ID: 1112041692

View in Genome Browser
Species Human (GRCh38)
Location 13:95553367-95553389
Sequence CCCCTACGTTCCCCGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112041683_1112041692 19 Left 1112041683 13:95553325-95553347 CCCAGAGTTCATGCTGCAGGGGC 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041679_1112041692 28 Left 1112041679 13:95553316-95553338 CCGCTGGGACCCAGAGTTCATGC 0: 1
1: 0
2: 1
3: 22
4: 194
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041684_1112041692 18 Left 1112041684 13:95553326-95553348 CCAGAGTTCATGCTGCAGGGGCT 0: 1
1: 0
2: 2
3: 9
4: 175
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72
1112041685_1112041692 -10 Left 1112041685 13:95553354-95553376 CCTCCACCTCCCTCCCCTACGTT 0: 1
1: 0
2: 2
3: 144
4: 6079
Right 1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112041692 Original CRISPR CCCCTACGTTCCCCGAAGGC TGG Intronic
903132867 1:21290587-21290609 CCCCTCCCTTCCCCGGAGGTCGG + Intronic
903230429 1:21919028-21919050 CCCCATCTTTCCCCAAAGGCAGG + Intronic
912177332 1:107176062-107176084 CCCATATGTTCCCTGAAGGTAGG - Intronic
916694136 1:167220243-167220265 CCCCTACCTGCCCAGAGGGCCGG + Intergenic
919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG + Intergenic
920986734 1:210897701-210897723 TCCCTACATTCCCCAAAGGCAGG - Intronic
1069684395 10:70308471-70308493 CCTCTCAGTTCCCTGAAGGCAGG + Intronic
1074701596 10:116097329-116097351 CCCTTCTGTTCCCCAAAGGCAGG - Intronic
1078538860 11:12197604-12197626 CACATAGGTTCCCCGAAGTCAGG - Intronic
1081622949 11:44629854-44629876 ACCCTAAGTTCCTCGAGGGCAGG + Intergenic
1082193479 11:49274217-49274239 CCCCCCAGTTCCCCAAAGGCTGG + Intergenic
1083628775 11:64085393-64085415 GCCCTCCGTCCCCGGAAGGCAGG - Intronic
1088054213 11:105555634-105555656 CCTCTACATTCCCCAGAGGCTGG - Intergenic
1092255673 12:6925781-6925803 CTCCTTCCTTCCCTGAAGGCAGG + Intronic
1096112720 12:49038789-49038811 GCCCTAGGTTCCCCGTTGGCGGG - Exonic
1098942909 12:76558878-76558900 CTCCTACGTTACAAGAAGGCCGG + Intronic
1102600509 12:114026167-114026189 GCCCTCCCCTCCCCGAAGGCTGG - Intergenic
1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1118439179 14:65797699-65797721 ACTCTAAGTTCCCTGAAGGCAGG - Intergenic
1125794963 15:42397295-42397317 CCCCTAAGTTCCCCGAGGACTGG + Intronic
1127831109 15:62752359-62752381 CCCACACATTCCCCAAAGGCAGG - Exonic
1128260731 15:66231227-66231249 CCCCCACCATCCCCCAAGGCAGG + Intronic
1129267733 15:74403074-74403096 CCCCTGGCTTCCCCGAAAGCCGG + Intergenic
1131215026 15:90529703-90529725 CCCCAGCGTTCCCCGTACGCCGG + Intergenic
1133442519 16:5832629-5832651 CCTGTAAGTTCCCTGAAGGCAGG + Intergenic
1136242248 16:28951461-28951483 GCCCTACCCTCCCCGAACGCCGG - Intronic
1139472000 16:67183489-67183511 CCCCTGAACTCCCCGAAGGCAGG + Exonic
1139967921 16:70755879-70755901 CCCCTAGGTTCCCAGGTGGCTGG - Intronic
1141715862 16:85726516-85726538 CCCCCAGGATCCCCGCAGGCAGG + Intronic
1146720364 17:35119607-35119629 CGCCCATGTTCCCCGCAGGCCGG + Exonic
1151192504 17:72408718-72408740 CCACTACCCTTCCCGAAGGCAGG + Intergenic
1151343060 17:73484275-73484297 CCCCTTGGTTCCCTGAAGCCTGG - Intronic
1151798924 17:76365970-76365992 CCCCTCCGTCCCCGGAAGTCAGG - Intronic
1152524065 17:80877272-80877294 CCCCCACCCTCCCCGCAGGCAGG - Intronic
1160788837 19:913434-913456 CCCGTTCGTTCCCTGATGGCTGG - Intergenic
1163607289 19:18282023-18282045 CCCCTCCAGTCCCCGGAGGCCGG - Intergenic
1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
926004770 2:9365294-9365316 CCCCTTGGATCCCCGAAGGGTGG - Intronic
935446145 2:103158829-103158851 CTTCTACCTTCCCCTAAGGCAGG - Intergenic
944398736 2:199300814-199300836 TCTCTATGTTCCCAGAAGGCAGG + Intronic
1168897150 20:1331445-1331467 ACCCTAAGTTCCCTGAGGGCAGG + Intronic
1175234891 20:57503026-57503048 CCCCTAGGTCCCCCGAGGGAGGG + Intronic
1175497038 20:59422422-59422444 CCCCTAAGCTGCCCAAAGGCTGG - Intergenic
1178640072 21:34338332-34338354 ACCCTACGCTCCTTGAAGGCAGG + Intergenic
1179790644 21:43754159-43754181 CACCTACTGTCCCCGAAGGGCGG - Intronic
1181585328 22:23849804-23849826 CCCATTCATTCCCCGAGGGCTGG + Intergenic
1183300266 22:37055536-37055558 CCCCTAGGCTCCCAGAAGGCAGG - Intronic
1185052206 22:48559763-48559785 CCCCTCTGCTCCCCAAAGGCAGG - Intronic
950230395 3:11271059-11271081 CCCCCACCCTCCCCAAAGGCAGG - Intergenic
959739069 3:109695220-109695242 CCCATAGGTCCCCCGATGGCAGG + Intergenic
972690784 4:41395799-41395821 AACCTAAGTTCCCAGAAGGCAGG - Intronic
1002106280 5:176880830-176880852 CCCCTATGTGCCCCGGCGGCCGG - Exonic
1002561991 5:180088784-180088806 CCTCTCCGCTCCCCGGAGGCTGG + Intergenic
1007810296 6:44480857-44480879 ACCATAGGTTCCCCCAAGGCTGG - Intergenic
1020766795 7:12332033-12332055 TCCCTACCTTCCCCAAAGGAGGG - Intronic
1021313033 7:19116502-19116524 CCCCAGCGTCCCCGGAAGGCCGG - Intronic
1022088959 7:27095651-27095673 CCCCCAGGTTCCCGGAAGTCTGG + Exonic
1023576528 7:41634357-41634379 TCCCTAAGTTCCCCTAAGACTGG + Intergenic
1023995257 7:45155820-45155842 CCCCTAGGTCCCTCTAAGGCAGG - Intergenic
1024216504 7:47253667-47253689 CCCCTCCTTCCCCAGAAGGCAGG - Intergenic
1026771704 7:73205560-73205582 CTCCCACATTCCCTGAAGGCAGG - Intergenic
1027012572 7:74758957-74758979 CTCCCACATTCCCTGAAGGCAGG - Intronic
1027075468 7:75187096-75187118 CTCCCACATTCCCTGAAGGCAGG + Intergenic
1029294974 7:99533282-99533304 CCCCAACCTTCCTGGAAGGCAGG - Exonic
1031690524 7:124782467-124782489 CCCTTCCCTTCCCCCAAGGCAGG + Intronic
1034113052 7:148557236-148557258 CACCTACGGTCCCTGATGGCAGG + Intergenic
1034833534 7:154330849-154330871 CCTCTCCACTCCCCGAAGGCAGG + Intronic
1035330742 7:158095712-158095734 CTCCTACGCTCCTTGAAGGCAGG - Intronic
1043057554 8:75458590-75458612 CCCCTAAGTTTCTTGAAGGCAGG + Intronic
1044319982 8:90791318-90791340 GCCCGACCTTCCCCAAAGGCGGG - Intronic
1055587153 9:77767179-77767201 CCTCTAGGTTCCCCCAAAGCAGG + Intronic
1190215375 X:48476460-48476482 TCCCTCCTTTCCCCGCAGGCGGG - Intronic
1200003061 X:153072074-153072096 CCCGCACGTGCCCCGGAGGCAGG - Intergenic
1200004662 X:153077935-153077957 CCCGCACGTGCCCCGGAGGCAGG + Intergenic