ID: 1112049022 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:95626970-95626992 |
| Sequence | TGCAAAGAAGGTTATTGGAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 273 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 16, 4: 256} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1112049022_1112049028 | 22 | Left | 1112049022 | 13:95626970-95626992 | CCATTCCAATAACCTTCTTTGCA | 0: 1 1: 0 2: 0 3: 16 4: 256 |
||
| Right | 1112049028 | 13:95627015-95627037 | ATTTCATATGCAACTGTAAGAGG | 0: 1 1: 0 2: 1 3: 24 4: 243 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1112049022 | Original CRISPR | TGCAAAGAAGGTTATTGGAA TGG (reversed) | Intronic | ||