ID: 1112040115

View in Genome Browser
Species Human (GRCh38)
Location 13:95538753-95538775
Sequence GTACAGCAGGACAACGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112040115 Original CRISPR GTACAGCAGGACAACGGTGT TGG (reversed) Intronic
911225921 1:95305508-95305530 GTACAGAAAGAAAACGGGGTGGG + Intergenic
912158669 1:106953825-106953847 GTATAGCAGTATAACTGTGTGGG - Intergenic
916249888 1:162726759-162726781 CTACAGAAGAACAACAGTGTTGG + Intronic
918663023 1:187113219-187113241 GTAGAGAAGGACAATGGTATGGG - Intergenic
920380775 1:205533354-205533376 GGGCAGCAGGACGAGGGTGTGGG + Intergenic
1062803294 10:395902-395924 GCATAGCAGGAGAACAGTGTGGG - Intronic
1071399050 10:85251551-85251573 TCACAGAAGGACAACAGTGTGGG - Intergenic
1071542366 10:86498229-86498251 CTACAGCAGGACAAGGGCGCTGG + Intronic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075428820 10:122363900-122363922 CTACAGCAGGACACCTGTGTTGG + Intergenic
1082757448 11:57092093-57092115 GTACAGCAGGTGTACCGTGTTGG + Intergenic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1089337866 11:117737505-117737527 GGACAGCAGGACAGCGGGGCAGG + Intronic
1091847619 12:3669533-3669555 GTGCAAAAGGACAAGGGTGTGGG + Intronic
1092172671 12:6383710-6383732 GTAGGGCAGGACAACGGGGGAGG + Intronic
1094488515 12:30943838-30943860 GCACAGAAGGACAAGGCTGTTGG + Intronic
1096501908 12:52069465-52069487 GTCCTGCAGTACAGCGGTGTGGG + Intronic
1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG + Intronic
1105674978 13:22661450-22661472 ATACAGCAGGACAACCTTCTAGG + Intergenic
1109993517 13:70090391-70090413 CTACAACAGTACAAAGGTGTAGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG + Intronic
1120583592 14:86284422-86284444 ATACAGCAGGACAACCTGGTGGG + Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1159022522 18:63155354-63155376 GTACAGCAAGTCAACAGTATCGG + Intronic
1163110028 19:15154280-15154302 GTACAGCAGGACAGGAGTATTGG - Intergenic
1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG + Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927096667 2:19752454-19752476 GGAAAGCAGGACATGGGTGTAGG - Intergenic
931643995 2:64405129-64405151 GTAGAGCAGGACTACTGTGTAGG - Intergenic
935053537 2:99544742-99544764 GTGCAGCAGGACAACGGAAGAGG + Intergenic
938169411 2:129061580-129061602 GGCCAGCAGGGCAATGGTGTGGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
944958660 2:204842772-204842794 GTACAGCAGGCCTGCGCTGTGGG + Intronic
945864361 2:215160423-215160445 GTCCAGCAGGAAAAAGTTGTTGG - Intergenic
1169873448 20:10271490-10271512 TTAGAGCAGGACAAAGGTGTGGG + Intronic
1177993485 21:28067048-28067070 GTACAGCAGGGCAGAGGGGTTGG + Intergenic
954385930 3:50243843-50243865 GGACAGCAGGCAGACGGTGTGGG + Intronic
956867738 3:73386064-73386086 GTGCAGTAGGACACCTGTGTAGG + Intronic
968360798 3:198145381-198145403 GTACAGCTGCTCAACTGTGTGGG - Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
989212929 5:38874729-38874751 GTACAGGGGGACACAGGTGTTGG + Intronic
1002206925 5:177569290-177569312 GTCCAGCAGGGCAGCGGGGTGGG + Intergenic
1004285571 6:14317802-14317824 ATGCATCAGGACCACGGTGTTGG + Intergenic
1005913360 6:30329727-30329749 GTCCAGTGGCACAACGGTGTGGG - Exonic
1006818532 6:36871217-36871239 ATAAAGCAGGAAAAGGGTGTGGG - Intronic
1007825256 6:44595235-44595257 GGTCAGCAGGACAATGGTGTAGG - Intergenic
1008530874 6:52457282-52457304 GGTCAGAAGGACAAAGGTGTGGG + Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1024594809 7:50923010-50923032 GTGCAGTAGGACAGCTGTGTTGG + Intergenic
1030230994 7:107208390-107208412 ACACAGCAGGACAACTGTTTTGG + Intronic
1035069080 7:156127722-156127744 GAACAGGAGGACAACGGGCTCGG + Intergenic
1038480678 8:27899718-27899740 GTACAGCATGGCAAGGGTTTGGG - Intronic
1044355090 8:91213158-91213180 GGAGAGCAGGACCACTGTGTGGG + Intronic
1046334983 8:112773536-112773558 GTACAGCAAGACAACAGTGAAGG + Intronic
1049509631 8:143021011-143021033 GCACAGCTGGACAAAGGTCTGGG - Intronic
1052078537 9:24174947-24174969 GTACAGCAGAAAAACGGAATGGG - Intergenic
1054734380 9:68735737-68735759 GTAAAGCAGGATAAGGGAGTAGG + Intronic
1054814288 9:69460219-69460241 GAACAGCAGGGCATCTGTGTGGG - Intronic
1055854521 9:80669912-80669934 CTACTGCAGGACCAAGGTGTGGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060370633 9:123067183-123067205 CTGCAGCAGGACAATGGTATGGG - Intronic
1062406252 9:136398006-136398028 GTACAGAAAGACACCAGTGTTGG + Intronic