ID: 1112052557

View in Genome Browser
Species Human (GRCh38)
Location 13:95657329-95657351
Sequence AAATCTCAGCAAAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112052557_1112052560 18 Left 1112052557 13:95657329-95657351 CCTTCCACCTTTTGCTGAGATTT No data
Right 1112052560 13:95657370-95657392 TGAGTGCTGTATTTGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112052557 Original CRISPR AAATCTCAGCAAAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr