ID: 1112041679

View in Genome Browser
Species Human (GRCh38)
Location 13:95553316-95553338
Sequence GCATGAACTCTGGGTCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112041679_1112041694 29 Left 1112041679 13:95553316-95553338 CCGCTGGGACCCAGAGTTCATGC 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1112041694 13:95553368-95553390 CCCTACGTTCCCCGAAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 49
1112041679_1112041692 28 Left 1112041679 13:95553316-95553338 CCGCTGGGACCCAGAGTTCATGC 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041679_1112041689 24 Left 1112041679 13:95553316-95553338 CCGCTGGGACCCAGAGTTCATGC 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1112041689 13:95553363-95553385 CCCTCCCCTACGTTCCCCGAAGG 0: 1
1: 0
2: 1
3: 4
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112041679 Original CRISPR GCATGAACTCTGGGTCCCAG CGG (reversed) Intronic
901402063 1:9021457-9021479 GCACTCACTCAGGGTCCCAGCGG - Intronic
903275310 1:22217907-22217929 TCATTAACTCTGGGCCCCAGGGG - Intergenic
905468617 1:38175221-38175243 GCATAAAATATGGGTCACAGTGG - Intergenic
906163324 1:43667522-43667544 GCACTAACTCGGGGTCACAGAGG - Intronic
907212545 1:52835953-52835975 GCTTGAACCCTGGGACCCAGAGG + Intergenic
910713151 1:90202686-90202708 GCATGAGCTCTGGGTAGAAGTGG + Intergenic
912070040 1:105797716-105797738 AGATGATCTCTGAGTCCCAGGGG + Intergenic
915108173 1:153547061-153547083 CCATGAGCACTGAGTCCCAGGGG + Intronic
915375013 1:155386469-155386491 GCTTGAACTCCGGGTGGCAGAGG - Intronic
915544966 1:156591939-156591961 CCATGACCTCTGAGTCCCAGCGG - Exonic
919560232 1:199109337-199109359 CCATGCTCTCTGGTTCCCAGTGG + Intergenic
920563763 1:206957908-206957930 GCAAGAACTCTGGGTCCCCCTGG - Intergenic
1063616920 10:7608198-7608220 GCATGAGCTGCGGGACCCAGAGG - Intronic
1067516396 10:46949430-46949452 ACATGAACACTGGCTCCCTGTGG - Intronic
1067645856 10:48102363-48102385 ACATGAACACTGGCTCCCTGTGG + Intergenic
1067763086 10:49064494-49064516 GCATGCTCTCTGGATCCCTGGGG + Intronic
1070305852 10:75238768-75238790 CCTTGAACCCTGGGACCCAGAGG + Intergenic
1070325435 10:75385601-75385623 GCATGGTGACTGGGTCCCAGGGG + Intergenic
1072203150 10:93179147-93179169 GCATGAACTCTATTTCACAGGGG + Intergenic
1073034430 10:100553372-100553394 GCCTGACCTCTGCATCCCAGTGG + Exonic
1076466933 10:130689330-130689352 GCAAGAACCCTGGGTGCCTGTGG - Intergenic
1076860275 10:133136711-133136733 GGCTGATCTCTGGGTCCCTGTGG + Intergenic
1076860607 10:133137653-133137675 GGCTGATCTCTGGGTCCCTGTGG + Intergenic
1076860908 10:133138466-133138488 GCCTGGTCTCTGGGTCCCTGTGG + Intergenic
1076861284 10:133139469-133139491 GCCTGGTCTCTGGGTCCCTGTGG + Intergenic
1077872569 11:6274398-6274420 GACAGAACTCTGGGTCCAAGGGG + Intergenic
1078449827 11:11432427-11432449 GCATGGCCTCTGCATCCCAGAGG - Intronic
1083602921 11:63960179-63960201 GCAGGAGCTATGGGCCCCAGAGG + Intergenic
1083882539 11:65555617-65555639 GCCTCAGCTCTGGGTCCCACAGG + Intronic
1083924810 11:65799539-65799561 GCTTGAACCCTGGGAGCCAGAGG - Intergenic
1085508047 11:77071281-77071303 CCCTGAACTCTGGCTACCAGGGG - Intronic
1088344744 11:108810275-108810297 GCCTGAACTCTGGGCCCCAGGGG + Intronic
1088683932 11:112269247-112269269 GGATGAACTGTGGGTTCCTGTGG + Intronic
1089286009 11:117408609-117408631 GGTGGAACTCTGGGCCCCAGAGG + Intronic
1089620846 11:119721368-119721390 GCTTGAACTCAGACTCCCAGTGG + Intronic
1090909855 11:131109506-131109528 GTATGAACTCAGAGACCCAGAGG + Intergenic
1093351659 12:18109992-18110014 GCATGCACACTGAGGCCCAGAGG + Intronic
1093505740 12:19863841-19863863 CCAGGTACTCTGGGTCCCAGAGG - Intergenic
1094143612 12:27206047-27206069 GGTAGAACTCTGGGTCTCAGTGG - Intergenic
1095296936 12:40537265-40537287 GCATGCACCCTGGTTCCAAGGGG - Intronic
1095978174 12:47954030-47954052 GCATGTACTCTTGGCCCCATAGG - Intergenic
1100759812 12:97794878-97794900 TCCAGAACTCTGGGTCCAAGAGG - Intergenic
1101943308 12:109116801-109116823 GCATGCACTTGGGGTCCCCGGGG + Intronic
1103254646 12:119530716-119530738 GCCTGATCTGTGGGTCACAGAGG + Intronic
1104379204 12:128291996-128292018 GGAGGAACAATGGGTCCCAGGGG - Intronic
1105005967 12:132720780-132720802 GCATGAACCCCGTGTCCCCGAGG - Exonic
1106637079 13:31540464-31540486 GCATGCATTCTGGGTCCACGTGG - Intergenic
1106875018 13:34062192-34062214 CCATGAACCATGGGTCACAGTGG + Intergenic
1108285306 13:48901089-48901111 GGATCAATCCTGGGTCCCAGAGG - Intergenic
1112041679 13:95553316-95553338 GCATGAACTCTGGGTCCCAGCGG - Intronic
1113565105 13:111315169-111315191 ACATCAACTCTGGATTCCAGAGG + Intergenic
1113663765 13:112126377-112126399 CCATGTACTCTGGCTCACAGGGG + Intergenic
1115983692 14:39081892-39081914 TCATTAATTCTAGGTCCCAGCGG - Intronic
1116435668 14:44893050-44893072 TCATGAACTTTGAGTCCCTGAGG - Intergenic
1117769757 14:59121417-59121439 GAAGGAATTCTGGGTCCCATTGG - Intergenic
1118892169 14:69919640-69919662 GCATGAGATCTGAGTCCCACTGG - Intronic
1120628465 14:86858763-86858785 GAAAGAACTGTGGCTCCCAGGGG + Intergenic
1122250611 14:100436847-100436869 GCAAAAGCTCTGGCTCCCAGAGG + Intronic
1122458954 14:101879569-101879591 GCACGAACTCTGGGTGGCAGAGG - Intronic
1122863214 14:104591758-104591780 TCATGAACTCAGGGAGCCAGGGG + Intronic
1124658091 15:31524706-31524728 GCCAGAACTATGGCTCCCAGGGG + Intronic
1125827791 15:42690895-42690917 GCATGTACTCTGAGCCCCTGAGG + Exonic
1125956422 15:43793704-43793726 GCATGATCTCCGAGTCCCTGGGG - Exonic
1126502692 15:49363936-49363958 GCATGAACCTTGTGTCCAAGAGG + Intronic
1128584414 15:68835197-68835219 TCATGACCTCAGGGTACCAGAGG + Intronic
1128865907 15:71115295-71115317 GGATGGTCCCTGGGTCCCAGGGG - Exonic
1130106436 15:80932101-80932123 GCTCAAACTCTGGGACCCAGGGG - Intronic
1130865667 15:87931271-87931293 GCATGCCCTTTGGGCCCCAGGGG + Intronic
1130885747 15:88091037-88091059 GTGTGAACCCTGGGCCCCAGAGG + Intronic
1131441469 15:92462871-92462893 GCATGCGTTCTGAGTCCCAGAGG + Intronic
1133229205 16:4358510-4358532 CCATGAGCTCTAGGTCCCAGCGG - Intronic
1135956733 16:26962358-26962380 GCTTGAAGCCTGGCTCCCAGAGG - Intergenic
1136124715 16:28169690-28169712 GCCTGAACTCTGGGTGCCTGCGG + Intronic
1137501412 16:49014288-49014310 CCATGAACTCTCCATCCCAGAGG - Intergenic
1138625606 16:58249122-58249144 GCATGGACTTTGGGTTCCACCGG + Intronic
1139243295 16:65416388-65416410 GCATGATGTCTGGGTACCAAGGG - Intergenic
1139355386 16:66364433-66364455 GCATGAGCTGTGGGCCCCAGGGG - Intergenic
1143345298 17:6244798-6244820 GCAGGAAGTCTGGTTCCAAGAGG - Intergenic
1144792576 17:17869007-17869029 GCAGAAGCTCTGGGGCCCAGAGG + Intronic
1145291035 17:21546058-21546080 GCTGGAGCTGTGGGTCCCAGGGG - Intronic
1145905126 17:28512049-28512071 TCATTAGCTCTGGGTCCCTGTGG - Intronic
1146760115 17:35469724-35469746 GTATGAGCTCTGGGTCACAGCGG - Intronic
1147174310 17:38643617-38643639 GGAGGATCTCTGGGGCCCAGGGG + Intergenic
1147449335 17:40494085-40494107 CCAGGAACCCTGGGTGCCAGAGG + Intronic
1149494865 17:57110978-57111000 GTCTGAACTCTGGGTCAGAGTGG + Intronic
1150266854 17:63837671-63837693 GCATGGGCTATGGGTCCCGGAGG - Intronic
1151383865 17:73743402-73743424 TCATGGTCTCTGGGACCCAGAGG + Intergenic
1152258689 17:79254979-79255001 GCAGGAACTGTGGGTCAGAGCGG + Intronic
1153289062 18:3482479-3482501 GCATCAGCTCTGGGTCGCTGTGG + Intergenic
1153332652 18:3889824-3889846 GCATCAACTCTGGCTTCCAGTGG - Intronic
1155873746 18:31059088-31059110 GCCTGAACTTTGGGTCCCTTGGG - Exonic
1157175272 18:45446128-45446150 GCGTGAACCCTGTGTGCCAGGGG - Intronic
1158341894 18:56474948-56474970 AGATGACCTCTGGGTCTCAGGGG + Intergenic
1159020430 18:63138649-63138671 GGAGGAACTCTGGGTCCAGGGGG + Intronic
1160049026 18:75414539-75414561 GCATTACCTCTGGGGCCCAGGGG + Intronic
1161872316 19:6879663-6879685 TCTTGAACTCTGGGCCCAAGTGG - Intergenic
1162195245 19:8979651-8979673 GCTGGAACTCTGCCTCCCAGAGG + Exonic
1162393414 19:10403199-10403221 GCAGGGACTCAGGGTCCCAATGG + Intronic
1166364759 19:42272806-42272828 GCATGGTCTCAGGTTCCCAGGGG - Intronic
1167279678 19:48559644-48559666 GGAGGAACTGTGGGACCCAGTGG + Intronic
925207794 2:2021933-2021955 GCATGATGTCTTGGTCACAGTGG - Intronic
927515104 2:23667703-23667725 CCATGAACTCAGGGTCCTAGGGG - Intronic
928383846 2:30847127-30847149 GGATTAACCCTGGGTCACAGGGG + Intergenic
933649147 2:84835256-84835278 GCTGTAACTCTAGGTCCCAGAGG - Intronic
935875835 2:107506133-107506155 GTAAGAACTCTGGGAGCCAGAGG + Intergenic
936288154 2:111197691-111197713 GCATGGAGACTGGGGCCCAGGGG - Intergenic
937298919 2:120826668-120826690 GCATGTACTCTGCGTCACACAGG + Intronic
937556547 2:123165112-123165134 GAATCAACTGTGGGTCCCAGAGG + Intergenic
938210699 2:129463880-129463902 GTATGAACTCTGGGGATCAGAGG - Intergenic
940017488 2:149122161-149122183 CCATGAAAACTGGGTCACAGTGG + Intronic
940136988 2:150448056-150448078 GCATGAAGCCTGGTTGCCAGAGG - Intergenic
940260166 2:151771035-151771057 GGATGAAGTCTGGGTCTCCGGGG + Intergenic
944422611 2:199547170-199547192 TCAGGAACTCTGGGTCCATGAGG + Intergenic
945202428 2:207296091-207296113 GGATGAACTTTGGGTATCAGTGG - Intergenic
946842678 2:223834308-223834330 GCATGAACAATTGGGCCCAGTGG - Intronic
947534938 2:230934472-230934494 CCCTGAGCTCTTGGTCCCAGGGG + Intronic
948141342 2:235674396-235674418 GCATGCTCTCTGCATCCCAGTGG + Intronic
1168916497 20:1492508-1492530 GTATGTCCCCTGGGTCCCAGAGG + Intergenic
1170757471 20:19217081-19217103 GCATGACATCTGGGTCGCAAGGG + Intronic
1170852911 20:20020383-20020405 ACATGAACACTGGGGGCCAGGGG + Intronic
1171933174 20:31246782-31246804 CCTTGAGCTCTGGGTCCCTGGGG + Intergenic
1172804205 20:37599559-37599581 GCACGGACTCTGGATCACAGGGG - Intergenic
1173064796 20:39700091-39700113 ACCTGAACTTTGGATCCCAGCGG - Intergenic
1175871059 20:62209695-62209717 ACATGAACCCTGGAGCCCAGGGG + Intergenic
1178140536 21:29678088-29678110 ACCTGATCTTTGGGTCCCAGTGG - Intronic
1178523669 21:33306622-33306644 GGAGGACCGCTGGGTCCCAGTGG - Intergenic
1179594126 21:42430826-42430848 GCATGAGTCCTGGGTGCCAGAGG + Intronic
1180644585 22:17328017-17328039 GCTTGAACCCTGGGTGGCAGAGG + Intergenic
1180822791 22:18843172-18843194 GCAAGAATTCTTGGGCCCAGTGG + Intergenic
1181190172 22:21132853-21132875 GCAAGAATTCTTGGGCCCAGTGG - Intergenic
1181209030 22:21277671-21277693 GCAAGAATTCTTGGGCCCAGTGG + Intergenic
1181502874 22:23328526-23328548 GCAAGAATTCTTGGTCCCAGTGG - Intergenic
1181653675 22:24276902-24276924 GCAAGAATTCTTGGGCCCAGTGG - Intronic
1184113652 22:42409681-42409703 GCCCGAACCCTGGCTCCCAGGGG - Intronic
1184149879 22:42631714-42631736 GAATGAACCCAGGGTCCCAAAGG + Intronic
1203217909 22_KI270731v1_random:17777-17799 GCAAGAATTCTTGGGCCCAGTGG - Intergenic
1203272928 22_KI270734v1_random:69080-69102 GCAAGAATTCTTGGGCCCAGTGG + Intergenic
949781848 3:7698510-7698532 GCATGATCTCTGGGCCCAAATGG - Intronic
950078345 3:10203477-10203499 GTTTGAACTCTGGGGCTCAGTGG - Intronic
951708720 3:25568786-25568808 CCATGTTCTCTGGGGCCCAGCGG - Intronic
952035522 3:29196161-29196183 GCATGAAGCCTGGGTCTGAGGGG + Intergenic
952718254 3:36504241-36504263 ACCTGAACGCTGGGTCACAGAGG + Intronic
953347509 3:42188537-42188559 GCATGAACTCCAGAGCCCAGTGG + Intronic
954635247 3:52067634-52067656 CCATGAACTCTATGGCCCAGTGG + Intergenic
959538232 3:107511232-107511254 GTATGAACTAAGGCTCCCAGTGG - Intergenic
959623480 3:108423905-108423927 TCATGAATCCTGGGTTCCAGAGG + Intronic
961037709 3:123653933-123653955 GCATAGAGTGTGGGTCCCAGGGG - Intronic
961439545 3:126944788-126944810 TCCTGAAATCTGGGGCCCAGTGG + Intronic
962650225 3:137480929-137480951 GGATGTGCTCTGGGGCCCAGGGG - Intergenic
966410710 3:179643350-179643372 GGATGAGCTTAGGGTCCCAGTGG - Intergenic
967861625 3:194156230-194156252 GCAGGAACTCAGAGTGCCAGAGG + Intergenic
968889999 4:3363799-3363821 CCCTGACCCCTGGGTCCCAGGGG - Intronic
969443100 4:7228794-7228816 GCATGGACTGAAGGTCCCAGAGG - Intronic
970004426 4:11396925-11396947 GCATGAACTGTGGATGCAAGAGG - Exonic
970446374 4:16126365-16126387 GCATGGACCCTGGGTCCCTGGGG - Intergenic
970879351 4:20910091-20910113 GCATCAGGTCTGGATCCCAGTGG - Intronic
972345009 4:38185492-38185514 GCACAATCTCTGGGTCCAAGAGG + Intergenic
972723405 4:41723451-41723473 GCTTGATCTGTCGGTCCCAGGGG + Intergenic
976992463 4:91384010-91384032 GAATCAACTTTGGCTCCCAGTGG + Intronic
977530571 4:98195799-98195821 TCTTGAACTCCGGGCCCCAGTGG - Intergenic
978816772 4:112915228-112915250 TCATGAACTTTGAGTCCCTGAGG - Intronic
980105281 4:128582660-128582682 ACAAGAACTCTAGGACCCAGTGG + Intergenic
980960787 4:139472519-139472541 TCATGAAGTCTGGATCCCATAGG + Intronic
981718331 4:147774322-147774344 GCATGAACTCTTGTTCTTAGTGG + Intronic
985097268 4:186425671-186425693 GCATGGCCTCTGGGTCTCAGAGG - Intergenic
985825599 5:2188690-2188712 GCATTATCTATGGGTCTCAGAGG + Intergenic
986687316 5:10286135-10286157 TCAAGAGGTCTGGGTCCCAGTGG - Intronic
987006681 5:13717477-13717499 ACGTGAGCTCTGGGTCCCAGTGG - Exonic
990787525 5:59439274-59439296 GCTTGAACCCTGGGAGCCAGAGG + Intronic
993547373 5:89229704-89229726 GCCTGAAACCTGGGTCCCAGTGG + Intergenic
995240885 5:109884632-109884654 GCATGAACCCCGTGTCCCTGAGG + Exonic
995789934 5:115875588-115875610 GAACCAACTCTTGGTCCCAGAGG + Intronic
997224925 5:132202772-132202794 GCAGGAAGCCAGGGTCCCAGTGG + Intronic
998161404 5:139814734-139814756 TCCTGAGCTCTGGGTCCCAGAGG - Intronic
998311871 5:141140605-141140627 GCATGAAGTCTGGCTCCAACCGG + Intronic
1000518844 5:162274759-162274781 CCATGGGCTCTGGGGCCCAGAGG + Intergenic
1001304369 5:170560973-170560995 GCCTGGCCTCTGGGCCCCAGAGG - Intronic
1001325687 5:170722086-170722108 GCAGGAACTCAGGGACTCAGGGG + Intronic
1001479897 5:172081574-172081596 CCAGGAACCCTGGCTCCCAGAGG + Intronic
1002286478 5:178165834-178165856 CCATGACCGCTGAGTCCCAGCGG - Intergenic
1005696495 6:28356836-28356858 GCATGAGCTGTGGCACCCAGTGG - Intronic
1006132700 6:31878639-31878661 GCCTGGACTCTGGGTCCCTAAGG - Intronic
1008130265 6:47713172-47713194 CCATGGACTCTGGGTGGCAGAGG - Intronic
1014746557 6:125207740-125207762 GCATGAACATTGTGTTCCAGTGG - Intronic
1014899539 6:126946096-126946118 GCATTTATTCTGGGTCCCAGAGG - Intergenic
1016652260 6:146475905-146475927 GCCTGGAGTCTGGGTCCCTGAGG + Intergenic
1017887277 6:158609614-158609636 GCCTGAAGTCTGTGTCCCAGGGG - Intronic
1018098335 6:160413332-160413354 TCATGAACTATGGGATCCAGTGG + Intronic
1019194868 6:170275219-170275241 GCTTGAAAGCTGGGTCCCTGCGG + Intergenic
1020746931 7:12090641-12090663 GCATGGACTGTGGTACCCAGTGG + Intergenic
1021487392 7:21182460-21182482 CCAGGAACTCAGGGTCCAAGAGG - Intergenic
1023927192 7:44678068-44678090 GAATGACCTCTGCGTCCCTGTGG - Intronic
1024692446 7:51817850-51817872 GGATGAACACTGAATCCCAGAGG - Intergenic
1025035077 7:55588850-55588872 CCCTGAACTCAGGGTCCCAATGG + Intergenic
1027363006 7:77428734-77428756 GAATGAGCTCTGAATCCCAGAGG + Intergenic
1029536799 7:101162142-101162164 GCCACAACTCTGGGTGCCAGTGG - Intergenic
1030115157 7:106057320-106057342 GCATGGACTCCAGGACCCAGGGG + Intergenic
1030643135 7:112028147-112028169 GCATGAAGTACAGGTCCCAGAGG + Intronic
1032188115 7:129745209-129745231 GGTTGAAGTCTGTGTCCCAGAGG - Intronic
1033397360 7:140988250-140988272 GCTTGAACTCTGGGAGGCAGAGG - Intergenic
1034716713 7:153250086-153250108 GCATCAATTCTGACTCCCAGGGG - Intergenic
1036420841 8:8594097-8594119 TCCAGCACTCTGGGTCCCAGTGG + Intergenic
1037631844 8:20664761-20664783 GAATGAACTGTGGCTCACAGAGG - Intergenic
1037949808 8:23011603-23011625 GCAGGCAGTCTGGGTCCAAGGGG + Intronic
1040890931 8:52314968-52314990 GCATGAACCCTGGCCCCCACTGG + Intronic
1045883715 8:107071124-107071146 GCTGGAAGTCTGGGTTCCAGAGG - Intergenic
1047506241 8:125482907-125482929 GGAAGAAATGTGGGTCCCAGAGG - Intergenic
1048444555 8:134483697-134483719 GAATGATTTCTGCGTCCCAGGGG - Intronic
1055010820 9:71562900-71562922 GCATGAACTTAGTGTCCCATAGG + Intergenic
1056388589 9:86119582-86119604 CAGTGAGCTCTGGGTCCCAGGGG + Intergenic
1057964844 9:99492757-99492779 CCAAGAACTCTGAGTACCAGGGG - Intergenic
1061036105 9:128115148-128115170 GCTTGAATCCTGGGTCCCGGTGG + Intergenic
1061252220 9:129433028-129433050 GCCTGCACTTTGGGTCCCAAGGG - Intergenic
1187190771 X:17032720-17032742 GCATGTCCTCTGGGTCCTGGGGG + Intronic
1188119854 X:26291175-26291197 GCATGTACTCTAGGCCCCAATGG - Intergenic
1189558432 X:42168538-42168560 GCATGGCCTCTGGCTTCCAGTGG + Intergenic
1192945110 X:75957827-75957849 GTAGGAACTCTGGGTCCCCAGGG - Intergenic
1195110123 X:101639878-101639900 GCATGAGTTCTGGTTTCCAGTGG + Intergenic