ID: 1112039680

View in Genome Browser
Species Human (GRCh38)
Location 13:95534297-95534319
Sequence AACCATATGAAGCTACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112039678_1112039680 18 Left 1112039678 13:95534256-95534278 CCTTCAAATAGGAAAGAAAAAGA 0: 1
1: 0
2: 11
3: 176
4: 1792
Right 1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112039680 Original CRISPR AACCATATGAAGCTACTGCC AGG Intronic
902060533 1:13638357-13638379 AACCATATCAAGCATCTACCAGG + Intergenic
903834050 1:26191229-26191251 CACCATAGGAAGCCTCTGCCTGG - Intronic
909823189 1:80092377-80092399 AACCAAATGAAGCTGCTGAAGGG - Intergenic
909895016 1:81057946-81057968 AACTATATGAAGATATTTCCAGG - Intergenic
912752811 1:112299509-112299531 AACCAAATGATGATTCTGCCTGG + Intergenic
913658197 1:120981880-120981902 AACCATATAAAGTAACTTCCAGG + Intergenic
914522765 1:148433145-148433167 AACCATATAAAGTAACTTCCAGG + Intergenic
915291374 1:154886426-154886448 AACCACATGTACCTACTTCCTGG - Intergenic
918645571 1:186900332-186900354 AAACATATTAAGATACTTCCTGG + Intronic
924795276 1:247288298-247288320 AACCTTATGAAGCTTGTGCCAGG - Intergenic
1068518020 10:58047955-58047977 ATCCCTATGAAGCTACTGAGGGG - Intergenic
1068746092 10:60532358-60532380 AACCAAATGTAGCTGCTACCAGG - Intronic
1070018379 10:72558499-72558521 AACCAGAAGAAGCTACGGCAGGG + Intronic
1071907198 10:90187420-90187442 AACCATAGGAAGCTCCTATCTGG - Intergenic
1089714375 11:120343438-120343460 AAGCCTATGAAGCTAGTGCCTGG + Intronic
1093160384 12:15740021-15740043 AACCAAAAGAAGCTACTCCGAGG + Intronic
1093745623 12:22737618-22737640 ATCCATGTGAAGCTACTCCCTGG - Intergenic
1097568665 12:61303313-61303335 AAACATATGAAGCTTCACCCAGG + Intergenic
1097794797 12:63850067-63850089 CACCCTGTGAAGCTGCTGCCTGG - Intronic
1099330753 12:81282991-81283013 AAGCATATGAATCTCCTACCTGG + Exonic
1099797190 12:87413878-87413900 CACCTTATCAAGCTACTCCCTGG + Intergenic
1102486335 12:113260269-113260291 GAGCATATGAAGGGACTGCCAGG + Intronic
1102788831 12:115626565-115626587 AAACATATGAAACTAATTCCAGG - Intergenic
1103576400 12:121880785-121880807 AACAATAATAAGATACTGCCTGG - Intergenic
1106504715 13:30361027-30361049 AACCATATGAAGCCAGTGCCTGG + Intergenic
1109063571 13:57653027-57653049 AACCTCTTGAAACTACTGCCAGG - Intronic
1109381723 13:61569973-61569995 AACCATATGAAGGTTCTTCTTGG - Intergenic
1110548063 13:76779038-76779060 ACCCATATAAAGCAACTGCAAGG + Intergenic
1111274559 13:85931803-85931825 ACCCATATGAAGTTACAGCCAGG - Intergenic
1111279983 13:86009945-86009967 AGTCATGTGAAACTACTGCCTGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1115103073 14:29726549-29726571 GACCTTAAGAAGCTACTGTCGGG + Intronic
1116403950 14:44545154-44545176 AACAATCTGAAGGTACTGCTGGG + Intergenic
1118298771 14:64595368-64595390 AACTTTATGAACCTGCTGCCAGG - Intergenic
1126844591 15:52746951-52746973 AGCCATGCGAAACTACTGCCTGG + Intergenic
1133466717 16:6034492-6034514 CACCATATGAAGATGCAGCCAGG - Intronic
1134414614 16:14032726-14032748 AACCCCAGGTAGCTACTGCCAGG + Intergenic
1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG + Intronic
1139297447 16:65915085-65915107 AACCAGATAAAGATATTGCCAGG - Intergenic
1141343935 16:83228188-83228210 AAACATATGCAGACACTGCCAGG - Intronic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1146605237 17:34252198-34252220 AAAGATCTGAAGCCACTGCCTGG - Intergenic
1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG + Intergenic
1157188573 18:45561159-45561181 AACCATAAGACTCTTCTGCCTGG - Intronic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1161320613 19:3639091-3639113 GACCGTATGAAGCCCCTGCCTGG - Intronic
1165143607 19:33717801-33717823 TGTCATATGAAACTACTGCCTGG + Intronic
1165960175 19:39527549-39527571 TAACATATGAATATACTGCCGGG + Intergenic
927151147 2:20196899-20196921 AACCAGAGGAAGCTAGGGCCTGG + Intergenic
927843555 2:26460179-26460201 AACCAGATGAAGCTCGTGTCGGG + Exonic
928829683 2:35465502-35465524 AAGCACATGAAGCTACTTGCAGG - Intergenic
932831225 2:74991989-74992011 AACCATATAAAGTAACTTCCCGG + Intergenic
937123826 2:119460251-119460273 AACCAAAAGAAGCTAATGCTTGG + Intronic
937560440 2:123218184-123218206 AACAATATGAAGTTAATACCAGG - Intergenic
940098083 2:150001418-150001440 ACCCATCTGATGCTTCTGCCAGG + Intergenic
944382260 2:199124943-199124965 AACTATAGGAAGCTAATGCAAGG + Intergenic
944466714 2:200008679-200008701 AACCATAAGAAACTACTACAAGG + Intergenic
946920744 2:224579720-224579742 AACTAACTGAAGCTACTTCCAGG + Intronic
1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG + Intronic
1171266138 20:23773511-23773533 AACCATAGGAAGCAGCTGCAGGG - Intergenic
1174114157 20:48215438-48215460 CACCATTTGAAGCTCCTCCCAGG - Intergenic
1174215097 20:48910520-48910542 AACCATATAAAGTAACTTCCTGG + Intergenic
1178155518 21:29849320-29849342 AACAATATTAAGTTATTGCCAGG + Intronic
1181446962 22:22984435-22984457 AACCATAGGAAACTTCTTCCTGG + Intergenic
949239986 3:1859478-1859500 AACCATATCAACCTAGTCCCAGG - Intergenic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
951203806 3:19904209-19904231 AACCACATGAAACTAATGCATGG - Intronic
952058665 3:29480480-29480502 AACCAGATGAAGGTAATGCATGG + Intronic
952598549 3:35049450-35049472 AACCATTTGAAACTAATGACAGG + Intergenic
953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG + Intronic
957144437 3:76405209-76405231 AACCTTAAGAAGCTTCTGGCTGG - Intronic
958588152 3:96118018-96118040 TACCCTCTGAAGCAACTGCCTGG - Intergenic
958944501 3:100348488-100348510 AGTCATATGAAACTGCTGCCTGG + Intronic
960675328 3:120188657-120188679 GACCAAATGAAGCTAATCCCAGG + Intronic
962435504 3:135362803-135362825 ATTCAGATGAGGCTACTGCCAGG - Intergenic
966691317 3:182744535-182744557 AAACATATGACCATACTGCCAGG + Intergenic
967936745 3:194734627-194734649 ATCCATAAGAAGCAACTCCCTGG + Intergenic
975713179 4:77180642-77180664 AAACACATGAAGCTACTGAAGGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
980159461 4:129141888-129141910 ATCCATATGAATATACTGCTAGG - Intergenic
983651597 4:170041580-170041602 GTCCATATGAGGCTACTCCCTGG - Intergenic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
984272686 4:177566833-177566855 AACCACATTAAGCTTCTGCTTGG + Intergenic
986589002 5:9349362-9349384 AACCAACTGTAGGTACTGCCTGG + Intronic
986945834 5:13018239-13018261 AACCTTATGAAACTAGTGCAAGG + Intergenic
987058245 5:14216848-14216870 TACCATATGAAGCTATTACAAGG - Intronic
993346864 5:86794940-86794962 AACCATATTATGCTTCTCCCAGG - Intergenic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
1005118755 6:22367632-22367654 AACCTTCTGAAGCTCCTCCCTGG + Intergenic
1005225483 6:23637381-23637403 ATCTATATGAATCTACAGCCAGG + Intergenic
1011194936 6:84771861-84771883 AACCAAATAAAACTTCTGCCTGG - Intergenic
1014382301 6:120757727-120757749 AATCAGATGAAACTACTGTCTGG - Intergenic
1015071745 6:129102772-129102794 AACTTTCTGATGCTACTGCCAGG + Intronic
1019280341 7:196618-196640 ACACACATGAAGCTAATGCCTGG - Intronic
1019496803 7:1344582-1344604 AACCATATCAGGCAGCTGCCAGG + Intergenic
1024010961 7:45266405-45266427 AGCCCTAGGAAGCTACTGCAGGG - Intergenic
1024435030 7:49342130-49342152 AACCATATGAGGCAACTCCTGGG - Intergenic
1034702612 7:153109402-153109424 AACCTTTTGAAGTCACTGCCAGG - Intergenic
1035575024 8:698866-698888 AACCATAGGATGCTACTTCGTGG - Intronic
1040743256 8:50605678-50605700 AACAATATGAAGTTAAAGCCAGG + Intronic
1041710287 8:60888173-60888195 AACTATATGAAGCCTCTGCCAGG - Intergenic
1043936888 8:86152740-86152762 AATAATATTAAGCTACTGACTGG - Intronic
1046300962 8:112288432-112288454 ATCCCTATGAAGTGACTGCCTGG - Intronic
1055702361 9:78959214-78959236 AACCTTAAGAAATTACTGCCAGG - Intergenic
1055914948 9:81391483-81391505 AAACATACAAAGCTACAGCCCGG + Intergenic
1056619165 9:88196145-88196167 AGCCATGTGAAACCACTGCCTGG - Intergenic
1060860215 9:126947864-126947886 AAATATATGTAGCTACTGCAGGG + Intronic
1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG + Intronic
1186851652 X:13585873-13585895 AACAACATGAAGCTGATGCCTGG - Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1192862209 X:75086967-75086989 AGCCATATAAAGCAACTTCCAGG - Intronic
1196666651 X:118324286-118324308 AACCATATGAAGATAGGGCGAGG - Intergenic
1197294940 X:124707431-124707453 AATCATGTGAAACTGCTGCCTGG - Intronic