ID: 1112045611

View in Genome Browser
Species Human (GRCh38)
Location 13:95594346-95594368
Sequence ATGTATCTATAGAAGCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112045611 Original CRISPR ATGTATCTATAGAAGCATGA TGG Intronic
901722904 1:11214642-11214664 AGGTATCTTTAAAAGCATAATGG + Intronic
902104139 1:14019487-14019509 ATGTATATATAGAAGCTTCTGGG - Intergenic
905011297 1:34748690-34748712 ATGTTTCTTTAGAACCGTGAAGG + Intronic
906095276 1:43218831-43218853 AGATATTTATTGAAGCATGATGG - Intronic
909000489 1:70211813-70211835 ATGTACCTCTAGAATGATGATGG - Intronic
909857336 1:80553128-80553150 ATGAATCTATAGAATCAGAAAGG + Intergenic
911259721 1:95671034-95671056 AATTATCTATAGAAGCATGTGGG + Intergenic
911365288 1:96930466-96930488 ATGTAGCTACAGCAGGATGAGGG + Intergenic
911419487 1:97621987-97622009 ATTTATTTATATAAGTATGATGG - Intronic
912249550 1:107996824-107996846 ATGTGTATAGAGAAGCAAGAAGG + Intergenic
912857866 1:113187799-113187821 ATCTTGCTATAGCAGCATGAGGG - Intergenic
913397259 1:118385675-118385697 ATGTCTCTATTGGAGCATTATGG - Intergenic
916585738 1:166148357-166148379 AAGCATCTATATAAGCATGATGG + Intronic
916903777 1:169258768-169258790 ACCTATCTATAGAACCATGCTGG - Intronic
916975444 1:170072775-170072797 ATGTATTTATACAGGCCTGATGG - Intronic
916979934 1:170124306-170124328 ATGTATATTTAAAAGCATGCTGG + Intergenic
917352001 1:174088071-174088093 ATGTATCTATAATAGAATGAGGG + Intergenic
919548965 1:198960881-198960903 ATGTATCTATATATATATGATGG - Intergenic
922318807 1:224466224-224466246 ATGTGACTATAAAAGCATCAGGG - Intronic
922356091 1:224777439-224777461 ATGTATATATAAAAGCCTGAAGG + Intergenic
924399927 1:243668266-243668288 ATGTACCTATATAAGCAAGAAGG + Intronic
1062778857 10:182098-182120 ATGTTTCTCTAGAAGCTTTAGGG + Intronic
1062949285 10:1485439-1485461 ATGTACCTATGGCAGCATGTGGG + Intronic
1063628282 10:7711578-7711600 CTGATTCGATAGAAGCATGATGG + Intronic
1065446911 10:25812156-25812178 TTGTATCTCATGAAGCATGAAGG + Intergenic
1065650486 10:27884272-27884294 ATGTTTCCATAGGAGAATGAGGG - Intronic
1065657405 10:27965921-27965943 ATGAATTGATATAAGCATGAAGG - Intronic
1068183595 10:53555552-53555574 ATGTATCTATAGAAAAATTTGGG + Intergenic
1068613186 10:59083252-59083274 TTTTATCTATAGAAGAATCATGG + Intergenic
1071174363 10:82907158-82907180 AAGAATCTCTAGAGGCATGAAGG - Intronic
1071790936 10:88953242-88953264 ATGTATTTATAGACGACTGAAGG - Intronic
1073044298 10:100627585-100627607 ATGTTGCTATGGAAGCTTGAAGG + Intergenic
1074341929 10:112640572-112640594 ATTTATCTATAGAAGCTAGTGGG - Intronic
1078389431 11:10923754-10923776 ACGTATATATAAAAACATGAGGG - Intergenic
1079338186 11:19589646-19589668 ATGTATCTAGAGCAGCAGGTGGG + Intronic
1079649975 11:22915695-22915717 ATTTATCTTTATAAGCATGCAGG + Intergenic
1081247372 11:40785277-40785299 CTGTAACTATAGAAAAATGATGG - Intronic
1081781454 11:45716006-45716028 ATGTAGGTAGAGAAGCATGTGGG - Intergenic
1084913057 11:72406861-72406883 ATGTATTTATAAAAGAAGGAAGG - Intronic
1085028324 11:73253467-73253489 ATGTATGTATCCAGGCATGATGG - Intergenic
1088926549 11:114308536-114308558 ATGCATCTATAAAAGCCTGAGGG - Intronic
1089264249 11:117246978-117247000 GTGTATGTATATATGCATGAGGG + Intronic
1091162253 11:133435109-133435131 CTGTATTTATAGAATCATTAAGG + Intronic
1093310156 12:17571577-17571599 ATGTACCAATTGAAGCATGAAGG + Intergenic
1093350641 12:18096701-18096723 ATGTATGTATACATGCATGTAGG + Intronic
1093350642 12:18096725-18096747 ATGTATGTATACATGCATGTAGG + Intronic
1095717452 12:45363026-45363048 ATGTGTCTATTTAAGCCTGAAGG + Intronic
1101217579 12:102600138-102600160 ATTTATTTATTGAAACATGATGG + Intergenic
1101467914 12:104966682-104966704 CTGTATCTTTAGAGGCATGTGGG + Intergenic
1103175449 12:118859438-118859460 ATGTATGTATACAAGGATGGAGG - Intergenic
1105009056 12:132742957-132742979 ATGCATCTGTAGAACCAGGAGGG - Intronic
1105351449 13:19619910-19619932 ATGTCTCTATGGGAGAATGAGGG + Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1108339128 13:49479128-49479150 ATGTGTATATAAAAGCATAAAGG + Intronic
1109215179 13:59581574-59581596 ATGTATGTATTTAAGCATCAGGG + Intergenic
1110958587 13:81590588-81590610 ATGTATATGTATAAGCATTATGG + Intergenic
1112045611 13:95594346-95594368 ATGTATCTATAGAAGCATGATGG + Intronic
1112136188 13:96580791-96580813 ATGTATCTATTAAAACATAAGGG - Intronic
1112585792 13:100717392-100717414 ATGATTCTATAGAAGCAGAATGG + Intergenic
1112689619 13:101877165-101877187 ATCTCTCTGTATAAGCATGAGGG - Intronic
1114914010 14:27239375-27239397 AAGCATCTCTAGAAGAATGAAGG + Intergenic
1116141207 14:40996542-40996564 ATGAGTATATTGAAGCATGAGGG - Intergenic
1119568712 14:75650982-75651004 TTCTATCTACAGATGCATGAGGG - Exonic
1120559036 14:85968599-85968621 ATGTTTCTACAGAAAAATGATGG + Intergenic
1124005193 15:25790012-25790034 ATGTATTTTTAAAATCATGAAGG + Intronic
1124227993 15:27912640-27912662 ATGTATTAATAGAAGCAATAAGG + Intronic
1126139074 15:45422301-45422323 AATTATCTATACATGCATGAAGG - Intergenic
1136612549 16:31375452-31375474 ATGTATCAATAGAAGCTTTGTGG - Intronic
1139766162 16:69232060-69232082 TTCTATATATAAAAGCATGAAGG + Intronic
1141289227 16:82702315-82702337 ATGTATTTCAAGAACCATGATGG - Intronic
1143559044 17:7681097-7681119 ATGTATGTATAGAATCATACTGG + Intronic
1146142033 17:30376771-30376793 ATGTAAATAAACAAGCATGAGGG - Intergenic
1146850324 17:36216039-36216061 CTGTATCAATGGGAGCATGATGG - Intronic
1149024135 17:52005191-52005213 ATGTATTTGTAGAATCATTAAGG - Intronic
1149723968 17:58873449-58873471 ATGTATCTAATGAAGCAAGTTGG + Intronic
1150527718 17:65940487-65940509 ATGTATCCATTGAAGGATAAAGG + Intronic
1154325222 18:13385934-13385956 ATGTTACTATAGATACATGAAGG + Intronic
1154942034 18:21123564-21123586 ATTTATCTCTAGAACTATGAGGG - Intergenic
1156062926 18:33102843-33102865 ATTTATCTACAAAAGCATGCAGG - Intronic
1158149223 18:54348417-54348439 ATGTATCTGTGGAATAATGAAGG - Intronic
1159437970 18:68442949-68442971 GTGTCTTTATAGCAGCATGATGG + Intergenic
1159593885 18:70363858-70363880 ATGGATCTACAGAACCAAGAGGG - Intergenic
1164304630 19:23994641-23994663 ATGGGTCCATACAAGCATGAAGG + Intergenic
1165174220 19:33915453-33915475 ATGTTTCTATGGAACTATGAGGG - Intergenic
1165421235 19:35722978-35723000 ATGTATCTATTGCAGCAGGCAGG - Exonic
1165443272 19:35843059-35843081 AGATATCTATGGAAGGATGATGG - Intronic
1167397082 19:49237027-49237049 GTGTATATATAGATACATGATGG - Intergenic
926099251 2:10103544-10103566 ATGCATGTTTAGAAGCCTGAAGG - Intergenic
926470466 2:13249372-13249394 ATGTCTCTAGAAATGCATGAGGG + Intergenic
926938596 2:18112446-18112468 ATGTATCTATAGTAACTAGAAGG + Intronic
927304369 2:21553824-21553846 ATGCATGTAAAGAAGCATGCAGG - Intergenic
928784749 2:34869748-34869770 TTTAATCTATAGAATCATGATGG - Intergenic
931631458 2:64304997-64305019 ATTTATCCATTGATGCATGATGG + Intergenic
933607141 2:84395163-84395185 CTTTATCTATTGAAGCAGGATGG - Intergenic
935247908 2:101235271-101235293 AAGTATTTACAGAATCATGAAGG + Intronic
935512999 2:103999580-103999602 TTGTATTTTTAGTAGCATGATGG - Intergenic
936488716 2:112950703-112950725 ATGTATCTGTAAAACCATTATGG + Intergenic
938001045 2:127738049-127738071 ATGTATCTATCAAAACAAGAAGG + Intronic
939908210 2:147945345-147945367 AAGTAATTATAGAAGCAAGAAGG - Intronic
939931044 2:148233311-148233333 ATGGAACTAAAGAAGCATTAGGG - Exonic
940083029 2:149826260-149826282 ATGTTTCTACAGGAGGATGAGGG + Intergenic
940755205 2:157674113-157674135 AGGTACCTCTGGAAGCATGAAGG + Intergenic
941200587 2:162504081-162504103 ATGTGTCTATTGAAGCTTTAGGG - Intronic
942557171 2:177183818-177183840 ATGTATCTATATATGTATGGTGG - Intergenic
942563325 2:177243395-177243417 AAGTATCTGTAGAAGCCTTACGG - Intronic
943138419 2:183945826-183945848 ATATATATATAAAAGCAGGAGGG + Intergenic
943746879 2:191471443-191471465 TTAGATCTATAGAAGCATCAAGG + Intergenic
944129547 2:196332318-196332340 ATGTTTCTATAATAGCATGATGG - Intronic
944787461 2:203087642-203087664 AAGTAGCTATAAAAGCATCAAGG - Intronic
946714337 2:222537472-222537494 ATGTATGTATAGAGATATGAAGG + Intronic
1169865032 20:10190776-10190798 TTCGGTCTATAGAAGCATGAAGG - Intergenic
1170239261 20:14145089-14145111 ATGTATCTATACAAGGGAGAAGG - Intronic
1170542887 20:17406864-17406886 ATGAATCTTTTGAAGCTTGAGGG - Intronic
1173322854 20:42004870-42004892 ATGTATTTATAGAATCATTAAGG - Intergenic
1177346825 21:19884027-19884049 ATGAATAAATATAAGCATGAGGG - Intergenic
1177350442 21:19932600-19932622 GTGTATTTATAGAAGGGTGAGGG + Intergenic
1179474718 21:41635819-41635841 ATGGATATATAGAGGGATGATGG - Intergenic
1179474741 21:41635981-41636003 GTGGATGTATAGAAGGATGATGG - Intergenic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1184977680 22:48074563-48074585 ATGTGTCTGTAGAAACATGCAGG + Intergenic
949794258 3:7829678-7829700 ATGTATCAATAGAAGAAAAAAGG + Intergenic
950906463 3:16543583-16543605 ATGTAGCTTGAGAAGCATGGTGG + Intergenic
951011627 3:17688796-17688818 AAGGATTTGTAGAAGCATGAAGG - Intronic
951480037 3:23150810-23150832 GTGTATTTATTGAAGCATCATGG + Intergenic
952600183 3:35070581-35070603 ATGTATATATATAAGCCAGAAGG - Intergenic
954828643 3:53398924-53398946 ATGTATGTATTGAAGGATGGAGG - Intergenic
955587570 3:60497803-60497825 ATGTACTTAAGGAAGCATGATGG - Intronic
956314411 3:67918098-67918120 ATGTATATAGAGAAACATAAAGG - Intergenic
956784989 3:72635073-72635095 ATGATCCTATAGAAGCACGAGGG + Intergenic
958686921 3:97410248-97410270 ATCTATCTTTAGAAAAATGAGGG - Intronic
964698330 3:159535292-159535314 ATATACCTGTAGAAGAATGATGG - Intronic
968319667 3:197754231-197754253 ATGTATCTCAATAAGCATAAAGG - Intronic
971907048 4:32739423-32739445 AGGTATCTATAGAGGCATGATGG - Intergenic
972165925 4:36283719-36283741 AAGTATCTTTATAAGCAAGAGGG + Intronic
976678617 4:87730646-87730668 AAGTATCTATAAAAGCAGGAGGG - Intergenic
978322509 4:107514121-107514143 ATGTATCTAAGGAAGCATTCAGG - Intergenic
979437905 4:120716279-120716301 ATGTATTTATATATGCATGTTGG + Intronic
979522042 4:121678758-121678780 ATTAATCTATAGATACATGATGG + Intronic
979877084 4:125906181-125906203 ATTTAGCAATTGAAGCATGAGGG - Intergenic
981074785 4:140580111-140580133 ATGCATATATAGAAACTTGATGG - Intergenic
981213964 4:142140770-142140792 TTGAATCTTTAGAAGCCTGAAGG + Intronic
983046480 4:162992842-162992864 AAGAATGTAGAGAAGCATGATGG - Intergenic
983067780 4:163230962-163230984 ATTTAACTCTAAAAGCATGATGG - Intergenic
983163250 4:164443794-164443816 AGGTAGCTGTATAAGCATGATGG - Intergenic
984090139 4:175363266-175363288 ATGTATATTTAAAAGGATGAAGG - Intergenic
984115874 4:175681097-175681119 ATGTATCTTTAGAATTAGGATGG + Intronic
987660092 5:20861289-20861311 AATTAACTATAGAAACATGATGG - Intergenic
987770869 5:22302704-22302726 ATGTATCTAGAGAAAAAAGAAGG + Intronic
987957712 5:24762726-24762748 AGCCACCTATAGAAGCATGATGG + Intergenic
988763554 5:34344360-34344382 AATTAACTATAGAAACATGATGG + Intergenic
991065794 5:62423674-62423696 ATGTAACTAGAGAAGTATGTGGG - Intronic
995619946 5:114014198-114014220 ATGTAAGTATAGTAGCTTGATGG - Intergenic
995707067 5:114997363-114997385 AGGTATCCAAAGAAGCAGGAGGG - Intergenic
995723233 5:115158627-115158649 ATGTACCAAAAGAAGCATTAAGG - Intronic
1000975313 5:167758005-167758027 ATGTATTGACAGATGCATGAAGG - Intronic
1001240711 5:170067827-170067849 ATGAGGCTATAGAAACATGAGGG - Intronic
1001327759 5:170741841-170741863 ATGTAGCTGGAGAAGCATGGCGG - Intergenic
1003300583 6:4877895-4877917 TTGTATCTATAGATGCATTTGGG + Intronic
1003492486 6:6635789-6635811 ATGGATCTATAGAGCCATGGAGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1006043780 6:31276100-31276122 ATGTGTCTATAGAATCATCTGGG - Intronic
1010132550 6:72511733-72511755 ATATATTTATAGAAGCAGGCAGG + Intergenic
1010521002 6:76837319-76837341 ACTTATCTATAGCTGCATGAAGG + Intergenic
1011231232 6:85164556-85164578 AATTATCTATAGCAGAATGAAGG - Intergenic
1011979381 6:93353535-93353557 CTTTATCTGCAGAAGCATGAGGG - Intronic
1013724489 6:113076848-113076870 AGGTATCTACAGAGGGATGAAGG + Intergenic
1016832429 6:148447082-148447104 ATTTATCTGTAGAGGCAGGAAGG + Intronic
1021219469 7:17959702-17959724 ATGGATATATAGAGACATGATGG + Intergenic
1022319278 7:29273318-29273340 ATATATATATATATGCATGATGG - Intronic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027405008 7:77850943-77850965 ATTTATCTATGGATGCATGATGG - Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1030183650 7:106737382-106737404 GTGTTTCTGTAGAAGAATGAGGG + Intergenic
1030943820 7:115691129-115691151 AAGTATCTTTTGAAACATGAGGG - Intergenic
1031064133 7:117086213-117086235 TTGTTTCTATAGTAACATGATGG + Intronic
1032541777 7:132708844-132708866 CTGTATTTATAGAACCATTATGG + Intronic
1032846393 7:135755257-135755279 ATGAATGAATAGGAGCATGATGG - Intergenic
1033081377 7:138301573-138301595 CTGTTTCTATAGGAGCGTGAGGG + Intergenic
1033952461 7:146801967-146801989 TTACATCTATAGAAACATGATGG + Intronic
1037429074 8:18790600-18790622 ATGTTTTTATAGAAGAATGTTGG - Intronic
1038892637 8:31743842-31743864 ATGTTTCTACAGAAGCTTGAAGG - Intronic
1040357597 8:46634679-46634701 ATGAATCCAAAGAAGCATGTAGG + Intergenic
1041024485 8:53669857-53669879 AAGTATCAGTAAAAGCATGAAGG - Intergenic
1041673887 8:60518354-60518376 AAGTAACTAAAGAAGCATGTTGG + Intronic
1041727353 8:61030559-61030581 ATCTATTAATAGAAGCCTGAAGG - Intergenic
1043007630 8:74839787-74839809 ATGTATCAATGGAAGAAAGAAGG - Intronic
1043764216 8:84109060-84109082 CTGTATTTATAGAACCATTAAGG + Intergenic
1043833683 8:85020048-85020070 ATATATCTATAGAAACATTATGG - Intergenic
1044164848 8:88968764-88968786 TTTTGTCTATAGAAACATGATGG - Intergenic
1046345226 8:112915546-112915568 ATGTATCTTTAGAAAAATAAAGG - Intronic
1046726054 8:117675140-117675162 ATGTATATAGAGAAACTTGATGG + Intergenic
1046790699 8:118318823-118318845 ATGTGTCTTTAGGAGCTTGAGGG + Intronic
1047453884 8:124991377-124991399 ATGTATGTATCTATGCATGAAGG - Intergenic
1047490992 8:125374525-125374547 ATGTGTATATTGAATCATGATGG + Intergenic
1048955897 8:139535768-139535790 ATGTATGTATGGAAGTATGATGG - Intergenic
1050818681 9:9849483-9849505 ATTTATATATAGAAGTCTGATGG + Intronic
1050838474 9:10114669-10114691 ATTTATCTATATATGCATGTGGG - Intronic
1051872916 9:21759387-21759409 ATGTATCCAAAGAAACAAGAAGG - Intergenic
1052361492 9:27565467-27565489 ATGTATCTGTATAAGGTTGATGG - Intronic
1052757211 9:32552961-32552983 TTATATCTACATAAGCATGAGGG - Intergenic
1054719174 9:68586548-68586570 ATACATCTATAGAAACATTATGG + Intergenic
1055118753 9:72634305-72634327 TTTTATCTATAGGAGCAAGAGGG + Intronic
1055782643 9:79835987-79836009 ATGTATTTATAGAAAGATCAAGG + Intergenic
1056853471 9:90104312-90104334 CTGTAACAATAGCAGCATGAAGG - Intergenic
1058065465 9:100544077-100544099 ATATATATATATCAGCATGAAGG - Intronic
1187248552 X:17575803-17575825 ATGTCTATTTGGAAGCATGAAGG + Intronic
1187742580 X:22372592-22372614 GTGTTTCCATAGAAGGATGATGG + Intergenic
1188777852 X:34244018-34244040 ATATATCTATAAATGCATGCTGG - Intergenic
1189799832 X:44681993-44682015 ATGCATTTATAGAAGCATGGGGG + Intergenic
1191934307 X:66409797-66409819 CTGGATCTTTAGGAGCATGATGG + Intergenic
1193143646 X:78055264-78055286 ATTTATTCATAGCAGCATGAGGG + Intergenic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic
1197193362 X:123673522-123673544 ATGTATTTAAACAAGAATGAAGG - Intronic
1197465616 X:126801337-126801359 AAGTCTATATAGAAGCATAAAGG + Intergenic
1198268951 X:135035944-135035966 CAGTATCTATAGAAGCAGGCAGG - Intergenic
1198978751 X:142368901-142368923 ATGTAACTATATAATCATAATGG + Intergenic
1199892367 X:152098914-152098936 ATGTATTTATATATGCATGATGG + Intergenic
1200803243 Y:7405901-7405923 ATGCATCTAGAGATGGATGAAGG + Intergenic
1200856543 Y:7944749-7944771 ATGAATCCATATAAGCATGTAGG - Intergenic
1200863204 Y:8014889-8014911 ATGAATCCATATAAGCATGTAGG - Intergenic
1202260113 Y:22961437-22961459 ATGAATCCATACAAGCATGTTGG + Intergenic
1202413100 Y:24595178-24595200 ATGAATCCATACAAGCATGTTGG + Intergenic
1202457682 Y:25074890-25074912 ATGAATCCATACAAGCATGTTGG - Intergenic