ID: 1112049028

View in Genome Browser
Species Human (GRCh38)
Location 13:95627015-95627037
Sequence ATTTCATATGCAACTGTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112049023_1112049028 17 Left 1112049023 13:95626975-95626997 CCAATAACCTTCTTTGCAGAAAT 0: 1
1: 5
2: 23
3: 287
4: 1919
Right 1112049028 13:95627015-95627037 ATTTCATATGCAACTGTAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 243
1112049022_1112049028 22 Left 1112049022 13:95626970-95626992 CCATTCCAATAACCTTCTTTGCA 0: 1
1: 0
2: 0
3: 16
4: 256
Right 1112049028 13:95627015-95627037 ATTTCATATGCAACTGTAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 243
1112049025_1112049028 10 Left 1112049025 13:95626982-95627004 CCTTCTTTGCAGAAATGGAAAAG 0: 2
1: 13
2: 37
3: 105
4: 687
Right 1112049028 13:95627015-95627037 ATTTCATATGCAACTGTAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 243
1112049021_1112049028 23 Left 1112049021 13:95626969-95626991 CCCATTCCAATAACCTTCTTTGC 0: 1
1: 0
2: 3
3: 12
4: 195
Right 1112049028 13:95627015-95627037 ATTTCATATGCAACTGTAAGAGG 0: 1
1: 0
2: 1
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112049028 Original CRISPR ATTTCATATGCAACTGTAAG AGG Intronic