ID: 1112049022

View in Genome Browser
Species Human (GRCh38)
Location 13:95626970-95626992
Sequence TGCAAAGAAGGTTATTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112049022_1112049028 22 Left 1112049022 13:95626970-95626992 CCATTCCAATAACCTTCTTTGCA 0: 1
1: 0
2: 0
3: 16
4: 256
Right 1112049028 13:95627015-95627037 ATTTCATATGCAACTGTAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112049022 Original CRISPR TGCAAAGAAGGTTATTGGAA TGG (reversed) Intronic