ID: 1112061698

View in Genome Browser
Species Human (GRCh38)
Location 13:95746863-95746885
Sequence CTGATTACTCAGCTGGGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112061694_1112061698 13 Left 1112061694 13:95746827-95746849 CCAGTGAGAATCTCATTCTTTAT 0: 1
1: 0
2: 1
3: 19
4: 312
Right 1112061698 13:95746863-95746885 CTGATTACTCAGCTGGGGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112061698 Original CRISPR CTGATTACTCAGCTGGGGTG AGG Intronic
901064515 1:6488580-6488602 CTGGGTACTCAGCAAGGGTGGGG + Intronic
902721578 1:18307787-18307809 CTGACTCCTAAGCTGCGGTGAGG + Intronic
903237318 1:21958423-21958445 CTTGATTCTCAGCTGGGGTGGGG + Intergenic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903397557 1:23013665-23013687 CTGATTTAACAGCTGAGGTGAGG + Intronic
903654259 1:24939505-24939527 CTGTTTACACAGCTGTGATGTGG - Intronic
904052281 1:27646917-27646939 CTCATTGCGCAGCTGGGGCGTGG - Intergenic
904655638 1:32044375-32044397 CTGATAACTCAGCTGGGCTGGGG + Intronic
906833695 1:49060562-49060584 CTGGTTACTAAGAGGGGGTGGGG + Intronic
907592380 1:55687383-55687405 ATGGTTACTCAGCTGGGAAGTGG + Intergenic
912392549 1:109314255-109314277 ATGATGACTCAGATGAGGTGAGG - Exonic
914445137 1:147743901-147743923 TTGAATACTCAGCAGTGGTGTGG + Intergenic
915460825 1:156069832-156069854 CTGAGAAATTAGCTGGGGTGAGG - Intronic
915576917 1:156785555-156785577 CTGAAGCCTCAGCTTGGGTGGGG - Intronic
915731878 1:158059635-158059657 GGGAATACTCACCTGGGGTGTGG + Intronic
916311635 1:163405001-163405023 CTGATTTCTCAGCAGGTGTATGG - Intergenic
916524655 1:165598322-165598344 CTGACCACTCAGCTCGGGCGTGG - Intergenic
916692762 1:167206589-167206611 CTGAGTATTCAGCTGAGCTGGGG - Intergenic
917187348 1:172374066-172374088 ATGATGACTCAGCTGTGGTCTGG + Intronic
917241693 1:172955705-172955727 CTGAATAGTCTGATGGGGTGGGG + Intergenic
919062475 1:192651230-192651252 CTGAGAAGTCAGCTGAGGTGAGG + Intronic
920975064 1:210778049-210778071 CTGAGAGCTCAGCTGGGCTGTGG - Intronic
921067066 1:211630760-211630782 CTGGATTCTCAGCTGGGGTGGGG - Intergenic
921234456 1:213111044-213111066 GTGACCACTCAGCTGGGATGGGG + Intronic
1063174336 10:3538111-3538133 CCAACCACTCAGCTGGGGTGTGG + Intergenic
1063680126 10:8179223-8179245 CTGATTCTTCTGCTGGGGGGAGG + Intergenic
1065390267 10:25175457-25175479 CTGCTTGCTCAGCTGGGATTGGG + Exonic
1066522950 10:36243180-36243202 GATGTTACTCAGCTGGGGTGGGG + Intergenic
1067348321 10:45454204-45454226 GTGCTTTCTCAGCTGGGCTGTGG + Intergenic
1068206719 10:53864365-53864387 TTTGTTACTCAGGTGGGGTGTGG - Intronic
1073056522 10:100706800-100706822 CTGATGCCCCAGCTGGGCTGAGG - Intergenic
1073483179 10:103799716-103799738 GTGATAACTCAGTTGGGGAGAGG - Intronic
1074870884 10:117575125-117575147 CTGATTCATTAGGTGGGGTGGGG + Intergenic
1078558314 11:12349404-12349426 CTGAGTACCCAGGTGGTGTGTGG - Intronic
1081721072 11:45288728-45288750 CTGATCACTCAACTGGGCTTTGG - Intergenic
1084657312 11:70527122-70527144 CTGATTCCACAGCTGTGGTCTGG + Intronic
1086850732 11:91804421-91804443 CTGATCACACAGCAGGGGAGAGG + Intergenic
1087187730 11:95219190-95219212 ATGAATTCTCAGTTGGGGTGTGG - Intronic
1088008039 11:104965982-104966004 CTGATTACTCAGGTGGGAGATGG - Intronic
1089493127 11:118895840-118895862 TTGTTTGCTCACCTGGGGTGTGG + Exonic
1089843148 11:121436288-121436310 CAGATCACTGAGCTGGGGTGTGG - Intergenic
1092883234 12:12904080-12904102 GTGATTAATCTGCCGGGGTGTGG + Intronic
1093383917 12:18527168-18527190 CTGATTCCTCAGCTGGTCTAAGG + Intronic
1093978811 12:25452778-25452800 CAGAGTGCTCAGGTGGGGTGAGG - Intronic
1097013950 12:55972180-55972202 CTGAAGACTCAGCCCGGGTGGGG + Exonic
1098643195 12:72863616-72863638 CTGATTTAGTAGCTGGGGTGGGG + Intergenic
1098974006 12:76883389-76883411 CTCAGAACTCTGCTGGGGTGCGG + Intergenic
1100585883 12:95978783-95978805 CTGACTTCTAAGCTAGGGTGAGG - Intronic
1100687910 12:97006805-97006827 CTGATTACGGAGGTGGGGTTTGG + Intergenic
1102639237 12:114351974-114351996 CAGATTACACAGCTGGTGTGTGG - Intergenic
1103052174 12:117789824-117789846 CTGTGTACTCAGCAGGGATGGGG - Intronic
1103888089 12:124217644-124217666 CTGTTTCCAGAGCTGGGGTGCGG - Intronic
1104372923 12:128239096-128239118 CTGAGGACTCTGCTGGGCTGGGG - Intergenic
1106758172 13:32842943-32842965 CTGAAGGCTCAGCTGGGGTTGGG - Intergenic
1107731715 13:43355749-43355771 CTCTTTACAGAGCTGGGGTGGGG - Intronic
1107818989 13:44269325-44269347 CTTATTGCTAACCTGGGGTGTGG + Intergenic
1108325302 13:49324700-49324722 CTGACTTCACAGATGGGGTGAGG + Intronic
1112061698 13:95746863-95746885 CTGATTACTCAGCTGGGGTGAGG + Intronic
1113252596 13:108471054-108471076 CTGATTTGGCAGCTGGGGGGTGG - Intergenic
1114448381 14:22807398-22807420 CTGATTATTAAGCAGGGGTATGG - Intronic
1117273538 14:54169449-54169471 CTGATTACTCGGCTGTAGTGGGG - Intergenic
1119506947 14:75181221-75181243 CTGATTCACCATCTGGGGTGAGG - Intergenic
1122881359 14:104691865-104691887 CTGGGTCCTGAGCTGGGGTGAGG + Intronic
1122960226 14:105090813-105090835 CTGTTTCCTCATCTGGGGAGTGG - Intergenic
1124040071 15:26093742-26093764 CTTATCTCTCAGCCGGGGTGGGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125750430 15:42024018-42024040 CTGACCACTCAGGTGGGGTCTGG + Intronic
1127303012 15:57676028-57676050 CCGATCACCAAGCTGGGGTGTGG + Intronic
1129169467 15:73798852-73798874 ATGATCATTCAGCTGGGGAGTGG + Intergenic
1130536191 15:84786654-84786676 CTGATGCGTCAGATGGGGTGTGG + Intronic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1136295073 16:29296974-29296996 CTGATTCCAGAGCTGGGATGTGG - Intergenic
1140475487 16:75237647-75237669 CTGATGACACCGGTGGGGTGAGG + Intronic
1140668255 16:77247929-77247951 CTGAATACTCGGCTGGGCTGGGG + Intronic
1141183414 16:81770201-81770223 CTGGTTTCTCGGTTGGGGTGTGG - Intronic
1142100974 16:88270983-88271005 CTGATTCCAGAGCTGGGATGTGG - Intergenic
1142813245 17:2406307-2406329 CTGACAACTCACTTGGGGTGGGG - Intronic
1144529177 17:16019558-16019580 CTAATTAATCCACTGGGGTGAGG + Intronic
1144891378 17:18496251-18496273 CTGATCTCGCAGGTGGGGTGGGG - Intergenic
1145140842 17:20448066-20448088 CTGATCTCGCAGGTGGGGTGGGG + Intergenic
1146005575 17:29158631-29158653 CTGGTGACCCAGCTGAGGTGAGG - Intronic
1148819077 17:50349856-50349878 ATGATTACTCAGATGGGAGGAGG - Intronic
1150286549 17:63957624-63957646 CTGAGGACTCAGATGGTGTGGGG - Intronic
1150387988 17:64775655-64775677 CTGCTTACTGAGTTGGGGGGTGG - Intergenic
1150600077 17:66643254-66643276 CTGAAGAGTCAGCTGGGATGGGG + Intronic
1151140494 17:71987067-71987089 CATATTACTCAGCTGGGGGTTGG - Intergenic
1152106061 17:78329737-78329759 TGGAGCACTCAGCTGGGGTGGGG + Intergenic
1152568834 17:81112388-81112410 CTGACAACTCAGCTGGGATTGGG + Intronic
1153788472 18:8555986-8556008 CCCATTAGTCAGCTGGTGTGGGG - Intergenic
1155034597 18:22015322-22015344 ATGATTACTCAGTTGGCCTGTGG + Intergenic
1159485946 18:69057431-69057453 CTGATACCTCATCTGGGGTGAGG + Intergenic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160588566 18:79927144-79927166 CTGCCTGCTCAGCTGGAGTGGGG - Intronic
1164050262 19:21579960-21579982 CTGTTTACTCATCTGTGGAGTGG + Intergenic
1165636879 19:37347800-37347822 CTCATTGCTCAGCTGGAGCGAGG + Exonic
1166194038 19:41194533-41194555 CTTCTTACTCAGCTGGGGGTAGG - Exonic
1166496272 19:43305319-43305341 CTGGTGGCTGAGCTGGGGTGAGG + Intergenic
1167323356 19:48809900-48809922 CTGAGTCCTCAGCTGTGATGGGG - Intronic
1167412705 19:49354465-49354487 CTGTTGCCTAAGCTGGGGTGCGG - Intronic
1167642439 19:50689056-50689078 CTGGTCCCTCAGCTGCGGTGAGG - Intronic
1167852600 19:52213517-52213539 CTTGTTACCCAGCTGGAGTGTGG + Intronic
1168302119 19:55411120-55411142 TTGAGTTTTCAGCTGGGGTGGGG - Intergenic
1168429728 19:56268751-56268773 CTGCTTAGTGAGATGGGGTGAGG - Intronic
925558269 2:5156541-5156563 CTAACTGCTGAGCTGGGGTGGGG + Intergenic
927681343 2:25141466-25141488 CTGCTTACTCAGCTGCCCTGGGG - Intronic
932086534 2:68767545-68767567 CTCCTTCCTCAGCTGTGGTGTGG + Intronic
932315825 2:70781587-70781609 CTGAGTAGTCATCTGTGGTGTGG - Intronic
933727491 2:85435032-85435054 CAGATTATTGAGCTGGGGTGGGG - Exonic
935332792 2:101989361-101989383 TTAATTACCCAGGTGGGGTGGGG - Intergenic
936542738 2:113364969-113364991 CAGATTCCTGATCTGGGGTGTGG - Intergenic
938583299 2:132667693-132667715 CTGATAAGACAGCTGGGGTAGGG + Intronic
940462986 2:153991335-153991357 CTGAATAGACAGCTGGAGTGAGG + Intronic
941376196 2:164734034-164734056 CTGATTAATGATCTGGGCTGGGG - Intronic
944350046 2:198715662-198715684 CTGACGCCTCAGCTGGGATGTGG + Intergenic
945811899 2:214559025-214559047 CTGTTCACTCTGATGGGGTGGGG - Intronic
946154719 2:217799984-217800006 ATAAATACACAGCTGGGGTGGGG + Exonic
948771055 2:240251430-240251452 CTGAGTCCTCAGCGGGGGAGGGG + Intergenic
1168987604 20:2063750-2063772 CTGATTATTATGGTGGGGTGGGG - Intergenic
1169373027 20:5043200-5043222 AGGAATCCTCAGCTGGGGTGAGG + Intergenic
1171137318 20:22708386-22708408 GTGGTTACTCAGCTGAGCTGGGG + Intergenic
1173177590 20:40776319-40776341 GAGATTACTCAGCTAGTGTGTGG - Intergenic
1173221283 20:41135075-41135097 CTGGTTAATCAGCATGGGTGAGG - Intergenic
1173326221 20:42036100-42036122 TAGATTACTCCACTGGGGTGAGG + Intergenic
1177060705 21:16370418-16370440 CTCATTACTCCACTGGGGTTGGG - Intergenic
1178428635 21:32499710-32499732 CTGAGATCTCAGCTGGGCTGAGG + Intronic
1178886795 21:36491150-36491172 CTAATTAGTTTGCTGGGGTGAGG - Intronic
1179201164 21:39222414-39222436 CTGATTCCACAGCTGAGGTAAGG + Intronic
1183010709 22:34944379-34944401 CTGTTTACACAGCAGGGGTTGGG - Intergenic
1183863041 22:40683157-40683179 CTGGTGACTCAGCGGGGGTGAGG - Intergenic
1184703724 22:46195906-46195928 TTGATGACTCAGCTGGGTTCAGG + Intronic
1184866350 22:47203775-47203797 CTGAGTACACAGGTGGGCTGAGG - Intergenic
949332133 3:2934243-2934265 CTGATTACACTGCAGGGGTCAGG - Intronic
950746242 3:15091860-15091882 CTGAACAATCAGCTGGTGTGGGG + Intronic
953440000 3:42908819-42908841 CTGATTTCCCAGCTGGAGCGAGG + Exonic
954395565 3:50291661-50291683 ATGTTTACTCTGCTGGGATGGGG - Intronic
954943029 3:54392644-54392666 CTGATTTCAAAGGTGGGGTGGGG + Intronic
956507752 3:69960875-69960897 GTGATTCCTCAGCTGTGGGGTGG + Intronic
959656273 3:108808462-108808484 CTGATTACCCAGCTGCTGGGAGG + Intergenic
960673936 3:120176892-120176914 CTGAGTTCTCAGATGGGCTGGGG + Intronic
961035853 3:123641126-123641148 AGGATTACACAGCTGGGGTAAGG - Intronic
961412492 3:126732890-126732912 CTGATGCCTGAGCTTGGGTGTGG + Intronic
961624757 3:128254260-128254282 GTGATGACTAAGCAGGGGTGAGG + Intronic
962351173 3:134656760-134656782 CTGACAACTGAGCTGGGGCGTGG - Intronic
962867580 3:139460548-139460570 CTGACTCCTCTCCTGGGGTGGGG - Intronic
963806660 3:149729337-149729359 CTGGTGACTCAGCTGGGGGCAGG + Intronic
964800797 3:160555153-160555175 CTGACTGCTTAGCTGGTGTGTGG + Intronic
967099734 3:186206592-186206614 CTGATTAAGCAGGTGGGGGGTGG - Intronic
968957692 4:3727520-3727542 ATAATTACTCAGCAGGGGTGGGG + Intergenic
975668328 4:76755182-76755204 CTGCTCACTCACCTGGGGCGTGG - Exonic
982301249 4:153881364-153881386 CTGCTTTCACAGCTGGTGTGAGG - Intergenic
985423123 4:189803927-189803949 ATGATTATTCAGATGTGGTGAGG + Intergenic
986127434 5:4896062-4896084 ATGATTACTCAGCTAGCATGTGG + Intergenic
987821447 5:22971075-22971097 TTGAGTGCTCAGGTGGGGTGTGG + Intergenic
991449694 5:66738751-66738773 CTGAATACTCAGCTGCTGTCAGG + Intronic
993539823 5:89135013-89135035 CTGATCACTCATCTTGGGTGAGG + Intergenic
993540674 5:89146883-89146905 CTGATTCCAGAGCTGGGGTAAGG - Intergenic
994100102 5:95882572-95882594 CTTATTACCGAGGTGGGGTGGGG + Intergenic
999156082 5:149458501-149458523 CTTATTCCTTAGATGGGGTGTGG - Intergenic
1001260554 5:170224943-170224965 CAGATTACTCAGCTGGGAAATGG - Intergenic
1002428558 5:179189972-179189994 TTGATTGATCAGCTAGGGTGGGG + Intronic
1003545450 6:7054197-7054219 CTGTTGCCTCAGCTGGAGTGCGG - Intergenic
1004243586 6:13951419-13951441 CTTATCTCTCAGTTGGGGTGGGG + Intronic
1004357591 6:14943557-14943579 CTGATTAGCCAGATGGGTTGAGG + Intergenic
1005873566 6:29994976-29994998 CTGAGGTCTGAGCTGGGGTGTGG + Intergenic
1006521922 6:34575701-34575723 CTCCTTACCTAGCTGGGGTGGGG + Intergenic
1007461756 6:42024430-42024452 CTGATAACACAGCTGGTGTGTGG + Intronic
1007710077 6:43817326-43817348 CTGATGACACAGCACGGGTGGGG + Intergenic
1007911338 6:45517811-45517833 TTGAGTACTCAAATGGGGTGGGG - Intronic
1013614508 6:111829307-111829329 CTGATTTCTCACCTGATGTGTGG + Intronic
1017585145 6:155912222-155912244 CTGATAAGTCAGCTTGGGTCCGG + Intergenic
1017847182 6:158269006-158269028 CTGGTCACTAAGCTTGGGTGTGG - Intronic
1023033719 7:36112374-36112396 CCACTTACTCAGCTTGGGTGGGG - Intergenic
1030346595 7:108440636-108440658 CTGATTGCTCTGCTAGGGAGTGG + Intronic
1031962707 7:128004298-128004320 GTGAATACTCAGGTGTGGTGGGG + Intronic
1032196528 7:129792448-129792470 TTGGTTACTCAGCTAGGATGGGG + Intergenic
1032845965 7:135752248-135752270 CTAATTACTAAACTGGGGTGAGG + Intergenic
1033493313 7:141866208-141866230 CTGATTCCTCATCTAGGATGGGG + Intergenic
1034226608 7:149489727-149489749 GGGATTACTCTGCTGGGCTGAGG + Intronic
1034239835 7:149602006-149602028 CTGATTCCTCACCATGGGTGGGG + Intergenic
1036799987 8:11783611-11783633 CTGATAACACAGTTAGGGTGTGG - Intronic
1037539228 8:19855511-19855533 ATCATTCCTCAGGTGGGGTGGGG + Intergenic
1044556313 8:93565955-93565977 CTGTTTCCTCAGCTGGGAAGTGG + Intergenic
1044771960 8:95645568-95645590 CTCTTTACTCAGCTTGGGGGTGG + Intergenic
1048369630 8:133766236-133766258 CTGACTTCGCAGCTGGGGAGAGG + Intergenic
1049492021 8:142910231-142910253 ATTATTACTCAGTTGTGGTGAGG - Intronic
1049561031 8:143310389-143310411 CTGACTTGGCAGCTGGGGTGGGG - Intronic
1052349262 9:27441826-27441848 CTGAGAACACTGCTGGGGTGGGG - Intronic
1053042951 9:34890327-34890349 CTGTTTTCTCTGCTGGGGTAGGG + Intergenic
1060123569 9:121019725-121019747 ATGGTTACTCAGCTGGGAAGAGG - Intronic
1060788862 9:126472068-126472090 CTCAATACACAGCAGGGGTGAGG - Intronic
1186001991 X:5022934-5022956 CTGATTTCTCAGGTAGCGTGTGG - Intergenic
1186048000 X:5557038-5557060 CTGACTCCTCTGCTGGGTTGGGG - Intergenic
1186642847 X:11474218-11474240 TTGCTGACTCAGCTGTGGTGTGG - Intronic
1187372969 X:18725747-18725769 CTGCTTCCCAAGCTGGGGTGGGG + Intronic
1191970933 X:66815465-66815487 CTGATTTCTCAGGTGGTGGGTGG + Intergenic
1195158287 X:102144387-102144409 CTTATTAATCAGCTGGTGTTTGG + Intergenic
1201858423 Y:18570208-18570230 CTGATTTCTCTGTTGGGGTGTGG + Intronic
1201874898 Y:18750173-18750195 CTGATTTCTCTGTTGGGGTGTGG - Intronic