ID: 1112041692

View in Genome Browser
Species Human (GRCh38)
Location 13:95553367-95553389
Sequence CCCCTACGTTCCCCGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112041684_1112041692 18 Left 1112041684 13:95553326-95553348 CCAGAGTTCATGCTGCAGGGGCT 0: 1
1: 0
2: 2
3: 9
4: 175
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041679_1112041692 28 Left 1112041679 13:95553316-95553338 CCGCTGGGACCCAGAGTTCATGC 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041685_1112041692 -10 Left 1112041685 13:95553354-95553376 CCTCCACCTCCCTCCCCTACGTT 0: 1
1: 0
2: 2
3: 144
4: 6079
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041683_1112041692 19 Left 1112041683 13:95553325-95553347 CCCAGAGTTCATGCTGCAGGGGC 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112041692 Original CRISPR CCCCTACGTTCCCCGAAGGC TGG Intronic