ID: 1112064492

View in Genome Browser
Species Human (GRCh38)
Location 13:95778496-95778518
Sequence TTACTCAGCTTTTAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1319
Summary {0: 1, 1: 6, 2: 21, 3: 244, 4: 1047}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112064488_1112064492 29 Left 1112064488 13:95778444-95778466 CCTTACCAAATGAATGGATACAT 0: 1
1: 0
2: 4
3: 28
4: 225
Right 1112064492 13:95778496-95778518 TTACTCAGCTTTTAAAAAGCAGG 0: 1
1: 6
2: 21
3: 244
4: 1047
1112064489_1112064492 24 Left 1112064489 13:95778449-95778471 CCAAATGAATGGATACATATAAA 0: 1
1: 0
2: 8
3: 47
4: 554
Right 1112064492 13:95778496-95778518 TTACTCAGCTTTTAAAAAGCAGG 0: 1
1: 6
2: 21
3: 244
4: 1047
1112064487_1112064492 30 Left 1112064487 13:95778443-95778465 CCCTTACCAAATGAATGGATACA 0: 1
1: 0
2: 37
3: 401
4: 2767
Right 1112064492 13:95778496-95778518 TTACTCAGCTTTTAAAAAGCAGG 0: 1
1: 6
2: 21
3: 244
4: 1047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112064492 Original CRISPR TTACTCAGCTTTTAAAAAGC AGG Intronic
900510092 1:3054760-3054782 TGACTCAGTCTTTAAAAGGCGGG + Intergenic
900516686 1:3085534-3085556 TCACTCAGCTTTTGAACAGTGGG - Intronic
900871050 1:5303531-5303553 TTACCCAGCCTTAAAAAAGAAGG + Intergenic
901132875 1:6973457-6973479 TTATTCAGCCTTCAAAAAGAAGG - Intronic
902173535 1:14632033-14632055 CTGCTAAGTTTTTAAAAAGCAGG + Intronic
902180240 1:14682595-14682617 TTACTCTGCCTTAAAAAAGAAGG - Intronic
902688351 1:18093727-18093749 TTATTCAGCCTTCAAAAAGAAGG + Intergenic
902688359 1:18093838-18093860 TTATTCAGCCTTCAAAAAGAAGG + Intergenic
903434685 1:23338196-23338218 TTACTCAGCTTTTTAACATTTGG - Intronic
903489561 1:23717969-23717991 TTACTCAGCCTTAAAAAAAAAGG + Intergenic
904857855 1:33513040-33513062 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
904859584 1:33525360-33525382 CTAGACAGCTTTTAAAAAGAAGG + Intronic
905003331 1:34690755-34690777 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
905071771 1:35232482-35232504 TTACTCAGACTTTAAAAAGAAGG - Intergenic
905119867 1:35673353-35673375 TTTTTCAGCTTTTAAAAGGAAGG + Intergenic
905147509 1:35899221-35899243 TTATTCAGCCTTAAAAAAGAAGG - Intronic
905330880 1:37196049-37196071 TTATTCAACCTTTAAAAAGCAGG + Intergenic
905908328 1:41635263-41635285 CTACTCAGATTTTGAAAAGTAGG - Intronic
905921297 1:41720855-41720877 TTATTCAGCCTTAAAAAAGAAGG + Intronic
906734566 1:48113150-48113172 TTATTCATCCTTTAAAAAGAAGG - Intergenic
907022418 1:51081073-51081095 ATACTAAACTTTTAAAAAGTAGG + Intergenic
907022525 1:51082341-51082363 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
907030311 1:51164520-51164542 TTATTCAGCTTTAAAAAAGAAGG + Intergenic
907174404 1:52504910-52504932 TTACTCAGCCTTAAAAAGGATGG - Intronic
907178305 1:52546356-52546378 TTATTCAGCCTTAAAAAAGAAGG + Intronic
907349802 1:53818745-53818767 TTATTTAGCCTTTAAAAAGAAGG - Intronic
907490038 1:54803265-54803287 TTATTCAGCCTTTAAAAGGAAGG - Intergenic
907721849 1:56979505-56979527 TCACACAGCTTTTAAAAATAAGG + Intergenic
907923414 1:58933857-58933879 TTACTCAGCCTTAAAAAGGAGGG + Intergenic
908162987 1:61429726-61429748 TTACTCAGCCTTTAAAAGGAAGG + Intronic
908521436 1:64946870-64946892 TTATTCAGCCTTTAAAAGGAAGG + Intronic
908593690 1:65661193-65661215 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
908715963 1:67069341-67069363 TTATTCAGTCTTTAAAAAGAAGG - Intergenic
908725810 1:67175666-67175688 TTACTCAGCCTTAAAAAGGAAGG - Intronic
908810861 1:67981033-67981055 TTACTCAGCCTCAAAAAAGAAGG + Intergenic
908877971 1:68699436-68699458 TTATTTAGCCTTTAAAAAGGAGG - Intergenic
909101112 1:71349684-71349706 TTCCTGAGATTTTAAAAAACTGG - Intergenic
909906861 1:81207527-81207549 CTATTCAGCTTTAAAAAAGAAGG + Intergenic
910058023 1:83055137-83055159 TTATGCACTTTTTAAAAAGCTGG - Intergenic
910329346 1:86052391-86052413 TTATTCAGCCTTAAAAAAGAAGG + Intronic
910459049 1:87428583-87428605 TTACACTGCTTTCAGAAAGCAGG + Intergenic
910563380 1:88617149-88617171 TTATTCATCCTTTAAAAAGAAGG + Intergenic
910640200 1:89452531-89452553 TTACCCAGTTTTTAAAAAAATGG - Intergenic
910660699 1:89669100-89669122 CTACTCAGCCTTTAAAAAACAGG + Intronic
910709534 1:90165482-90165504 TTCTTCAGCTTTTCAGAAGCAGG + Intergenic
911028510 1:93460531-93460553 CTACTCAGTTCTTAAAAAGAAGG + Intronic
911103456 1:94111694-94111716 ATTCTCAGCATTTAAGAAGCAGG + Intronic
912247411 1:107974604-107974626 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
912307776 1:108588039-108588061 TTATTCAGCCTTAAAAAAGAAGG - Intronic
912394844 1:109334345-109334367 TTATTCAGCCTTAAAAAAGAAGG + Intronic
912479496 1:109969941-109969963 TTATTCAGTTTTTAAAAGGAGGG + Intergenic
912784978 1:112593686-112593708 TTCTTCAGCATTTAAAAATCAGG - Intronic
912789072 1:112633421-112633443 CTATACAGCTTTTAAAAAGAAGG - Intronic
913206540 1:116544434-116544456 TTTCTCATCTTTTAAAAATAGGG - Exonic
913344104 1:117790793-117790815 TTATTCAGCCTTTAAAAAGATGG - Intergenic
913375047 1:118142139-118142161 TTATTCAGCTTTAATAAAGAAGG + Intronic
913474157 1:119220659-119220681 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
914355865 1:146884051-146884073 TAACTCAGCTCTTAAGTAGCTGG + Intergenic
914721805 1:150295295-150295317 TGTCTCAATTTTTAAAAAGCGGG - Intronic
916364790 1:164013594-164013616 TTATTCAGCTTTTAAAAAGAAGG + Intergenic
916805740 1:168259425-168259447 CTAGTCAGCCTTTAAAAAGAAGG - Intergenic
917125283 1:171682147-171682169 TTACGCAGCTTTAAAAAGGAAGG - Intergenic
917735646 1:177917542-177917564 TCACTCAACTTTTAATAAACAGG + Intergenic
917813758 1:178686743-178686765 TTTCTCACCTTTTTATAAGCAGG + Intergenic
917921342 1:179753124-179753146 TTATTCAGCCTTTAAAAAGAAGG + Intronic
918120383 1:181533031-181533053 TAACTCAGCTTCTAAAGACCAGG - Intronic
918217271 1:182402931-182402953 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
918773761 1:188600940-188600962 TTACTTACATTTTAAAAAACTGG + Intergenic
918782871 1:188725691-188725713 TTACTAATCTTTCAAAAAGAAGG - Intergenic
918875144 1:190031578-190031600 TTAGTCAGCCTTTAAAAAGGGGG - Intergenic
918910980 1:190569296-190569318 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
918993772 1:191731080-191731102 TTACTCAGAATTTAACATGCAGG + Intergenic
919351592 1:196462565-196462587 TTAATCATCTTTTATAAAGAAGG + Intronic
919382655 1:196878001-196878023 TTTTTAAGCTTTTAAAAGGCTGG + Intronic
919383122 1:196882958-196882980 TTTTTAAGCTTTTAAAAAGCTGG + Intronic
919394522 1:197028228-197028250 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
920083684 1:203397789-203397811 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
920153662 1:203930699-203930721 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
920224890 1:204431321-204431343 TTATTCAGCATTTAAAATGGAGG - Intronic
920248215 1:204604228-204604250 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
920598239 1:207294685-207294707 TTATTCTGCCTTTAAAAAGAAGG - Intergenic
921098130 1:211904720-211904742 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
921158977 1:212459741-212459763 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
921429160 1:215043454-215043476 TTACTCAGCCTTCAAAAGGAAGG + Intronic
921610176 1:217203967-217203989 TTACTCAGTCTTAAAAAGGCAGG - Intergenic
921661215 1:217805189-217805211 CTATTCAGCTTTTAAAAAGAAGG + Intronic
921670428 1:217918544-217918566 GTACTTATCTTTTAAAAAGATGG + Intergenic
921991844 1:221375183-221375205 TTACCCAGATTTTAAAAAGAGGG - Intergenic
922882721 1:228993316-228993338 TTATTCATCCTTTAAAAAGAAGG + Intergenic
923005581 1:230046886-230046908 TCACTCAGCCTTTAATAAGCAGG + Intergenic
923043832 1:230339664-230339686 CTATTCAGCCTTTAAAAAGGAGG + Intronic
923139135 1:231146388-231146410 CTATTCAACTTTTAAAAAGAAGG + Intergenic
923366583 1:233267699-233267721 TTACTCAGCCTTAAAAAAGAAGG - Intronic
923635229 1:235689304-235689326 TTATTCAGCCTTTAAAAAGATGG + Intronic
923857330 1:237859142-237859164 TGACTCAACTTTTGAAAAGCTGG + Intergenic
924307151 1:242701574-242701596 TTACTCAGCCTTTAAAAAGGGGG + Intergenic
924450078 1:244170309-244170331 TTATTCAGCCTTGAAAAAGATGG - Intergenic
924503743 1:244661343-244661365 TTACTCAGCCTTAAAAAGGAAGG - Intronic
924551119 1:245078490-245078512 TTATTCAGCCTTAAAAAAGGAGG + Intronic
924762030 1:246996449-246996471 TTACTCAGCTTTTACAAAGCAGG + Intronic
924871120 1:248045650-248045672 TTCTTCAGCTTTTCAAATGCGGG + Intronic
1062788387 10:284408-284430 TTACTCAGCCATAAAAAAGGAGG + Intronic
1062869376 10:886624-886646 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1062972228 10:1657408-1657430 TTTCACCGCTTTTAAAAAGAAGG - Intronic
1063057085 10:2517401-2517423 TTATTCAGCTTTAAAAAAGAAGG - Intergenic
1063164558 10:3448460-3448482 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1063292750 10:4766999-4767021 TTCCTCAGCTGTTAAACAGAAGG + Intergenic
1064121360 10:12622771-12622793 CTTCCCAGCTTTTGAAAAGCTGG + Intronic
1064121364 10:12622775-12622797 TTCCCCAGCTTTTCAAAAGCTGG - Intronic
1064333184 10:14413704-14413726 TTATTCAGCCTTTAAACAGAAGG + Intronic
1064376218 10:14798818-14798840 TTACTCAGCTTTTTAAAAGAAGG + Intergenic
1064510838 10:16089342-16089364 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1064514958 10:16137162-16137184 CTACTCAGCTTTAAAAAAGATGG + Intergenic
1064521056 10:16201624-16201646 ATATTAAGCTTTTAAAAATCTGG - Intergenic
1064724190 10:18260818-18260840 GTACTCTGCTTTTGAAAAGCAGG - Intronic
1064739341 10:18416288-18416310 TTACTCAGCCTTGAAAAAGAAGG - Intronic
1065413177 10:25453057-25453079 CTATTCAGCCTTTAAAAAGCAGG - Intronic
1065457395 10:25921403-25921425 TTACTCAGCCTTGAAAAGGAGGG + Intergenic
1066007583 10:31159913-31159935 TTATTCAGCTTTAAAAAAGAAGG - Intergenic
1066418700 10:35244715-35244737 TTACTCAGCCTTGAAAAGGAAGG - Intergenic
1066568615 10:36747914-36747936 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1066574247 10:36808217-36808239 TTACTCATTTTTTAAAAAAGTGG - Intergenic
1067174354 10:43932172-43932194 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1067331478 10:45325457-45325479 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1068198999 10:53758488-53758510 TTACTCCACATTTAAAAAGATGG + Intergenic
1068212968 10:53945805-53945827 TTACTCAGCCTTAAAAATGAAGG - Intronic
1068247091 10:54387384-54387406 TTATTCAGCCTTGAAAAAGAAGG + Intronic
1068317090 10:55359797-55359819 CTATTCAGCTTTTGAAAAGAAGG + Intronic
1068319919 10:55399030-55399052 TTACTCATCTTGTGAAAAACAGG + Intronic
1068850205 10:61729771-61729793 TTACTCAGCCTTTAAAAAGAAGG + Intronic
1069088244 10:64167432-64167454 TTATTCAGCCTTAAAAAAGGAGG - Intergenic
1069118908 10:64543902-64543924 TTTGTCAGCTTTTAAAAATAAGG + Intergenic
1069335860 10:67349362-67349384 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1069376956 10:67802693-67802715 GTTATCAGCTGTTAAAAAGCAGG + Intronic
1070234609 10:74610226-74610248 TTATTCAGCTTTAAAAAAGAAGG + Intronic
1070952156 10:80440117-80440139 CTTTTCAGCTTTTAAAAAGAAGG + Intergenic
1071090645 10:81913896-81913918 TATTTCAGCTTTTAAAAAGGAGG + Intronic
1071151195 10:82636597-82636619 TTATTCAGCCTTTAAATAGTAGG - Intronic
1071938430 10:90557524-90557546 TTAGTCTGCCTTTAAAAAGAAGG - Intergenic
1072021097 10:91402593-91402615 TCATTCAGCCTTTAAAAAGAAGG + Intergenic
1072079711 10:92016778-92016800 TTATTCAACATTTAAAAAGTGGG - Intronic
1072681034 10:97506839-97506861 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1072755122 10:98015105-98015127 TTATTCAGCTTTAAAAATGAAGG + Intronic
1072766683 10:98100167-98100189 TTACTCATTTTTTAAAGAGTTGG - Intergenic
1072813594 10:98483238-98483260 TTACTCAGTTTTTACATAACTGG + Intronic
1072879569 10:99212468-99212490 TTATTCAGCCTTGAAAAAGAAGG + Intronic
1073096244 10:100981737-100981759 TTATTCAGCTATTAAGAAACTGG + Intronic
1073156128 10:101348200-101348222 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1073200216 10:101729273-101729295 TTATTCAGCCTTTAAAAGGAAGG - Intergenic
1073245182 10:102085129-102085151 TTAGTCACCTTTTTAAAAGTTGG - Intergenic
1073346314 10:102785491-102785513 TTTTTCAACTTTTAAAAAGTGGG - Intronic
1073581429 10:104669569-104669591 TTATTCAGCTTTAAAAAGGGAGG - Intronic
1073997744 10:109335197-109335219 TTACTCAACATACAAAAAGCAGG + Intergenic
1074631850 10:115265571-115265593 TGACTCTTCTTTTAAAAAGATGG + Intronic
1074642824 10:115407564-115407586 TTATTCAGCCATTAAAAAGAAGG - Intronic
1074647194 10:115471124-115471146 TTATTAAGCCTTTAAAAAGCAGG - Intronic
1075108185 10:119557029-119557051 TTGCTCAACTTTTAACCAGCTGG + Intergenic
1075138592 10:119810451-119810473 TTACTCAGGTAATAGAAAGCAGG + Intronic
1075415580 10:122260128-122260150 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1075517947 10:123124290-123124312 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1075824498 10:125343236-125343258 TTATTCAGCCTTTAAAAGGAAGG - Intergenic
1075964660 10:126601005-126601027 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1076211390 10:128648400-128648422 TTACTCAGCATTAAAAAGGAAGG - Intergenic
1076385810 10:130054354-130054376 TTACTCAGTCTTTAAAAAGGAGG - Intergenic
1076547008 10:131252090-131252112 TTATTCAGCCTTAAAAAAGCTGG - Intronic
1077449389 11:2627631-2627653 ATATTCATCCTTTAAAAAGCAGG - Intronic
1077971159 11:7192581-7192603 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1078394621 11:10969733-10969755 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1078490806 11:11766619-11766641 CTACTCAGCCTTAAAAAAGAAGG + Intergenic
1078551441 11:12283487-12283509 TTATTCAGACTTTAAAAAGAAGG + Intronic
1078692393 11:13595257-13595279 TTACTCAGCTTTTGAAATCTAGG + Intergenic
1079084073 11:17432900-17432922 TTACACAGCTTATAAGTAGCAGG - Intronic
1079357429 11:19741628-19741650 TTATTCAACTTTTACAAAGAAGG - Intronic
1080030889 11:27659682-27659704 CCACTCAGCTTTTTAAAAGTAGG - Intronic
1080048396 11:27833924-27833946 TCACGCAGCTTTTGAAATGCAGG + Intergenic
1080334373 11:31179483-31179505 TTATTCAACCTTTAAAAAGAAGG + Intronic
1080389474 11:31831331-31831353 TAACTCAGCTAGTAAACAGCAGG + Intronic
1080952658 11:37053672-37053694 TTCCTCAGCTTTTCAAAATGTGG - Intergenic
1080957357 11:37114892-37114914 TTAATCAGCTTTGAAAAAGAAGG + Intergenic
1081745909 11:45472244-45472266 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1081889405 11:46528115-46528137 TTATTCAGCCTTTGAAAAGAAGG + Intronic
1082067570 11:47913263-47913285 TTTCTCAGCTGTAAAAAAGGGGG + Intergenic
1082736226 11:56859062-56859084 TTGCTATTCTTTTAAAAAGCAGG + Intergenic
1082874661 11:57975959-57975981 TTACGCAGCCTTTAAAAAGAAGG - Intergenic
1082954429 11:58854136-58854158 CTAATCAGCTTTTAAAAAGAAGG - Intronic
1083320013 11:61839938-61839960 TTACTCAGCCTTGAAAAGGGAGG - Intronic
1084060301 11:66668617-66668639 GTACTCAGCCTTTTAAAAACTGG - Exonic
1084078322 11:66799776-66799798 CTAGTCAGCCTTTAAAAAGAAGG - Intronic
1084353576 11:68622037-68622059 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1084418218 11:69046531-69046553 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1084753012 11:71216276-71216298 TCACTCAGCCTTTAAAAGGAAGG + Intronic
1085538297 11:77241238-77241260 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1085568518 11:77538522-77538544 CTATTCAGCCTTTAAAAAGGAGG + Intronic
1085951775 11:81341179-81341201 TAACCCAGATTTTAAAATGCTGG - Intergenic
1086096614 11:83056358-83056380 TTACTCAGCTTTAAAAAGGAAGG - Intronic
1086733513 11:90277856-90277878 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1086761131 11:90633043-90633065 TTACTTAGATTTTAAAAGGAAGG - Intergenic
1086936815 11:92754316-92754338 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1088502001 11:110492074-110492096 TTCCTCAACTTTAGAAAAGCTGG + Intergenic
1088613004 11:111596908-111596930 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1088745887 11:112804472-112804494 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1088766417 11:112984236-112984258 TTATTCAGCCTTTAAAAAGAGGG - Intronic
1088961925 11:114676921-114676943 TTGCTCAGCCTTAAAAAAGAAGG + Intergenic
1089070910 11:115698957-115698979 CTACACAGCTATTAAAAAGAAGG - Intergenic
1089310306 11:117553961-117553983 TTATTCAGCCTTTAAAAGGAAGG + Intronic
1089904387 11:122023547-122023569 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1090718962 11:129455374-129455396 CTACTCAGCCTTTAAAGAGAAGG - Intergenic
1090754048 11:129773092-129773114 CTAATCAGCATTTAAAATGCCGG + Intergenic
1090761827 11:129844108-129844130 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1090851397 11:130573690-130573712 TTACTCAGTCTTTAAAAGGAAGG - Intergenic
1090920516 11:131202464-131202486 TTACTCAGCCTTTAAAAAGTAGG - Intergenic
1091002122 11:131918494-131918516 TTACTCTGATTTTACAGAGCAGG + Intronic
1091364111 11:135002977-135002999 TTATTCAACCTTTAAAAAGAAGG - Intergenic
1091547453 12:1511338-1511360 CTACTCAGCCTTTAAAAAGAAGG - Intergenic
1091746826 12:2998177-2998199 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1091747542 12:3002199-3002221 TTACCCAGCCTTAAAAAAGAGGG - Intronic
1091919573 12:4293648-4293670 TCAATGAGCTATTAAAAAGCAGG + Intronic
1092073512 12:5653412-5653434 TTGCTCAGCTTATAAAGAGGTGG - Intronic
1092590454 12:9948603-9948625 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1093019327 12:14188550-14188572 GAACTCAGCTTTTAAAAAGCAGG + Intergenic
1093250666 12:16800437-16800459 TTATTCAGCCTTTAAAAAAGAGG - Intergenic
1093517146 12:20001872-20001894 TTATTCAGCCTTGAAAAAGAAGG + Intergenic
1093613262 12:21188945-21188967 TTATTCAGTCTTTAAAAAGAAGG - Intronic
1093801095 12:23374333-23374355 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1093825977 12:23689317-23689339 TTGCCAAGCTTTTAAAAAGTTGG - Intronic
1093875949 12:24349613-24349635 TTACTCAGCTTTAAAAAGGAAGG - Intergenic
1093980326 12:25468742-25468764 TTACTCAGCTACTAAACGGCCGG - Intronic
1094210019 12:27879232-27879254 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1094228702 12:28077911-28077933 TTAGTCAGCCTTTAAAAAGAAGG + Intergenic
1094240830 12:28222523-28222545 TTACTAAGCCTTGAAAAACCAGG + Intronic
1095147899 12:38752466-38752488 TAATTCAGCAATTAAAAAGCTGG + Intronic
1095215917 12:39547471-39547493 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1095260876 12:40098166-40098188 TTATGCAGCCTTTAAAAAGAGGG + Intronic
1095398855 12:41791698-41791720 TTACTGACTTTTTAAAAAGTAGG - Intergenic
1095408963 12:41901373-41901395 TTATTCAGACTTTAAAAAGAAGG + Intergenic
1095709455 12:45272964-45272986 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1095744059 12:45637869-45637891 TTACTCAGCTTCTAAAAGGAAGG + Intergenic
1096166836 12:49432757-49432779 TTATTCAGCCTTTAAAAAAAAGG - Intronic
1096314453 12:50551750-50551772 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1096395783 12:51265523-51265545 TTATTCAGCCTTGAAAAAGTAGG + Intronic
1097073515 12:56374805-56374827 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1097513520 12:60573089-60573111 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1097525039 12:60723087-60723109 TAATTCAGCCTTTAAAAAGAAGG - Intergenic
1097873331 12:64620274-64620296 TTATTCAGCCTTTAAAAGGAAGG - Intronic
1098139450 12:67436897-67436919 TGATTTAGCTTTTAAAAAGAAGG - Intergenic
1098150426 12:67540845-67540867 TTCCTCAGCATTTTAAAAACAGG + Intergenic
1098174464 12:67776534-67776556 TGATTCAGCCTTTAAAAAGAAGG + Intergenic
1098518567 12:71408433-71408455 TTATTCAGCCTTTTAAAAGAAGG + Intronic
1098603142 12:72357542-72357564 TTATTCAGTCTTTAAAAAGGAGG - Intronic
1098700960 12:73625243-73625265 TTACTCACTTGTCAAAAAGCAGG + Intergenic
1098799163 12:74931368-74931390 TTATTCAGCTTTAAAAACGAAGG - Intergenic
1098932428 12:76435208-76435230 TTATTCAGCTTTGAAAAAGAAGG + Intronic
1098963059 12:76759554-76759576 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1099026754 12:77474042-77474064 TTATTCAGCTTTTTAAAAGGTGG + Intergenic
1099294272 12:80810356-80810378 ATATTTAGCCTTTAAAAAGCAGG - Intronic
1099566646 12:84257125-84257147 TTACTCAGCCTTTAGAAACAAGG - Intergenic
1099761381 12:86924135-86924157 TTATTCTGCTTTTAAAAATAAGG + Intergenic
1099834653 12:87894324-87894346 TTATTCAGCATTTAAAAATAAGG + Intergenic
1099925726 12:89014233-89014255 TTAATCAGCATTCAAAAAACTGG + Intergenic
1100107821 12:91198478-91198500 TTATTCAGCTTTAAAAAAGAAGG - Intergenic
1100156190 12:91803385-91803407 TTACTCAGCCTTAAAAAAGATGG + Intergenic
1100285192 12:93158614-93158636 TTATTCAGCTGTAAAAAAGAAGG - Intergenic
1100485664 12:95024048-95024070 TTACTCAGCTTTTACAGAACTGG + Intronic
1101111327 12:101489411-101489433 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1101152898 12:101899728-101899750 TTCCTGAATTTTTAAAAAGCAGG - Intronic
1101164798 12:102018142-102018164 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1101519268 12:105466476-105466498 TTAATTAGCTTTGAAAAAGATGG - Intergenic
1101716328 12:107316470-107316492 TTATTCAGCTCTAAAAAAGAAGG - Intergenic
1101812286 12:108118165-108118187 TTATTCAGCTTGTAAAAAGATGG - Intergenic
1101863600 12:108502863-108502885 TTATTCAGCCTTTAAAAGGAAGG + Intergenic
1102326320 12:111987985-111988007 TTACTCAGCCTTAAAAACGAAGG + Intronic
1102690353 12:114755695-114755717 TTGCTAAGCTTTGTAAAAGCAGG - Intergenic
1102964816 12:117117835-117117857 TTATTCAGCCTTCAAAAAGAGGG - Intergenic
1103385389 12:120528501-120528523 GTATTCTGCTTTTAAAAAGGGGG + Intronic
1103657177 12:122480914-122480936 GTATTGAGTTTTTAAAAAGCAGG - Intronic
1103676811 12:122662438-122662460 CTATTCAGCGTTTAAAAAGAAGG - Intergenic
1103969057 12:124658395-124658417 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1103969165 12:124659192-124659214 TTACTCAGCCTTGAAAAGGAAGG - Intergenic
1104328385 12:127821426-127821448 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1104483961 12:129133402-129133424 TTATTCAGCCTTAAAAAAGTAGG + Intronic
1105515759 13:21089489-21089511 TCACTCAGCCTTTAAAAAGAAGG + Intergenic
1105540897 13:21315809-21315831 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1105820345 13:24075640-24075662 ATACTTAACTTTTAAAAAGCGGG - Intronic
1106056671 13:26244510-26244532 TTATTCAGCTATGAAAAAGAAGG + Intergenic
1106252971 13:27997081-27997103 CTACTCAGCCTTTAAAAAACAGG + Intergenic
1106380911 13:29238213-29238235 TTGTTCAGCCTTTAAAAAGAAGG + Intronic
1106430260 13:29674228-29674250 TTATTCAGCCTTAAAAAAGGAGG - Intergenic
1106622382 13:31383179-31383201 TTATTCAGCCTTAAAAAAGAGGG - Intergenic
1106731768 13:32548707-32548729 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1106771484 13:32965061-32965083 TTATCCAGCTTTTAAAAGGCAGG - Intergenic
1106797498 13:33221840-33221862 TTACTCAGCTTTAAAAAGCAAGG + Intronic
1106948171 13:34852161-34852183 TTATTTGGCTATTAAAAAGCAGG - Intergenic
1107044621 13:35981624-35981646 TTATTCAGCTTTAAAAAGGATGG - Intronic
1107593254 13:41931182-41931204 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1107640295 13:42435634-42435656 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1107640468 13:42438081-42438103 TTACTCAGCCTTAAAAAGGGAGG - Intergenic
1107779916 13:43888103-43888125 TTATTTAGCTTTAAAAAGGCAGG + Intronic
1107820343 13:44280264-44280286 TTATTCAGTTTTCAAAAAGAAGG - Intergenic
1107960544 13:45554298-45554320 CTACTCAGCCTTAAAAAAGAGGG - Intronic
1108175575 13:47789378-47789400 TTATTCATCCTTTAAAAAGAAGG + Intergenic
1108495736 13:51023344-51023366 TTATTCAGCCTTAAAAAGGCAGG + Intergenic
1108606902 13:52048633-52048655 CTATTCAGCTATTAAAAAGAAGG + Intronic
1109191891 13:59334677-59334699 TCATTCAGCCTTTAAAAAGAAGG + Intergenic
1109305111 13:60630405-60630427 CTACTCAGTCTTTAAAAAGAAGG - Intergenic
1109329296 13:60907835-60907857 CTACTCAGCCTTTAAAAAGAAGG + Intergenic
1109391390 13:61698386-61698408 TTATTCAACTTTTAAAAAGAAGG + Intergenic
1109489575 13:63078353-63078375 TCATTCAGCTTTTAAAAAGGAGG - Intergenic
1109607654 13:64718348-64718370 TCATTCATCTCTTAAAAAGCAGG - Intergenic
1109611953 13:64777185-64777207 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1109889324 13:68587553-68587575 TTATTTAGCCTTTAAAAAGAAGG - Intergenic
1110134684 13:72051624-72051646 TTACTCAGCCTTAAAAAAGAAGG - Intergenic
1110241964 13:73278212-73278234 TTACTTACCTTTAAAAAAGAAGG + Intergenic
1110548743 13:76787689-76787711 TTAATCAGCCTTTAAAAAGAAGG + Intergenic
1110642415 13:77840890-77840912 TTATTCGACTTTTAAAAAGAAGG - Intergenic
1110801032 13:79695021-79695043 CTACTCAGTCTTTAAAAAGAAGG - Intergenic
1111533856 13:89576096-89576118 CTAGTCAGCTTTTAAAAAGGAGG + Intergenic
1111534903 13:89590708-89590730 CAACTCAGTTTTTAAAAAGTAGG - Intergenic
1111749466 13:92310083-92310105 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1111842789 13:93472157-93472179 TTACTCAGCATATAAAGAACAGG - Intronic
1112064492 13:95778496-95778518 TTACTCAGCTTTTAAAAAGCAGG + Intronic
1112123864 13:96443122-96443144 TAACACAAATTTTAAAAAGCAGG + Intronic
1112295878 13:98186601-98186623 TTACGCAGCCTTTAAAAAGAAGG - Intronic
1112410334 13:99157443-99157465 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1112423536 13:99275783-99275805 CCAATCAGCTTTTAAAAAGCTGG - Intronic
1112588321 13:100739587-100739609 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1112873007 13:103997877-103997899 TTACTCTCTTTTTAAAAAGATGG + Intergenic
1113198956 13:107843313-107843335 TCACACAGCTTTTAAATTGCAGG + Intronic
1113645890 13:111995568-111995590 CTAGTCAGCTTTTAAATATCAGG + Intergenic
1113770573 13:112905718-112905740 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1114311082 14:21467864-21467886 TTACTCATCTTTAAAAAGGAAGG + Intronic
1114878978 14:26760122-26760144 TGATTCAGCCTTTAAAAAGAAGG + Intergenic
1114888510 14:26886098-26886120 TTAGTAAGCTTTAAAAAATCAGG + Intergenic
1115144783 14:30214110-30214132 TTACTCATCATTTAGAAAGTGGG - Intergenic
1115393885 14:32884902-32884924 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1115674811 14:35660775-35660797 CCACTCAGCCTTTAAAAAGAAGG + Intronic
1115959202 14:38816077-38816099 TTTTGCAGCTTTCAAAAAGCAGG - Intergenic
1115966510 14:38895666-38895688 TCATTCAGCCTTTAAAAAGCAGG + Intergenic
1116086482 14:40245551-40245573 TTATTCAGCCTTTAAAAAGGAGG - Intergenic
1116340617 14:43718565-43718587 TTATTCAGCTTTCATAAAGAAGG + Intergenic
1116497591 14:45581428-45581450 TTACTCAGCTTTTATTAGTCTGG + Intergenic
1116705506 14:48293244-48293266 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1116794505 14:49375422-49375444 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1116951003 14:50878453-50878475 CTCCACTGCTTTTAAAAAGCTGG + Intronic
1117027237 14:51633485-51633507 TTTCTCAGCCTTTCAAGAGCTGG - Intronic
1117110093 14:52443758-52443780 TTAGTCATCTTTTGAAAAACAGG - Intronic
1117210139 14:53488875-53488897 TTATTCAGCCTTTGAAAAGAAGG + Intergenic
1117589550 14:57252943-57252965 CTACTCAGCCATTAAAAAGAAGG + Intronic
1117673639 14:58133160-58133182 TTACTCAGCTGTCAAGAAGATGG - Exonic
1117691460 14:58311745-58311767 CTATTCAACTTTTAAAAAGAAGG + Intronic
1117999241 14:61507580-61507602 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1118265704 14:64293383-64293405 TTACTCGCTGTTTAAAAAGCAGG - Intronic
1118436797 14:65778718-65778740 TTTCTCCATTTTTAAAAAGCAGG - Intergenic
1119121239 14:72079867-72079889 CTACTCAGCCTTAAAAAAGAAGG - Intronic
1119125336 14:72120457-72120479 TTACTCATCTTTAAAACGGCAGG - Intronic
1119257825 14:73214614-73214636 TTATTCAGCTTTAAAAAGGAAGG + Intronic
1119485385 14:74983516-74983538 TTACTCAGCATTTAAAAGGAAGG + Intergenic
1119577594 14:75741019-75741041 ACTCTCAGCCTTTAAAAAGCTGG - Intronic
1119587795 14:75853439-75853461 GTCATGAGCTTTTAAAAAGCAGG + Intronic
1119589634 14:75873583-75873605 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1120044126 14:79787729-79787751 ATATTCAGCCTTTAAAAAGCAGG - Intronic
1120445917 14:84595718-84595740 CTAGTCAGCCTTAAAAAAGCAGG - Intergenic
1120478020 14:85013221-85013243 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1120937977 14:89917423-89917445 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1121092458 14:91192165-91192187 TTACTCAGCCTTAAAAAGGCAGG + Intronic
1121093246 14:91197726-91197748 TTATTCAGCCTTAAAAAGGCAGG - Intronic
1121099162 14:91238097-91238119 TTATTCAGCCTTAAAAAGGCAGG - Intronic
1121149241 14:91615626-91615648 CTACTCAGCCTTTTAAAAGAAGG - Intronic
1121235336 14:92387880-92387902 TTATTCAGCCTTTAAAAGGTAGG - Intronic
1121258128 14:92546455-92546477 TGACACAGCTGTTAAAAGGCAGG - Intronic
1121764293 14:96472459-96472481 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1121833976 14:97075806-97075828 TTATTCAGCCTCTAAAAAGAAGG - Intergenic
1122050034 14:99051313-99051335 TTATTCAGCCATTAAAAAGAAGG + Intergenic
1122404967 14:101495154-101495176 CTACTCAGCCTTTAAAAACAAGG + Intergenic
1122850943 14:104530639-104530661 TTACTCAGTTTTTAAATATGAGG + Intronic
1122980437 14:105189822-105189844 TTACTTAGCTTTAAAAAGGAAGG + Intergenic
1123708072 15:22965006-22965028 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1123985973 15:25646419-25646441 TTATTCAGCCTGTAAAAAGAAGG + Intergenic
1124359138 15:29021972-29021994 TTATTCGGCTTTTAAAAAGAAGG - Intronic
1124414269 15:29462082-29462104 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1124473839 15:30013220-30013242 TTACTCAACCTTTAAAAAGAAGG - Intergenic
1124984926 15:34598322-34598344 CTACTTAGCCTTTAAAAAGAAGG - Intergenic
1125013883 15:34911109-34911131 TGATTCACCTTTTAAAAAGAAGG - Intronic
1125269924 15:37927703-37927725 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1125642965 15:41247060-41247082 TTACTTAGATTTTAAGGAGCAGG - Intronic
1125786677 15:42324605-42324627 TTATTCAGCCTTTAAAACGAAGG + Intronic
1125828851 15:42697399-42697421 CTATTCAGCTGTTAAAAAGAAGG - Intronic
1125839784 15:42789429-42789451 TTATTCAGCTTTTAAAAAGAAGG - Intronic
1125876655 15:43153621-43153643 TTATTCAGCCTTTAAAAGGAAGG - Intronic
1125993287 15:44131598-44131620 TTATTCAGCCTTTAAAAGGAAGG + Intronic
1126463932 15:48943434-48943456 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126787652 15:52191267-52191289 TTTCTGAGCATTTCAAAAGCTGG + Intronic
1127139103 15:55955639-55955661 TTATTCAGCCTTTAAAAAGAAGG - Intronic
1127210170 15:56766188-56766210 TTACTCAGCTTTAAAAAGGAAGG + Intronic
1127794129 15:62423945-62423967 TTAGTCAGCCTTTGAAAAGAGGG - Intronic
1128494148 15:68182169-68182191 TCAAACAGCTTTTAAAAAGAAGG - Intronic
1129085390 15:73084479-73084501 CTATTCAGCCTTTAAAAAGGAGG - Intronic
1129129419 15:73479759-73479781 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1129975784 15:79820383-79820405 TTACTCAGCCTTGAAAAGGAAGG + Intergenic
1130159296 15:81383010-81383032 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1130203835 15:81857451-81857473 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1131216909 15:90545178-90545200 TTACTCAGCCTTGAAAAGGAAGG - Intronic
1131637483 15:94251968-94251990 TTATTCAGCCTTTAAGAAGAAGG - Intronic
1132126700 15:99232945-99232967 CTACTCAGCCTTAAAAAAGAAGG + Intronic
1132168607 15:99623239-99623261 TTATTCAGCATTAAAAAAGAAGG - Intronic
1132238995 15:100243160-100243182 TTACTCAGCCTTCAAAAGGAAGG - Intronic
1132241159 15:100258051-100258073 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1132259677 15:100411468-100411490 TTATTCAGCCTTTAAAAGGAAGG - Intronic
1133407652 16:5538284-5538306 TTTCTTAGCTTTTAAAATGGAGG + Intergenic
1133413180 16:5585340-5585362 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1134237813 16:12481335-12481357 TTAATTAACTTTTAATAAGCTGG + Intronic
1134760945 16:16714571-16714593 TTATTCAGCCTTTAAAAAGAGGG - Intergenic
1134774091 16:16836908-16836930 TCACTCAGCCTTAAAAAAGAAGG + Intergenic
1134798046 16:17059560-17059582 TTAGTCTGCCTTTAAAAAGAAGG + Intergenic
1134985113 16:18644603-18644625 TTATTCAGCCTTTAAAAAGAGGG + Intergenic
1135108879 16:19674889-19674911 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1135501980 16:23003963-23003985 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1136017446 16:27411000-27411022 TTATTCAGACTTTAAAAAGGAGG - Intronic
1136669574 16:31844221-31844243 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1136711909 16:32245017-32245039 TTATCCAGTTTTTTAAAAGCAGG - Intergenic
1136756007 16:32684389-32684411 TTATCCAGTTTTTTAAAAGCAGG + Intergenic
1136812106 16:33185983-33186005 TTATCCAGTTTTTTAAAAGCAGG - Intergenic
1136818582 16:33296063-33296085 TTATCCAGTTTTTTAAAAGCAGG - Intronic
1136825146 16:33352596-33352618 TTATCCAGTTTTTTAAAAGCAGG - Intergenic
1136830212 16:33451367-33451389 TTATCCAGTTTTTTAAAAGCAGG - Intergenic
1136869156 16:33788615-33788637 TTATTCAGCCTTTAAAAACAAGG - Intergenic
1137011423 16:35324773-35324795 TTATTCACCTTTGGAAAAGCAGG + Intergenic
1137024893 16:35463689-35463711 TTATTCAGTTTTTTAAAAGCAGG - Intergenic
1137030082 16:35514934-35514956 TTATTCAGTTTTTTAAAAGCAGG + Intergenic
1137534782 16:49311779-49311801 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1137746440 16:50823606-50823628 TCACTCAGCCTTTAAAATGCCGG - Intergenic
1137905939 16:52322153-52322175 GTATTCAGCCTTTAAAAAGAAGG - Intergenic
1137935872 16:52634971-52634993 TTTTTCAGCTTTTTAAAATCAGG + Intergenic
1137963139 16:52905636-52905658 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1138058336 16:53860138-53860160 TTACTCAGTCTTAAAAAAGAAGG + Intronic
1138098721 16:54234440-54234462 TTACTCAGCCTTGAAAAGGAAGG - Intergenic
1138291515 16:55851846-55851868 TTAGTCAGCCTTAAAAAAGGAGG + Intronic
1138721318 16:59083706-59083728 AAACTCAGTTTTTAAAAAGGTGG - Intergenic
1138797452 16:59986314-59986336 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1139022907 16:62774008-62774030 TTATTCACCTTTTAAATAGAAGG - Intergenic
1139183435 16:64774008-64774030 TTATTCAGACTTTAAAAAGAAGG - Intergenic
1139316754 16:66078564-66078586 CTACTCAGCCTTAAAAAAGAAGG - Intergenic
1139609118 16:68042197-68042219 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1139978151 16:70831393-70831415 TAACTCAGCTCTTAAGTAGCTGG - Intronic
1140038073 16:71386176-71386198 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1140184607 16:72756364-72756386 TTATTCAGCCTTAAAAAAGATGG - Intergenic
1140693749 16:77511024-77511046 TTCCATAGCTTTTCAAAAGCTGG + Intergenic
1140762784 16:78126174-78126196 TTCCACAGCTATTAAAAAGCTGG - Intronic
1142293469 16:89203454-89203476 TTATTCTGCCTTTAAAAAGAAGG - Intergenic
1202990684 16_KI270728v1_random:8953-8975 TTATCCAGTTTTTTAAAAGCAGG - Intergenic
1203058147 16_KI270728v1_random:944742-944764 TTATCCAGTTTTTTAAAAGCAGG + Intergenic
1203103017 16_KI270728v1_random:1327453-1327475 TTATTCAGCCTTTAAAAACAAGG + Intergenic
1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG + Intergenic
1142925561 17:3232915-3232937 TTACTCAGCTTGTAAAAGAATGG - Intergenic
1142969182 17:3599921-3599943 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1143702105 17:8668422-8668444 TTATTCAGTCTTTAAAAAGAAGG - Intergenic
1143823488 17:9584935-9584957 TTACTTAGCCTTTAAAAAGAAGG + Intronic
1144345221 17:14343668-14343690 TTATACAGCCTTTAAAAAGAAGG - Intronic
1144392428 17:14806985-14807007 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1144649642 17:16999214-16999236 TTATTCAGCTTTCAAAAGGAAGG - Intergenic
1145106935 17:20125704-20125726 TTATTCAGCCTTTAAAAGGAAGG - Intronic
1145120241 17:20252698-20252720 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1145292680 17:21561648-21561670 TTATTCAGCTTTTAAAAGGAAGG - Intronic
1145387289 17:22424294-22424316 TTATTCAGCTTTTAAAAGGAAGG + Intergenic
1145872091 17:28282782-28282804 TGACTCAGCTTTCAAGTAGCTGG + Intergenic
1146023114 17:29295626-29295648 TTAGTCAGCCTTAAAAAAGAGGG - Intergenic
1146145853 17:30415796-30415818 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1146233377 17:31133322-31133344 TTATTCAGCCTTTAAAAGGTAGG - Intronic
1146234014 17:31140767-31140789 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1146470835 17:33123299-33123321 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1146606831 17:34267059-34267081 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1146732577 17:35207142-35207164 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1146961972 17:36988454-36988476 TTACTTAGATTTTAAAAACTAGG - Intronic
1147370360 17:39988413-39988435 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1148015828 17:44521659-44521681 TTATTCAGTCTTTAAAAAGAAGG - Intergenic
1148892274 17:50816966-50816988 TTACTCAGCCTTATAAAAGAAGG - Intergenic
1148920635 17:51029571-51029593 TTACTCAGCCTTAAAAAGGAAGG + Intronic
1149153344 17:53595622-53595644 TTACTGGGCTTTTAGAATGCAGG + Intergenic
1149167677 17:53772951-53772973 TTATTCAGCCTTTAAAAGGCAGG - Intergenic
1149322885 17:55499324-55499346 TTTCACAGCTATTAAAGAGCAGG - Intergenic
1149365056 17:55935743-55935765 CTATTCAGCTTTTACAAAGAAGG + Intergenic
1149444263 17:56701364-56701386 TTTCTCACTTTTTAAACAGCTGG + Intergenic
1149689661 17:58564322-58564344 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1150110300 17:62493309-62493331 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1150198602 17:63328442-63328464 CTACTTAGCCTTTAAAAAGAAGG + Intronic
1150297891 17:64023723-64023745 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
1150309850 17:64119307-64119329 TCATTCAACTTTTAAAGAGCAGG - Intronic
1150327064 17:64265654-64265676 TTCCTCAGATTTCAAAAAGAAGG - Intergenic
1150450872 17:65266946-65266968 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1150540671 17:66095327-66095349 TTATTCAGTTTTTAAAAAGAAGG + Intronic
1150607645 17:66707880-66707902 TTACTCAGCATCTCAAGAGCTGG - Intronic
1150935810 17:69634167-69634189 CTATTCAGCTTTAAAAAAGAGGG + Intergenic
1152289610 17:79432130-79432152 TTACTCAGCCTTGAAAAGGAAGG - Intronic
1152652340 17:81500585-81500607 TTTCTCAGCTTTAAAAAGGAAGG + Intergenic
1152969536 18:148481-148503 TTACTAATTTTTTAAAAAGTAGG + Intergenic
1153292267 18:3513205-3513227 TTATTCAGCTTTGAAAAAGAAGG - Intronic
1153487172 18:5611302-5611324 TTACTCAGCCTTCAAAAGGAAGG + Intronic
1153492178 18:5660694-5660716 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1153558677 18:6346985-6347007 TTACTCAGCCTTTAAAAAGAAGG + Intronic
1153989388 18:10382703-10382725 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1154393542 18:13965810-13965832 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1155531385 18:26770500-26770522 TTACTCAGGCTTAAAAAAGAAGG - Intergenic
1155822834 18:30399605-30399627 TTACACATCTTTTTAAAAGAGGG + Intergenic
1155879022 18:31120916-31120938 GCACTCAGCCTTTAAAAAGAAGG - Intergenic
1156059188 18:33052763-33052785 TTACTAATCTTTTAGGAAGCAGG + Intronic
1156183553 18:34635199-34635221 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1157388535 18:47281120-47281142 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1157606807 18:48930971-48930993 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1157693957 18:49705906-49705928 TTATTCAGCCTTCAAAAAGAAGG - Intergenic
1157703753 18:49783101-49783123 TTATTCAGCCTTTAAAAAGAAGG + Exonic
1158062901 18:53367864-53367886 TTATTCAGCCTTTAAAAAGAAGG - Intronic
1158132221 18:54165013-54165035 GTACTAAACTTTTAAAAAGTTGG + Intronic
1158255078 18:55537290-55537312 TTGCCCAGCTTTTAAAATGATGG + Intronic
1158324488 18:56299456-56299478 TTATTTAACTTTTACAAAGCAGG - Intergenic
1158667310 18:59444070-59444092 TTATTCAGCCTTTAAAAAGATGG - Intronic
1158887634 18:61843611-61843633 TTATTCAGCCTTAAAACAGCAGG + Intronic
1159544330 18:69820060-69820082 TTACTCAGCCTTAAAAAAGGAGG - Intronic
1159617755 18:70600945-70600967 TTACTCAGTTTTTAAAAGAAAGG - Intergenic
1159691951 18:71499590-71499612 CTACTCAGCCTTTAAAAAGAAGG + Intergenic
1159763060 18:72452761-72452783 GTATTCAGCCTTAAAAAAGCAGG + Intergenic
1159795913 18:72843374-72843396 TGGTTCAGCTTTTAAAAAGGAGG - Intronic
1159875712 18:73808698-73808720 ATACTCAGTTCTTAAAAAGATGG + Intergenic
1159993052 18:74933200-74933222 TTACTCAGCCTTAAAAAGGAAGG + Intronic
1161650488 19:5481219-5481241 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1161884898 19:6987112-6987134 TTATTCAGCCTTTAGAAAGAAGG + Intergenic
1163068972 19:14822036-14822058 CCACTCAGCCTTTAAAAAGAAGG - Intronic
1163412429 19:17163811-17163833 TTACTCAGCCTTGAAAAGGAAGG - Intronic
1163985571 19:20945444-20945466 TCCCTCAGTTTTCAAAAAGCAGG - Intronic
1164059194 19:21651908-21651930 TCACCCAGGATTTAAAAAGCAGG - Intergenic
1164211431 19:23100971-23100993 GTCCTCACCTTTTAACAAGCTGG - Intronic
1164319076 19:24122687-24122709 TCACTCAGTCTTCAAAAAGCAGG - Intronic
1164467296 19:28498276-28498298 TTACTCAGCCTTAAAAAAGACGG + Intergenic
1164744741 19:30602867-30602889 TTAAGCAGCTTTTCAAAGGCAGG - Intronic
1164877695 19:31703495-31703517 TTACTCAGCCTTAAAAAAGAAGG - Intergenic
1164968434 19:32508795-32508817 TTATTCAGCCTTTAAAAAGTAGG - Intergenic
1165207227 19:34200287-34200309 ATACTGGGCTTTTAAAAAGTTGG + Intronic
1165280181 19:34790423-34790445 TTAATCAGCCTTAAAAAAGGGGG + Intergenic
1165289164 19:34869218-34869240 TTTTTCAGTTTTTAAAGAGCTGG - Intergenic
1165597329 19:37020703-37020725 TTATTCAGCCTTTAAATAGAAGG + Intronic
1165984984 19:39760350-39760372 TTATTCAGCCTTTAGAAAGAAGG + Intergenic
1166513308 19:43425894-43425916 CTATTCAGCTTTTAAAAACGTGG - Intergenic
1167196859 19:48035294-48035316 ATATTCAGCTTTTAAAAAGAAGG - Intronic
1167552171 19:50168808-50168830 TTATTCAGCCTTAAAAAAGGAGG - Intergenic
1167759270 19:51434424-51434446 TTACTCAGCCTTAAAATAGAAGG - Intergenic
1167856307 19:52244121-52244143 TTATTCAGCCTTTAGAAAGAAGG + Intergenic
1167977959 19:53246547-53246569 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1168362265 19:55751981-55752003 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1168442494 19:56381964-56381986 TCACTCAGACTTTATAAAGCAGG + Intronic
1168518911 19:57032971-57032993 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
924997884 2:380618-380640 TTATTTAGCCTTTAAAAAGAAGG + Intergenic
925273685 2:2634002-2634024 TTACTCAGCCTTGATAAAGGAGG - Intergenic
926130393 2:10299991-10300013 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
926204500 2:10826128-10826150 TTATTCAGCTATTAAAAGGAAGG + Intronic
926372471 2:12193787-12193809 TTATTCAGCTTTGAAAAAGAAGG - Intergenic
926563389 2:14442576-14442598 TTATTTAGCTTTTAAAAATAAGG + Intergenic
926609670 2:14933594-14933616 TTACTCATGTTTTAAAAAAGAGG - Intergenic
926981411 2:18574639-18574661 TTAGTCAGCCTTTAAAAAGAAGG + Intronic
926995155 2:18727154-18727176 TTATTCAGCTTTACAAAAGAAGG + Intergenic
926999953 2:18784210-18784232 ATACTCAGCTCATTAAAAGCAGG + Intergenic
927385598 2:22530119-22530141 TAACTCAGCATTTCAAAAGTAGG - Intergenic
927594973 2:24388401-24388423 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
927620460 2:24651360-24651382 TTATTCAGCCATTAAAAAGGAGG + Intronic
927896337 2:26784951-26784973 TTATTCAGCCTTTAAAAGGAAGG - Intronic
928386118 2:30869697-30869719 TTATTCAGCTTTGAAAAGGAAGG - Intergenic
928402573 2:30989933-30989955 CAACTCTGCTTTTAAAAAGAAGG + Intronic
928586080 2:32759925-32759947 TTATTCAGCCTTAAAAAGGCAGG - Intronic
928806717 2:35166355-35166377 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
929026525 2:37609673-37609695 TTATTCAACCTTTAAAAAGAAGG + Intergenic
929126987 2:38531241-38531263 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
929191438 2:39144205-39144227 TTATTCAGCTTTAAAAAGGAAGG - Intergenic
929230279 2:39552533-39552555 CCACTCAGCCTTTAAAAAGAAGG - Intergenic
929620900 2:43353075-43353097 TTATTCAGCCTTTAAAAAGGAGG - Intronic
929739189 2:44585109-44585131 TTACTCCCCTTTTAAAAAGCTGG - Intronic
929869628 2:45747542-45747564 TTACTCAGCCTTAAAAAAGGAGG - Intronic
930209871 2:48624880-48624902 TGATTCAGCTTTTTAAAAGAGGG - Intronic
930625670 2:53694773-53694795 TTATTCTCATTTTAAAAAGCAGG - Intronic
930855455 2:56011816-56011838 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
930891516 2:56393871-56393893 TTACTAGATTTTTAAAAAGCAGG - Intergenic
931023455 2:58078334-58078356 TTAATCAACCTTTAAAAAGAAGG - Intronic
931247319 2:60502233-60502255 TTCACCAGCTTTTACAAAGCAGG - Intronic
931263490 2:60640053-60640075 TTCCTCAGCCTTCAGAAAGCTGG - Intergenic
931337524 2:61362470-61362492 TTATTCAGCTTTTAAAAAGGAGG + Intronic
931472308 2:62550907-62550929 CTATTCAGCCTTTAAAAAGCAGG - Intergenic
931541112 2:63329921-63329943 TTATTCAGCCTTTAAAAAGAAGG - Intronic
931595451 2:63937811-63937833 TTACTCAGCCTTAAAAAGGAAGG + Intronic
931710276 2:64983798-64983820 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
932011827 2:67985936-67985958 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
932271036 2:70410216-70410238 TTATTCAGCTTTAAAAAAGAAGG + Intergenic
932348285 2:71010511-71010533 CTATTCAGCTTTAAAAAGGCAGG + Intergenic
932361051 2:71106111-71106133 CTACTCAGCCTTAAAAAAGAAGG + Intergenic
932509719 2:72273573-72273595 TTACTCAACTTTTAAGATTCAGG - Intronic
932518270 2:72377519-72377541 TTATTCAGACTTTAAAAAGATGG + Intronic
933360450 2:81276186-81276208 TTATTCAGCCTTAAAAAAGAGGG + Intergenic
933689339 2:85167558-85167580 TCATTCAGCTTTTTAAAAGAAGG + Intronic
933776989 2:85777028-85777050 TTACTCATCTTTTAACACTCAGG - Intronic
935000418 2:99009330-99009352 ATTCTGAGCTTTTAAAAAGTTGG + Intronic
935073033 2:99712585-99712607 TTCCTCATCTTTTTAAATGCAGG - Intronic
935126697 2:100230738-100230760 CTGCTCAGCTTTTAAAAGTCAGG + Intergenic
935203071 2:100875091-100875113 TTACTCAGCCTTGAAAAGGAAGG + Intronic
935225527 2:101048941-101048963 TTACTCAGCCTTGAAAAGGAAGG - Intronic
935390229 2:102543555-102543577 TTAGACAGCTTTGCAAAAGCCGG - Intergenic
935494289 2:103759253-103759275 TAACACAGTTTTTAAAAATCTGG + Intergenic
935511147 2:103975875-103975897 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
935604030 2:104951797-104951819 TTACTGAGCCTTTGAAAAGAAGG - Intergenic
936031763 2:109078328-109078350 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
936162942 2:110098546-110098568 TTATTCAGCCTTGAAAAAGAAGG - Intronic
936235214 2:110736560-110736582 TTATTCAGCCTTCAAAAAGGAGG - Intronic
936399547 2:112155152-112155174 TTTCTCAGCTTGGAAAAAGGGGG + Intronic
936559493 2:113524360-113524382 CTCCTCAGCTTATACAAAGCTGG - Intergenic
936606350 2:113960206-113960228 TTGCTCACTTTTTGAAAAGCAGG - Exonic
936969834 2:118166420-118166442 CTATTCAGCTTTCAAAAAGAAGG + Intergenic
936984224 2:118292853-118292875 GTATTCAGCCTTTAAAAAGCAGG - Intergenic
937686215 2:124700197-124700219 TTACTCAGCCTTAAAAAGGAAGG - Intronic
937706775 2:124930108-124930130 TTGCTCACTTTTAAAAAAGCTGG + Intergenic
938213597 2:129489482-129489504 CTACTCAGCCTTAAAAAAGAAGG - Intergenic
938375825 2:130805780-130805802 TTATTCAGTTTTTAAAAAGAAGG + Intergenic
939006529 2:136794471-136794493 TTACTCAATTTTCAAAAAGTTGG + Intronic
939017954 2:136923281-136923303 TTATGCAGCCTTTAAAAAGAAGG - Intronic
939494843 2:142915732-142915754 ATTTTCAGCTTTTAACAAGCAGG - Intronic
939622119 2:144432945-144432967 TTATTCAGCATTTAAAAGCCTGG + Intronic
939664313 2:144931746-144931768 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
939763615 2:146216980-146217002 CTATTTAGCTTGTAAAAAGCAGG + Intergenic
939968180 2:148631270-148631292 TTAATCAGCTTTAAAAAGGAAGG + Intergenic
940226220 2:151403714-151403736 TTATTCAGTCTTTAAAAAGCAGG - Intergenic
940286275 2:152035979-152036001 TTATTCAGCCTTAAAAAAGGAGG + Intronic
940470817 2:154097934-154097956 TTTCTCAGCTTTAAAAATGCAGG - Intronic
940801069 2:158133177-158133199 CTACTTAGCCTTTAAAAAGAAGG + Intronic
941001372 2:160206586-160206608 TTATTCAGCCTTTAAAAGGAAGG - Intronic
941046446 2:160681108-160681130 TTACTCAGCTTTTAAAAAGAAGG - Intergenic
941687845 2:168465550-168465572 TTATTCATCTTTTAAAAGGAAGG + Intronic
942109799 2:172669353-172669375 CTATTCAGCTTTTAAAAATCAGG - Intergenic
942266547 2:174233010-174233032 TTACTCAGCCCTTAAAAAGAAGG + Intronic
942336685 2:174895249-174895271 TTATTCAGCTTTTAAAATGAAGG + Intronic
942378305 2:175359755-175359777 GTATTCAGCCTTTAAAAAGAAGG + Intergenic
942732067 2:179071523-179071545 TAACTGAGTTTTTAAAAATCTGG + Intergenic
942803956 2:179908061-179908083 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
942849703 2:180469726-180469748 TTATTCAACCTTTAAAAAGAAGG + Intergenic
943129109 2:183835670-183835692 CTACTCAGCCTTAAAAAAGAGGG - Intergenic
943437849 2:187889082-187889104 TTAGCCATCTTTTAAAAAGGTGG - Intergenic
943574909 2:189619975-189619997 TTACACAGTTTTTAAAGAGAAGG - Intergenic
943643362 2:190382928-190382950 TAACTCAGCTTTCAAATAACTGG - Intergenic
943727749 2:191269330-191269352 TTACTCAGCCTTAAAAAGGAAGG - Intronic
944603984 2:201332890-201332912 CTATTCAGCCTTTAAAAAGAAGG - Intronic
944681474 2:202081182-202081204 TTACTCAGCTTTGCAAAAGAAGG - Intronic
945532492 2:210973490-210973512 CTATTCAGCATTTAAAAAGAAGG - Intergenic
945713028 2:213323785-213323807 CTACTCATCCTTTAAAAAGAGGG + Intronic
945913626 2:215679267-215679289 TGACTCAGCCTTGAAAAAGAAGG + Intergenic
946456979 2:219834670-219834692 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
946506149 2:220303237-220303259 TAACTCAGTTTTTAAAATGGAGG + Intergenic
946674635 2:222145807-222145829 TTACTCAGCCATTAAAAGGAAGG + Intergenic
947884174 2:233551536-233551558 TTACAAAGCTTTTTAAAAACAGG + Intronic
948009676 2:234641469-234641491 TAACTTAACTTTTAAAGAGCAGG + Intergenic
948065946 2:235080165-235080187 TTACTCAGGTTTAGAAAAGAAGG - Intergenic
948105234 2:235408132-235408154 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
948240193 2:236424994-236425016 CTATTCAGCTTTAAAAAAGAAGG - Intronic
948347272 2:237308944-237308966 TTATTCAGCCTTAAAAAAGTAGG - Intergenic
948538851 2:238670659-238670681 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
948566516 2:238890694-238890716 TTACTCAATTTTTAAAAATTCGG - Intronic
948751756 2:240137063-240137085 TTACTCAGCCTTTAAAAGGAAGG + Intergenic
948889657 2:240900892-240900914 TTACTCCGCCTTTAAAAGGAAGG - Intergenic
1168912199 20:1457756-1457778 CTACTCAGTCTTTAAAAAGAAGG - Intronic
1169107362 20:3008276-3008298 TTATTCAGCCTTTAAAAGGAAGG + Intronic
1169114539 20:3055064-3055086 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
1169361773 20:4956265-4956287 TTACTCAGTTTTACAACAGCAGG - Intronic
1169521294 20:6375868-6375890 TTATTCAGCATTTAAAAAGAAGG + Intergenic
1169626496 20:7577014-7577036 TTATTCAACCTTTAAAAAGTAGG + Intergenic
1169655725 20:7920707-7920729 CTATTCAGCCTTTAAAAAGTGGG - Intronic
1169918209 20:10705116-10705138 TTATTCAGCCTTTAAAAGGCAGG - Intergenic
1169925207 20:10776506-10776528 ATACTCAGCCTTTAAAAAGAAGG + Intergenic
1170631356 20:18069048-18069070 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1170863602 20:20132254-20132276 TTATTCAGCTTTTAAAAGGAAGG - Intronic
1170934636 20:20798982-20799004 TTGCTCAGTTTTTAAAAATTGGG + Intergenic
1172075213 20:32290925-32290947 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1172566253 20:35933027-35933049 TTACTCAGCCTTAAAAAGGGAGG - Intronic
1172846664 20:37933729-37933751 TTGCTCTGTTTTTTAAAAGCCGG + Intronic
1173283513 20:41650050-41650072 ATACTCAGCCTTTAAAAAACTGG - Intergenic
1173537442 20:43826794-43826816 TTACTCAGCCTTTAAAAGGAGGG - Intergenic
1173756047 20:45517274-45517296 CTACTCAGCCTTTAAAAAGAAGG - Intergenic
1173762114 20:45571811-45571833 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1173768630 20:45637698-45637720 TTACTCAGCTTTTAAAAAGAAGG - Intergenic
1173931324 20:46822302-46822324 TGGCTCATCATTTAAAAAGCTGG - Intergenic
1174238007 20:49110048-49110070 TTACTCAGCCTTAACAAAGGAGG + Intergenic
1174255432 20:49251098-49251120 GTAACCAGCTTTTAAAAAGCTGG + Intronic
1174612125 20:51806665-51806687 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1174639014 20:52027120-52027142 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1174671909 20:52316186-52316208 TTTCTCAGATTTTAAAAAAAAGG - Intergenic
1174862885 20:54108690-54108712 TAATTCAGCCTTTAAAAAGAAGG - Intergenic
1175956852 20:62615456-62615478 TTACTCAGCCTTAAAAAAGAAGG + Intergenic
1176040513 20:63063098-63063120 TTATTCAGCCTTTAAAAAGGAGG - Intergenic
1176077714 20:63255872-63255894 TTTCACATCTTTTAAAAATCGGG - Intronic
1176378733 21:6101147-6101169 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1177049347 21:16212437-16212459 TTAATGAGTTTTTAAAAAGGTGG - Intergenic
1177176917 21:17709584-17709606 TTATTCAGTTTTTAAAAAGAAGG - Intergenic
1177205714 21:18008681-18008703 TTATTCAGCCTTGAAAAAGAAGG - Intronic
1177409069 21:20706707-20706729 TTATTCAGCCTTTAAAACGAAGG + Intergenic
1177429034 21:20965537-20965559 TTATTCAGTTTTTAAAAAGAAGG + Intergenic
1177490606 21:21821018-21821040 GTATTCAGCCTTTAAAAAGAAGG + Intergenic
1177816281 21:25980820-25980842 TTACTCAGCTCCCAAGAAGCCGG + Intronic
1177938793 21:27383058-27383080 TTATTCAACCTTTAAAAAACAGG - Intergenic
1178167029 21:29991045-29991067 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1178529455 21:33363204-33363226 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1178557789 21:33608705-33608727 CTGTTCAGCCTTTAAAAAGCAGG - Intronic
1178726349 21:35055416-35055438 TTATTCAGCCTTAAAAAAGGAGG - Intronic
1178787777 21:35669724-35669746 TTATTCAGCCTTTAAAAATAAGG - Intronic
1178846605 21:36179151-36179173 TTACTCAGCAGTAAAAAAGAAGG - Intronic
1178974926 21:37213303-37213325 CTATTCAGCTTTTAAAAAGAAGG - Intergenic
1179031258 21:37721577-37721599 TTACTCAGCCTTAAAAAGGAAGG + Intronic
1179181158 21:39046433-39046455 TTATTCAGCCTTGAAAAAGAAGG - Intergenic
1179720099 21:43311370-43311392 TCAGGCAGCTGTTAAAAAGCGGG + Intergenic
1179744742 21:43437090-43437112 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1179900190 21:44388213-44388235 TTACTGAGCTTTAAAAAGGAAGG + Intronic
1180847202 22:18990364-18990386 TTACTCAGCCTTCAAAAGGAGGG - Intergenic
1181913899 22:26263710-26263732 TTACTCAGCATTTACAGTGCAGG + Intronic
1182002293 22:26929765-26929787 TTATTCAGCCTCTAAAAAGAAGG - Intergenic
1182507393 22:30793976-30793998 TTATTCAGCTTTTAAAAGGAAGG + Intronic
1182818129 22:33187299-33187321 CTATCCAGCTTTTAAAAAGAAGG + Intronic
1182931511 22:34178613-34178635 TTATTCAGCCTTTAAAAGGAAGG - Intergenic
1183178351 22:36240604-36240626 TTACTCAGCTGTAAAAAGGAAGG - Intergenic
1183621730 22:38977486-38977508 TTACTCAGCCTTGAAAAGGAAGG + Intronic
1183626767 22:39008641-39008663 TTACTCAGCCTTGAAAAGGAAGG + Intergenic
1183803449 22:40187811-40187833 TTTTTCAGTTTATAAAAAGCAGG + Intronic
1183812927 22:40273267-40273289 TTACTCATTTTTTAGAGAGCAGG - Intronic
1184105452 22:42365090-42365112 TTCAACAGCTTTTAAAAATCTGG - Intergenic
1184323897 22:43767172-43767194 TTACTAAGCCCTTAAAATGCCGG + Intronic
1184733287 22:46382706-46382728 TTACTCAGCCTTCAAAAGGAGGG + Intronic
1184761147 22:46545259-46545281 TTACTCAGCCTTCAAAAGGAAGG - Intergenic
1184971943 22:48028989-48029011 GTATTCAGCTTTTTAAATGCTGG - Intergenic
949263107 3:2125296-2125318 TTACTCAGCCTTGAAAAAGAAGG - Intronic
950211825 3:11129290-11129312 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
950266888 3:11580326-11580348 TTACTCAGCCTTAAAAAGGAAGG - Intronic
950325905 3:12109830-12109852 TTACTTAGCTTTTAAATGGTAGG - Intronic
950484098 3:13262719-13262741 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
950616447 3:14163723-14163745 TCACACAGCTTTTAAAGAGGGGG - Intronic
950735044 3:15000348-15000370 CTATTCAGCCTTTAAAAAGAAGG - Intronic
950830424 3:15869658-15869680 TTATTCAGCCTTAAAAAAGGAGG + Intergenic
951131505 3:19051494-19051516 TTACTGAGCATTAAAAAAACTGG - Intergenic
951148674 3:19260940-19260962 TTATTCAGCCTTAAAAAAGGAGG - Intronic
951631267 3:24723611-24723633 TTATTCAGCCTTTAAGAAGAAGG - Intergenic
951900519 3:27653467-27653489 TTACTCTGCTTTGCAGAAGCAGG + Intergenic
952035157 3:29191429-29191451 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
952212116 3:31238508-31238530 TTACTCAGATTTAAAAAATAAGG - Intergenic
952475736 3:33708412-33708434 TTATTCAGCCTTAAAAAAGAAGG - Intronic
953276298 3:41502028-41502050 CTATTCAGCCTTTAAAAAGAAGG - Intronic
953423719 3:42774830-42774852 TAACCCATTTTTTAAAAAGCAGG + Intronic
953593513 3:44284451-44284473 TTATTCAGCCTTTAAAAGGAAGG - Intronic
954099665 3:48359773-48359795 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
954585856 3:51735745-51735767 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
954889827 3:53915233-53915255 TTATTCAGCTTTAAAAAGGAAGG - Intergenic
954951256 3:54476175-54476197 TTATTCAGCCTTTAAAAAGAAGG - Intronic
955632992 3:60994942-60994964 TTTCTAAACATTTAAAAAGCTGG - Intronic
955870037 3:63428214-63428236 TTTCACAGATTTTAAAAAGCAGG + Intronic
956554297 3:70500787-70500809 GTACTCATCCTTTAGAAAGCAGG - Intergenic
956689831 3:71865253-71865275 TTACTCAGCATACAAAAAACAGG + Intergenic
956856053 3:73275834-73275856 CTACACAGCCTTTAAAAAGAAGG - Intergenic
957017232 3:75081688-75081710 TTATTCAGCCTTGAAAAAGAAGG + Intergenic
957035830 3:75291888-75291910 TCATTCAGCTTTAAAAAGGCAGG + Intergenic
957500421 3:81050192-81050214 TTACTCAGCCTTTATAAAGAAGG - Intergenic
957574770 3:81992992-81993014 TTATTCAGCTATAAAAAAGAAGG + Intergenic
957597814 3:82289833-82289855 TTAAACATCTTTTATAAAGCTGG - Intergenic
958008199 3:87840739-87840761 TTATTCAGCTTTAAAAACACAGG + Intergenic
958530126 3:95318001-95318023 CTACTCAGCCTTTAAAAAGAAGG + Intergenic
958898265 3:99854791-99854813 TTACTCAGCTTTAATTAAACAGG + Intronic
958993135 3:100870849-100870871 TTATTCAGCCTTAAAAAAGGAGG + Intronic
959061538 3:101620732-101620754 TTTCTCCTTTTTTAAAAAGCTGG + Intergenic
959166335 3:102783627-102783649 TTATTGAGTTTTTAAAAAACTGG + Intergenic
959451932 3:106516049-106516071 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
960616908 3:119604420-119604442 CTATTCAGCCTTTAAAAAGAAGG + Intronic
961148886 3:124619240-124619262 TTACTCAGCCTTTAAAAAGAAGG - Intronic
961310218 3:125992844-125992866 TTATTCAACCTTTAAAAAGAAGG + Intergenic
961419720 3:126792049-126792071 TTACTCAGCCTTAAAAAGGAAGG - Intronic
961845404 3:129758994-129759016 TTACTCAGCCTTAAAAAGGAAGG - Intronic
961875308 3:130018080-130018102 CTATTCAGCCTTAAAAAAGCAGG - Intergenic
962030501 3:131595377-131595399 TTATTCAGCCTTAAAAAAGAAGG + Intronic
962090150 3:132235407-132235429 TTATTCAGCTATAAAAAAGAAGG + Intronic
962090241 3:132236718-132236740 TTACTCAGCCTTTAAAAATAAGG + Intronic
962276164 3:134015247-134015269 TTATTCAGCCTTTTAAAAGGGGG + Intronic
962299748 3:134228501-134228523 TTATTCAACTTTTAAAAAAATGG + Intronic
962972439 3:140416015-140416037 TTACTCAGCGTTAAAAAAGAAGG + Intronic
963205000 3:142624606-142624628 ATACTTAACTTTTTAAAAGCTGG - Intronic
963537680 3:146548192-146548214 TTACTCAGCCTTATAAAAGAAGG - Intergenic
963658027 3:148084294-148084316 TTGCTCAGTTTTTAAAATTCTGG + Intergenic
963726187 3:148924214-148924236 TTACTCAGCCTTTAAAAATAAGG + Intergenic
963801612 3:149681730-149681752 TTATTCAGCTTTAAAACAGAAGG + Intronic
963844148 3:150138227-150138249 TTATTTAGCCTTTAAAAAGAAGG + Intergenic
963930323 3:150997821-150997843 TCACTCAGCTTTTAAAAGGAAGG + Intergenic
965141837 3:164847817-164847839 TTACTCATCTGTTAAAATACAGG + Intergenic
966529553 3:180960064-180960086 TTTCTCAGCCATTAAGAAGCTGG + Intronic
966556118 3:181261989-181262011 TTACTCAACCTTCAAAAAGAAGG - Intergenic
966566523 3:181388368-181388390 TTATTCAGCCTTGAAAAAGAAGG - Intergenic
966997816 3:185300794-185300816 TTATTCAGCCTTAAAAAAGAAGG - Intronic
967019907 3:185513731-185513753 TTACTCAGCCTTAAAAATGAAGG + Intronic
967227029 3:187301800-187301822 CTACTCAGCCTTCAAAAAGAAGG - Intergenic
967986991 3:195102627-195102649 TTACTCGGCCTTTAAAAAGAAGG - Intronic
968173925 3:196532717-196532739 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
968197498 3:196720379-196720401 TTACTCAGCTTTAAAAAGAAGGG - Intronic
968617603 4:1586038-1586060 CTACTCAGCCTTTAAAAAGAAGG - Intergenic
969786684 4:9463703-9463725 CTATTCAGCCTTCAAAAAGCAGG + Intergenic
969790112 4:9488176-9488198 TTATTCAGCCTTCAAAAGGCAGG + Intergenic
970129945 4:12857566-12857588 TTATTCAGCCTTGAAAAAGAAGG + Intergenic
970331681 4:14992786-14992808 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
970405852 4:15762881-15762903 TTACTCAGCCATAAAAAAGAAGG - Intergenic
970560893 4:17281366-17281388 TCACACAGCTTATAAAAAGTAGG - Intergenic
970923380 4:21421430-21421452 TTACTGAGCCTTTAAAAAGGAGG + Intronic
971056602 4:22920311-22920333 GTATTCAGCCTTTAAAAAGAAGG - Intergenic
971511517 4:27432135-27432157 TTATTCAGCCTTTAAAAGGAAGG + Intergenic
972422330 4:38900554-38900576 TTATTCAGATTTTAAAAAGAAGG + Intronic
972479275 4:39482632-39482654 TGAATCTGCTTTTAAAGAGCAGG + Intergenic
972698047 4:41467105-41467127 TTACTCAGCTTTTAAAAAGAAGG - Intronic
973017461 4:45159111-45159133 TTATTCAGCTTTTAAAAAGAAGG - Intergenic
973605647 4:52584692-52584714 TTATTCAGCCTTCAAAAAGGAGG + Intergenic
973797095 4:54438638-54438660 TTATTCAGCTTTAAAACAGAAGG - Intergenic
974068670 4:57104185-57104207 CTATTCAGCCTTTAAAAAGAAGG - Intronic
974086941 4:57271563-57271585 TTATTCAGCCTTTACAAAGAAGG - Intergenic
974139930 4:57873027-57873049 ATATTCAGCCTTTAAAAAGAAGG + Intergenic
974244389 4:59295148-59295170 TTACTCAGCCTTAGAAAAGAAGG + Intergenic
975175091 4:71279421-71279443 TTATTCAGCCTTTGAAAAACAGG - Intronic
975951625 4:79779377-79779399 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
976071801 4:81249544-81249566 TTATTCAGCCTTTAAAATGAAGG + Intergenic
976328915 4:83805285-83805307 TAATTCAGCCTTTAAAAAGAAGG + Intergenic
976455499 4:85242176-85242198 TTATTCTGCTTTTAAAAGGAAGG - Intergenic
976484206 4:85582027-85582049 TAACTTAATTTTTAAAAAGCAGG - Intronic
977006730 4:91576212-91576234 TTATTCAGCCTTTAAAAAGAAGG + Intronic
977139143 4:93344955-93344977 CAACTCAGCCTTTAAAAAGAAGG - Intronic
977507575 4:97921831-97921853 TTATTCAACCTTTAAAAAGAAGG + Intronic
977730400 4:100344289-100344311 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
977909045 4:102510977-102510999 AAAGTCAGCCTTTAAAAAGCAGG + Intronic
978007991 4:103641783-103641805 CTAGTCAGCCTTTAAAAAGAAGG + Intronic
978083176 4:104619532-104619554 TTATTCAGCTTTCAGAAACCTGG - Intergenic
978759791 4:112344111-112344133 ATACCCAGCTTTAGAAAAGCGGG + Intronic
978761714 4:112360255-112360277 TTACTCAGCCTTAAAATAGAAGG - Intronic
978870525 4:113571442-113571464 CTATTCAGCCTTTAAAAAGAAGG + Intronic
979443332 4:120779534-120779556 TTACTCAGCATTAAAAATACAGG + Intronic
979471250 4:121099882-121099904 TTATTCAGTCTTTAAAAAGAAGG - Intergenic
979658293 4:123222869-123222891 TTATTCAGTCTTTAAAAAGAAGG - Intronic
979793987 4:124821223-124821245 TTATTTAGCCTTTAAAAAGAAGG - Intergenic
980094802 4:128478421-128478443 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
980146659 4:128994352-128994374 CTATTCAGCCTTTAAAAAGAAGG - Intronic
980477698 4:133339739-133339761 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
980527114 4:134004770-134004792 CTACTGAGATTTTAAAAAGAAGG + Intergenic
981196196 4:141923583-141923605 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
981218045 4:142195104-142195126 TTATTCAGCCTTTAAAAAGATGG + Intronic
981656838 4:147121196-147121218 TTATTCAGCTGTAAAAAAGAAGG + Intergenic
981956929 4:150486968-150486990 CTACTCAGTCTTTAAAAAGAAGG - Intronic
982032105 4:151311164-151311186 TTATTCAGCCTTTAAAAAGAAGG + Intronic
982145457 4:152384336-152384358 TTATTCAGCTCTGAAAAAGAAGG + Intronic
982367149 4:154591695-154591717 TTACTCAGCCTTGAAAAAGAAGG + Intergenic
982534489 4:156592690-156592712 TTACTCAGCCTTGTAAAAGGGGG - Intergenic
982575344 4:157102517-157102539 TTATTTAGCCTTTAAAAAGAAGG - Intronic
982597261 4:157402961-157402983 TAATTCAGCCTTTAAAAAGAAGG - Intergenic
982829286 4:160041236-160041258 TTACACAGCATGTGAAAAGCTGG + Intergenic
984030540 4:174598877-174598899 CTACTCAGCCATTAAAAAGAAGG - Intergenic
984205724 4:176785580-176785602 TTTAGCAGATTTTAAAAAGCAGG + Intronic
984514595 4:180722290-180722312 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
984606741 4:181794638-181794660 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
984710090 4:182877623-182877645 TTACTCAGCCTTGAAAAGGAAGG - Intergenic
985074330 4:186198110-186198132 TTATTCACCTGTTAAAAGGCAGG + Intronic
985172434 4:187166240-187166262 TTATTCAGCTTTAAAAAAGAAGG + Intergenic
985792923 5:1940540-1940562 CTACCAAGCCTTTAAAAAGCAGG - Intergenic
985904968 5:2827256-2827278 CTACTCAGCCTTTAAAAAGCAGG + Intergenic
986537648 5:8807915-8807937 CTACTCAGCCTTTAAAAAGAAGG - Intergenic
986564908 5:9102839-9102861 TTACTCAAGTTTTAAAAAGTAGG - Intronic
986579635 5:9251950-9251972 TTACTGAGCTTTTAAATGGATGG + Intronic
986995964 5:13607650-13607672 TTATTCAGCCTTTAGAAAGAAGG + Intergenic
988027567 5:25717470-25717492 TTACTCAGCTCTTATGTAGCTGG - Intergenic
988032051 5:25775187-25775209 TTATTCAGCCTTTAAAAAGAGGG + Intergenic
988278885 5:29118353-29118375 TTATTCAGCTTTTAAAAAGAAGG - Intergenic
988414185 5:30925194-30925216 TTATTTAGCCTTTAAAAAGAAGG + Intergenic
988782647 5:34537345-34537367 TTACACAGCTTTTAAATAAAGGG + Intergenic
989139306 5:38187505-38187527 TCATTCAGCTTTTAAAAAGAAGG + Intergenic
989362948 5:40624240-40624262 TTACACAGCTTTTATGTAGCAGG - Intergenic
990013601 5:51030234-51030256 TTATTCAGCCTCTAAAAAGGAGG + Intergenic
990096327 5:52118659-52118681 TTTTTCAGCTTTTAAAAAGAAGG - Intergenic
990113024 5:52351249-52351271 TTATTCAGCTATAAAAAAGAAGG - Intergenic
990126185 5:52520178-52520200 TTACTCATCTATTAAAAAGAAGG + Intergenic
990509072 5:56473763-56473785 TTACTCAGCCTTAAAAAGGAAGG - Intronic
990550255 5:56868870-56868892 TTACTCAGCTTTACAAAGGAAGG + Intronic
990821537 5:59846109-59846131 TTACTCATCCTAAAAAAAGCAGG - Intronic
990840009 5:60067904-60067926 TTATTCAGCCTTAAAAAAGCAGG - Intronic
991171766 5:63634985-63635007 TTATTCAACTTTTAAAAAATAGG - Intergenic
991438952 5:66625941-66625963 TTATTCTGCCTTTAAAAAGAAGG + Intronic
991533562 5:67641358-67641380 CTACTCAGTCTTTAAAAAGAAGG + Intergenic
991679223 5:69122082-69122104 TTATTCAGCCTTTAAAAAGAGGG + Intronic
992306220 5:75441742-75441764 TCACTCAACCTTTAAAAAGAAGG - Intronic
992454808 5:76906936-76906958 CTATTCAGCCTTTAAAAAGAAGG - Intronic
992948042 5:81828983-81829005 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
993368902 5:87068076-87068098 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
993540532 5:89144959-89144981 TTACCCAGCCTTTAAAAAGAAGG - Intergenic
993776772 5:92009827-92009849 TTATTCAGCTTCAAAAAAGAAGG + Intergenic
993869453 5:93234552-93234574 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
994198763 5:96949065-96949087 TTAGTGAGGTTTTGAAAAGCTGG + Intronic
994569007 5:101489191-101489213 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
994584468 5:101688515-101688537 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
994911385 5:105913471-105913493 TCACTCTACTTTTAAAAAACTGG - Intergenic
995169266 5:109088373-109088395 TTAATCATTTTTTAAAAAGATGG + Intronic
995340180 5:111049385-111049407 TTATTAAGCTTTTAAAATGCAGG + Intergenic
995350276 5:111167071-111167093 TTACTGACCTTATAAAGAGCTGG + Intergenic
995691246 5:114828690-114828712 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
995700134 5:114926462-114926484 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
996026837 5:118656252-118656274 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
996065325 5:119072683-119072705 ATACTCAGCATTTAAAATGGTGG + Intronic
996264192 5:121515224-121515246 GTATTCAGCCTTTAAAAAGAAGG - Intergenic
996465076 5:123791163-123791185 TTACACAGCTTTTTAAATGATGG - Intergenic
996775986 5:127133210-127133232 TTATTCAGCTTTAAAAAGGAAGG - Intergenic
996952592 5:129145822-129145844 CTACTCAGCCTTTAAAAAGAAGG - Intergenic
996989229 5:129608149-129608171 TTACTAAGTCTTTAAAAAGAGGG + Intronic
997107774 5:131040825-131040847 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
997239835 5:132298294-132298316 TTATTCAGCTTTAAAAAGGAAGG + Intronic
997532274 5:134589044-134589066 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
997537487 5:134633792-134633814 TTATTCAGCTTTTATTCAGCTGG + Intronic
997871352 5:137507789-137507811 TTATCCAGCCTTTAAAAAGAAGG - Intronic
998109346 5:139489007-139489029 TTACTGAGCATTTACAAATCAGG - Intergenic
998311128 5:141133464-141133486 TTAGTCTACTTTTAAAAAACTGG + Intronic
998425160 5:142020310-142020332 TTATTCAGCCTTGAAAAAGAAGG - Intergenic
998656116 5:144181592-144181614 TTATTCAGCTTTTGTAAAGAAGG + Intronic
998867481 5:146519939-146519961 CTACTCAGCATTTCAAGAGCAGG - Intergenic
999433772 5:151546132-151546154 GTACTCAGATTTTGAAAAGATGG + Exonic
999470756 5:151852897-151852919 TTATTCAGCCTTAAAAAAGAAGG + Intronic
999714218 5:154346104-154346126 TTATTCAGCCTTAAAAAAGAAGG - Intronic
999765160 5:154735003-154735025 TTATTCAGCTTTAAAAAGGAAGG - Intronic
999795272 5:154983017-154983039 TTACACAGCCTTTAAAAGGAAGG - Intergenic
1000056240 5:157608992-157609014 GTACTGTTCTTTTAAAAAGCTGG + Intergenic
1000853045 5:166363577-166363599 TTACTCAGCTTTTATGCAGAAGG - Intergenic
1001141953 5:169151870-169151892 TTGCTCAGCTTGTAAGAGGCAGG - Intronic
1001194685 5:169661792-169661814 TTATTCACCCTTTAAAAAGGAGG - Intronic
1001437161 5:171708942-171708964 ATAATAAGATTTTAAAAAGCAGG - Intergenic
1001445688 5:171780914-171780936 TTACTCAGCTGGTAAGAGGCAGG - Intergenic
1001491142 5:172156359-172156381 TTATTAAGCTTGTAAACAGCAGG + Intronic
1001519993 5:172384688-172384710 TTACTCAGCCTTTAAAAGGAAGG - Intronic
1001523435 5:172412144-172412166 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1001608300 5:172979900-172979922 TTATTCAGCCTTTAAAAGGAAGG + Intergenic
1001793432 5:174481522-174481544 TTATTTAGCCTTTAAAAAGAAGG + Intergenic
1001841853 5:174883189-174883211 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1002083456 5:176751699-176751721 TTACTCAGCTTTAAAAAGGAAGG + Intergenic
1003213304 6:4087327-4087349 TTTCTCTGCTTTGAAAATGCAGG + Exonic
1003336588 6:5178922-5178944 TTATTCAGCTTTTGAAACGGTGG - Intronic
1003410824 6:5861458-5861480 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1003507918 6:6754885-6754907 TTATTCAGCTTTTTAAAAAAAGG - Intergenic
1003708012 6:8556583-8556605 TTACTCAACCTTTAGAAGGCAGG + Intergenic
1003804296 6:9708623-9708645 TTACTCAGCTTTAACAAAGAAGG + Intronic
1004562775 6:16766681-16766703 TTCCTCAGATTTTAAAAACTTGG + Intergenic
1004751615 6:18567701-18567723 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1004808420 6:19230332-19230354 TTATTCAGCCTTTAAGAAGAAGG - Intergenic
1004833429 6:19502502-19502524 TTATTCATCTTTTAAAAAGAAGG - Intergenic
1004897144 6:20159438-20159460 CTACTCAGCCTTTAAAAAGCAGG + Intronic
1004913258 6:20307224-20307246 TTACTCGGCTTTAAAAAGGATGG + Intergenic
1005054099 6:21713727-21713749 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1005319709 6:24641236-24641258 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1005963396 6:30709324-30709346 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1006351339 6:33523417-33523439 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1006383219 6:33713097-33713119 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1006527810 6:34622907-34622929 TTATTCAGCCTTTAAAAGGAAGG + Intronic
1006565107 6:34949437-34949459 TTAGTTAGCATTTAAAAAGTAGG + Intronic
1007466477 6:42055273-42055295 TTATTCAGCCTTTAAAAGGAAGG - Intronic
1007491335 6:42224366-42224388 TTACTCAAATTTGAAAATGCAGG + Intergenic
1007867526 6:44989316-44989338 TTACTCAGCCTTCAAAAAAGTGG - Intronic
1008191973 6:48470166-48470188 TTATTCAGTCTTTAAAAAGAAGG - Intergenic
1008432803 6:51439408-51439430 CTATTCAGCTTTTAAAAAGAAGG - Intergenic
1008471131 6:51886454-51886476 TTATTCAGCCTTTAAAGAGAAGG + Intronic
1008550285 6:52622750-52622772 TTATTCAGCCTTTCAAAAGAAGG + Intergenic
1008658183 6:53637648-53637670 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1008790749 6:55229543-55229565 TTATTCAGCCTTAAAAAAGAAGG + Intronic
1008956761 6:57224130-57224152 TTATTCAGCCTTAAAAAAGGAGG + Intergenic
1009584328 6:65578236-65578258 CTACTTAGCCTTTAAAAAGAAGG + Intronic
1009591622 6:65679349-65679371 TTATTCAGCTTTAAAAAAGAAGG + Intronic
1009623931 6:66111754-66111776 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1009906778 6:69878858-69878880 TTATTCAGCTTTAAAAGAGGAGG + Intronic
1009932479 6:70193047-70193069 TTAATCAGCTTCCAAAAAGATGG - Intronic
1009949979 6:70384177-70384199 TTATTCAGCCTTAAAAAAGGAGG - Intergenic
1010110815 6:72228505-72228527 TTACTAAGCCTTGAAAAAGAAGG - Intronic
1010193617 6:73218308-73218330 TAATACAGCATTTAAAAAGCAGG + Intronic
1010246832 6:73668357-73668379 TTATTCAGCTTTTAAAAAGACGG - Intergenic
1010322782 6:74532338-74532360 CTATTCAGCTTCTAAAAAGAAGG + Intergenic
1010337781 6:74707867-74707889 TTACTTAAATTTTTAAAAGCAGG + Intergenic
1010381415 6:75229699-75229721 CTAATCAGCTTTTGAAAAGAAGG + Intergenic
1010933814 6:81836111-81836133 CTATTCAGCTGTTAAAAAGAGGG + Intergenic
1011268174 6:85547904-85547926 TTACTCAGCCTTGAAAAGGAAGG + Intronic
1011754966 6:90489163-90489185 TTATTCAGCTTTAAAAATGAAGG - Intergenic
1011854885 6:91677343-91677365 TTTCAAAGCTTTTAAGAAGCAGG + Intergenic
1011908585 6:92405883-92405905 CTATTCAGCCTTAAAAAAGCAGG - Intergenic
1011916942 6:92518272-92518294 ATACTCAGCTTTCAAAAAGAAGG - Intergenic
1012003406 6:93682865-93682887 TTATTGAACTTTTAAAAAGGAGG - Intergenic
1012046707 6:94284944-94284966 TTACTCAGTTTGGAAAAAGAAGG - Intergenic
1012483796 6:99697834-99697856 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1012516307 6:100064397-100064419 TTGCACAGTTATTAAAAAGCAGG - Intergenic
1012522235 6:100135644-100135666 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1012700904 6:102456032-102456054 TTTTTCAGCTTTGTAAAAGCAGG - Intergenic
1012796121 6:103764095-103764117 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1012846150 6:104392131-104392153 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1013812462 6:114060311-114060333 CTAGACAGCTTTTAAAAAACAGG + Intronic
1013818523 6:114127739-114127761 TCACTCAGCCTTAAAAAAGAAGG + Intronic
1013905900 6:115219179-115219201 TTATTCAACTTTTAAAAAGAAGG + Intergenic
1014240067 6:119007596-119007618 TTACCAAACTTTTAAAAAACAGG - Intronic
1014322213 6:119943954-119943976 TTACTTTGCTTCTAAAATGCAGG + Intergenic
1014429900 6:121356204-121356226 TTAATCATGTTTTAAAAATCAGG - Intergenic
1014463873 6:121730804-121730826 TGACTCAGGTTTTGCAAAGCAGG + Intergenic
1014636428 6:123852656-123852678 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1014748954 6:125233206-125233228 TTATTAAGCTTTCAAAAAGATGG - Intronic
1014758889 6:125333218-125333240 TTATTCAGCATTAAAAAAGAAGG - Intergenic
1014763533 6:125385684-125385706 CTATTCATCTTTTAAAAAGTAGG - Intergenic
1014965606 6:127744486-127744508 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1014984317 6:127983508-127983530 TTAATAAGCTTTTACACAGCAGG - Intronic
1015168681 6:130227301-130227323 TTACTCAGCCTTAAAAATGAAGG - Intronic
1015324568 6:131909542-131909564 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1015380737 6:132564643-132564665 ATAATAAGCATTTAAAAAGCAGG - Intergenic
1015469123 6:133583441-133583463 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1015655468 6:135513482-135513504 TTACTCAGCCTTAAAAAAGAAGG + Intergenic
1015853257 6:137596599-137596621 TTAATGAGTTTTTAAAAAGTGGG + Intergenic
1015857140 6:137636877-137636899 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1016038921 6:139411753-139411775 TTTCTCTGCTTTCAAAAAGCAGG + Intergenic
1016180312 6:141138310-141138332 ATATTCAGCTTTTAAAAATTAGG - Intergenic
1016447084 6:144145205-144145227 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1016670721 6:146703636-146703658 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1016930735 6:149405557-149405579 TTACTCAGCCTTAAGAAAGAAGG + Intronic
1017275852 6:152567224-152567246 TTATTCAGCTTTTAAAAAGAAGG - Intronic
1017287414 6:152691847-152691869 TTATTCAACCTTTAAAAAGAAGG - Intergenic
1017432888 6:154388345-154388367 CTATTTAGCTTTTAAAAAGAAGG - Exonic
1018377346 6:163225869-163225891 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1018388587 6:163326581-163326603 TCAATCAGGTTTTAAAAACCAGG - Intergenic
1018622208 6:165740647-165740669 TTACTCAGCCTTAAAAAAGAAGG + Intronic
1018675057 6:166213433-166213455 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1018964207 6:168471420-168471442 TTACTCAGCCTTGGAAAAGAAGG - Intronic
1019046560 6:169153760-169153782 TTATTCAGCCTTTAAAATGAAGG - Intergenic
1019650583 7:2155640-2155662 TTACTCAGCCTTCAAAAGGAAGG - Intronic
1019762586 7:2824669-2824691 CTACACAGCTTTTAATAAGTCGG - Intronic
1019993412 7:4707991-4708013 TTACTCAGATTTCAGAAAACAGG - Intronic
1020356950 7:7288046-7288068 TTATTCTGCCTTTAAAAAGAAGG + Intergenic
1020676739 7:11192748-11192770 TTACTCATCTTTTCCAAACCAGG + Intergenic
1020870430 7:13622524-13622546 TTATTCAGCTTTTAAAAAGCAGG + Intergenic
1020941119 7:14538789-14538811 TTATTCACCCTTTAAAAAGATGG + Intronic
1021029616 7:15715140-15715162 ATACGCAGCTTTTAAAATCCTGG - Intergenic
1021288274 7:18810027-18810049 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1021301872 7:18983281-18983303 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1021322024 7:19224042-19224064 TTATTCAGCCTTGAAAAAGAAGG - Intergenic
1021404883 7:20253602-20253624 TTATTTAGCTTTAAAAAAGAAGG + Intergenic
1021441012 7:20676406-20676428 TTAATAAGCCTTTAAAAAGGAGG + Intronic
1021603540 7:22388524-22388546 TTATTAACATTTTAAAAAGCAGG - Intergenic
1021608931 7:22437650-22437672 TTCCTCAGGATTTAAAAAGCAGG - Intronic
1021630244 7:22637812-22637834 CTACTCAGCCTTTAAAAACTGGG - Intergenic
1021851279 7:24810857-24810879 TTGTTCAGCCTTTAAAAAGAAGG - Intronic
1022442435 7:30445447-30445469 TTACTCAGCCTTAAAAAAGAAGG + Intronic
1022552601 7:31255536-31255558 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1022626021 7:32037064-32037086 TTTCTCAGCTTTTGTAAGGCTGG - Intronic
1022800627 7:33773769-33773791 CTATTCAGCTTTTAAAAAGAAGG + Intergenic
1022960823 7:35424646-35424668 TTATTCAGCTTTAAAAAAGAAGG + Intergenic
1023008093 7:35896665-35896687 TGACTCCACTTTTAAAATGCAGG + Intronic
1023221427 7:37923018-37923040 TTACTCAGCTCTAAAAACTCCGG - Intronic
1023335366 7:39163822-39163844 CTATTCAGCCTTAAAAAAGCAGG + Intronic
1023372447 7:39525345-39525367 TTATTCAGCCCTTAAAAAGAAGG + Intergenic
1023392897 7:39727600-39727622 CTACTCAGCCTTTAAACAGCAGG - Intergenic
1023443462 7:40207995-40208017 TTATTCAGCCTTAAAAAGGCGGG + Intronic
1023675478 7:42624810-42624832 TTAATATGCTTTTAAAAATCAGG - Intergenic
1024029845 7:45450412-45450434 TTATTCAGCCTTTAAAAGGAAGG + Intergenic
1024180053 7:46882826-46882848 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1024224803 7:47318263-47318285 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1024364304 7:48503617-48503639 TTACTCAGCTTCAAAAGAGAAGG - Intronic
1024382173 7:48709644-48709666 TCTATCAGCTTTTTAAAAGCAGG + Intergenic
1024908427 7:54416669-54416691 TTATTTAGTCTTTAAAAAGCAGG + Intergenic
1025159536 7:56642704-56642726 TTAATTAGCTTTTAAAAAGCAGG + Intergenic
1025615828 7:63114883-63114905 TTTTTCAGCTTTAAAAAATCTGG - Intergenic
1025756151 7:64344626-64344648 TTAATCAGCTTTTTAAAAGCAGG - Intronic
1025805548 7:64828501-64828523 TCACTCATTTTTCAAAAAGCAGG - Intronic
1026234541 7:68514790-68514812 TTATTCATCCTTTAAAAAGAAGG - Intergenic
1026626956 7:72002716-72002738 ATATTCAGCTTTTAAAAAGAAGG + Intronic
1026864269 7:73813317-73813339 TTACTCAGCATACAAAGAGCCGG - Intronic
1027155860 7:75767386-75767408 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1027179492 7:75928271-75928293 TATCTCAGTTTTTAAAAATCAGG + Intronic
1027573658 7:79904217-79904239 CTATTCAGCCTTTAAAAAGATGG + Intergenic
1027722585 7:81763111-81763133 TTAAGGAGCTTTTAAAAATCAGG + Intronic
1027925071 7:84449914-84449936 TTAATTAGCTTTTAAAAACAAGG - Intronic
1028027375 7:85862704-85862726 TTTCACAGGTTTTAAAAATCAGG + Intergenic
1028287449 7:89021022-89021044 TGCCTCAGATATTAAAAAGCAGG - Intronic
1028296217 7:89135207-89135229 TTTCTCAGGTTTTACAAATCAGG - Intronic
1028403289 7:90447618-90447640 TTATTCAGCTTTAATAAAGAAGG - Intronic
1028698214 7:93742774-93742796 TCATTCAGCTTTTAAAAGGAAGG - Intronic
1028871034 7:95772060-95772082 TTACCCAGATTTTTAAAAGCTGG + Intergenic
1028949090 7:96613878-96613900 CTATTCATCCTTTAAAAAGCAGG - Intronic
1029093745 7:98068895-98068917 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1030246052 7:107385515-107385537 TTATTCAGCCTTTAAAAGGCAGG + Intronic
1030250320 7:107436259-107436281 TTATTCAGCCTTTAAAAGGAAGG + Intronic
1030504581 7:110404482-110404504 TTATTCAGCTTTAAAAAAGAAGG + Intergenic
1030528568 7:110682998-110683020 TTGCTCTGCTTATAAAAAGGGGG + Intronic
1030555196 7:111015212-111015234 TTATTCAGCTTTAAAAAGGAAGG + Intronic
1030578883 7:111327023-111327045 TTATTCAGCTTCTAAAAAGAAGG + Intronic
1030593955 7:111513842-111513864 TTATTCAGCTTTTAAAAAGAAGG + Intronic
1030917185 7:115329652-115329674 CTACTCAGCCTTTAAAAAGAAGG + Intergenic
1031036176 7:116790443-116790465 TTATTCTGCCTTTAAAAAGAAGG - Intronic
1031610525 7:123820981-123821003 TTAGTCAGCCTTTTAAAAGAAGG - Intergenic
1031780953 7:125963534-125963556 TTACTCACCTTTTAAAGAGAAGG + Intergenic
1031945368 7:127834028-127834050 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1032039322 7:128545624-128545646 TTACTCAGCCTTAAAAAGGAAGG - Intergenic
1032476196 7:132213063-132213085 TTACTCAGCCTTAAAAAGGGAGG + Intronic
1032503897 7:132421274-132421296 TTATTTAGCCTTTAAAAAGAAGG - Intronic
1032542446 7:132714564-132714586 GCACTCAATTTTTAAAAAGCAGG + Intronic
1032605720 7:133349491-133349513 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1032619918 7:133518651-133518673 TTACTCAGCCTTTAAAAGGGTGG + Intronic
1032770345 7:135047235-135047257 CTATTCAGCTTTAAAAAAGAAGG - Intronic
1032771335 7:135060730-135060752 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1032876059 7:136039348-136039370 TTACTTAGCTTTTAAAAACATGG - Intergenic
1033123294 7:138685243-138685265 TTATTCATCTTTAAAAAAGAGGG + Intronic
1033480094 7:141731213-141731235 TTAATTAGCTTTTAAAAATGAGG - Exonic
1033486456 7:141793984-141794006 TTATTCAGCTTTAAAAAAGAAGG + Intergenic
1033958939 7:146888658-146888680 TTATTCAGCTTTAAAAAACAAGG + Intronic
1033986429 7:147231266-147231288 TTATTCAGCCTTAAAAAAGAAGG - Intronic
1034116049 7:148584788-148584810 TTATTCAGCTTTAAAAATGAAGG - Intergenic
1034213419 7:149384425-149384447 TTACTCAGCTTTGAAAGGGAAGG + Intergenic
1034249702 7:149678588-149678610 CTACTCAGCCTTTAAAAAGATGG - Intergenic
1034281079 7:149854868-149854890 TTACACAGCTCTTTAAAAGCTGG - Intronic
1034535847 7:151725191-151725213 TTACTCAGCCTTAAAAAAGAGGG + Intronic
1034704629 7:153129448-153129470 TTATTCAGCCTTTAAGAAGAAGG - Intergenic
1034993663 7:155564809-155564831 TTACTCAGCCTTAAAAAGGAAGG + Intergenic
1035237338 7:157507280-157507302 TTACTCAGTCTTTCAAAAGAAGG - Intergenic
1036042728 8:5103996-5104018 TTTCTAGACTTTTAAAAAGCTGG - Intergenic
1036060583 8:5314497-5314519 TGAATCAGCTTTGAAAATGCTGG - Intergenic
1036073499 8:5468789-5468811 TTGCTTAGCCTTTAAGAAGCAGG + Intergenic
1036261380 8:7243160-7243182 CTATTCAGCTTTCAAAAGGCAGG - Intergenic
1036313420 8:7701704-7701726 CTATTCAGCTTTCAAAAGGCAGG - Intergenic
1036395147 8:8363375-8363397 TCACTCAACTTTTAAAAGGAAGG + Intronic
1036670469 8:10781998-10782020 TTACTCAGCCTTTAAAAAGGAGG + Intronic
1036769567 8:11569781-11569803 TTATTCAGCCTTAAAAAGGCAGG - Intergenic
1036790592 8:11716048-11716070 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1036795440 8:11753214-11753236 TTACTCAGCCTTTAAAAGGAAGG + Intronic
1037102410 8:15063357-15063379 TTGCATAGCTTTTAAAAAGGTGG + Intronic
1037116369 8:15234018-15234040 TTACTCATCTTTTAAAATATGGG - Intronic
1037523120 8:19699445-19699467 TTACTCAGCCTTAAAAAGGAAGG + Intronic
1037575914 8:20202477-20202499 TTACTAACTTTTTAAAAGGCTGG + Intronic
1037955991 8:23059178-23059200 TTACTCAGCCTTGAAAAGGAAGG - Intronic
1037962909 8:23112649-23112671 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1038045693 8:23764027-23764049 TTATTCAGCTTTAAAAAGGAAGG - Intergenic
1038172285 8:25147035-25147057 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1038348849 8:26758072-26758094 TGTCTTAGCTTTTAAAAATCAGG - Intronic
1038564294 8:28606856-28606878 TTACTCAGCCTTCAAAAGGAAGG - Intronic
1039954106 8:42194404-42194426 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1039984095 8:42433692-42433714 TTATTTAGCCTTTAAAAAGAAGG - Intronic
1040062747 8:43118218-43118240 TTACTCAGCTTTAAAAAGAATGG + Intronic
1040426493 8:47292675-47292697 TCACAAAACTTTTAAAAAGCAGG - Intronic
1040427778 8:47306448-47306470 TTATTCAGCCTTTAAAAAGAAGG - Intronic
1040946236 8:52887469-52887491 TCACTTAGTTTTTAAAAATCTGG + Intergenic
1041117784 8:54557035-54557057 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1041267289 8:56077455-56077477 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1041401431 8:57449558-57449580 TTATTCAGCCTTTGAAAAGAAGG - Intergenic
1041776802 8:61531872-61531894 TTATTCAGCCTTTAAAAAGAAGG - Intronic
1041958832 8:63587731-63587753 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1042017335 8:64328677-64328699 CTATTCAGCCTTTAAAAAGCAGG - Intergenic
1042074232 8:64971974-64971996 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1042199396 8:66266586-66266608 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1042494042 8:69436129-69436151 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1042771406 8:72386477-72386499 TTATTCAGCCTTAAAAAAGGAGG - Intergenic
1042914327 8:73860255-73860277 TTATACAGCATTTAAAAATCAGG - Intronic
1043346672 8:79305644-79305666 TTATTCAGCCTTAAAAAAGGAGG - Intergenic
1043593491 8:81857062-81857084 TTGCTAAGCATTTAACAAGCAGG - Intergenic
1043636769 8:82394124-82394146 CTACTCAGCCTTCAAAAAGAAGG - Intergenic
1044372225 8:91425558-91425580 CTATTCAGCTTTAAAAAAGAAGG + Intergenic
1044381306 8:91537128-91537150 TTATTCAACTTTAAAAAAGAGGG - Intergenic
1044489590 8:92797126-92797148 TTACTGAACTCTTTAAAAGCGGG - Intergenic
1044494005 8:92854836-92854858 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1044643488 8:94412205-94412227 CTACTCAGCCTTTAAAAAGAAGG - Intronic
1045038760 8:98200464-98200486 ATATTCAGCTTTTAAAAGGAAGG - Intronic
1045107215 8:98904590-98904612 GTACTCAGCCTTTTAAAAACTGG - Intronic
1045291778 8:100839721-100839743 CTAATCAGTTTTTAAAAAGAAGG + Intergenic
1045335031 8:101193309-101193331 TTAGTCACCTTATAAAATGCAGG - Intronic
1045536353 8:103032200-103032222 TTGCCCAGTTTTTAAAAAACTGG - Intronic
1045580333 8:103471678-103471700 CTATTCAGCTTTTAAAAAGAAGG - Intergenic
1045883350 8:107066418-107066440 TTATTCAGCCTTTTAAAAGAGGG + Intergenic
1045976477 8:108135115-108135137 TTATTCAGCTTTAAGAAAGAAGG + Intergenic
1046024780 8:108709335-108709357 TTACTAAGCCTTAAAAAAGAAGG + Intronic
1046161184 8:110367183-110367205 CTATTCAGCTTTAAAAAAGAAGG + Intergenic
1046267641 8:111851872-111851894 TTCCTCAGCTTCTACAAATCTGG + Intergenic
1046372015 8:113322568-113322590 ATGCTAAGCTTTAAAAAAGCTGG - Intronic
1046796121 8:118374315-118374337 TTATTCGGCCTTTAAAAAGAAGG - Intronic
1047326757 8:123846450-123846472 TAACACTGATTTTAAAAAGCTGG - Intergenic
1047586251 8:126277165-126277187 TTATTCAGCTTTACAAAAGAAGG - Intergenic
1047713181 8:127572051-127572073 TTTTTCAGCCTTTAAAAAGAAGG + Intergenic
1048050730 8:130813566-130813588 TTATTCAGGCTTTAAAAAGAAGG - Intronic
1048434842 8:134406603-134406625 TTATTCAGTTTTTAAAAAGGTGG - Intergenic
1048606774 8:135976714-135976736 TTACTCATCTTTTAAGGACCAGG + Intergenic
1048870693 8:138794718-138794740 GTATTCAGCCTTTAAAAAGAAGG + Intronic
1048932994 8:139330852-139330874 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1049893366 9:91830-91852 CTCCTCAGCTTATACAAAGCTGG + Intergenic
1050080243 9:1908350-1908372 TTATTCAGCCTTTAAAAGGAAGG - Intergenic
1050198594 9:3115297-3115319 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1050241421 9:3639865-3639887 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1050945124 9:11507718-11507740 TTATTCAGTCTTTAAAAAGAAGG - Intergenic
1050964142 9:11776096-11776118 ATTCTCATCTTTTTAAAAGCTGG + Intergenic
1051317419 9:15856537-15856559 TTACTCAGGTTTTCAAAGGAAGG - Intronic
1051747301 9:20307241-20307263 TTTCTCTGCTTTTAAAAAAGGGG + Intergenic
1051764220 9:20504403-20504425 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1051858242 9:21594270-21594292 TTATTCAGCTTTAAAAAGGAAGG - Intergenic
1051982773 9:23044792-23044814 TTACTCAGCCTTAAAAAAGGAGG - Intergenic
1052024275 9:23557396-23557418 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1052183601 9:25562632-25562654 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1052255423 9:26450418-26450440 CTATTCAGCTTTTAAAAAGAAGG + Intergenic
1052321940 9:27177020-27177042 TTATTCAGCCTTTGAAAAGAAGG - Intronic
1052702620 9:31956585-31956607 TTAGCCAGCCTTTAAAAAGAAGG + Intergenic
1053271872 9:36755603-36755625 GCACTCAGCTTTGAAAGAGCAGG + Intergenic
1053474750 9:38374420-38374442 TTATTCAGCCTTTAAAAAGAGGG - Intergenic
1053702146 9:40705516-40705538 TTACTCAGTGTTTAAAAACAGGG - Intergenic
1053734585 9:41091912-41091934 CTCCTCAGCTTATACAAAGCTGG + Intergenic
1054412206 9:64828976-64828998 TTACTCAGTGTTTAAAAACAGGG - Intergenic
1054693795 9:68339502-68339524 CTCCTCAGCTTATACAAAGCTGG - Intronic
1055000220 9:71440498-71440520 TTCCTCATCTTTTGAGAAGCAGG + Intronic
1055221245 9:73934566-73934588 CTATTCAGCTTTTAAAAAGGAGG + Intergenic
1055538988 9:77280939-77280961 CTATTCAGCTTTAAAAAAGGGGG + Intronic
1055569860 9:77605578-77605600 CTACTCAGTCTTTAAAAAGAAGG + Intronic
1055570595 9:77613024-77613046 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1055839059 9:80480843-80480865 TTACTCAGCATGAAAAAAGATGG - Intergenic
1055872261 9:80896119-80896141 CTAATCAGCCTTTAAAAAGAAGG + Intergenic
1056547259 9:87623131-87623153 TTACTCAGCTGTTAAGAAGGTGG - Intronic
1056838050 9:89973842-89973864 TTATTCAGCCTTTAAAAACATGG - Intergenic
1057369872 9:94461597-94461619 TTATTCAGCTTTAAAAAGGAAGG + Intergenic
1057524897 9:95789908-95789930 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1057692434 9:97296899-97296921 TTTCTCAGTTTCTAAAAAGCAGG - Intergenic
1058148648 9:101440058-101440080 TTATTCAGCTTTAAAAAGGAAGG - Intergenic
1058201690 9:102050156-102050178 TTAGACAGCTTTTTAAGAGCAGG - Intergenic
1058406696 9:104684658-104684680 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1058666333 9:107319499-107319521 TTTCCCAGTTTTTAAAAAGCTGG - Intronic
1059056686 9:110989458-110989480 TTACAAAAGTTTTAAAAAGCAGG + Intronic
1059082381 9:111264337-111264359 TTCCTCACCTTCTAAAAAGTAGG - Intergenic
1059190361 9:112319834-112319856 TTACTCAGTCTTTAAAAAGAAGG + Intronic
1059230137 9:112713123-112713145 TTACTCATTTTTTAAAAATTGGG - Intronic
1059860348 9:118453271-118453293 TTTCTCAACTTTTGAAAGGCAGG - Intergenic
1060687962 9:125629409-125629431 TTATTCAGCTTTTGAAAAGAAGG + Intronic
1061707956 9:132467527-132467549 TTACTCAGCCTTAAAAAGGAAGG - Intronic
1185764208 X:2711730-2711752 GTATTCAGCTTTAAAAAAGAAGG + Intronic
1185986444 X:4839932-4839954 TTATTCAGCCGTTAAAAAGGAGG - Intergenic
1185987719 X:4854486-4854508 TTATTCAGCCATTACAAAGCAGG + Intergenic
1186034739 X:5409628-5409650 TTGCTATGATTTTAAAAAGCTGG - Intergenic
1186439325 X:9571917-9571939 TTATTCAGCTTTAAAAAGGAAGG - Intronic
1186449777 X:9662372-9662394 TGACTCAGCTTTGAAAAGGAAGG + Intronic
1186651030 X:11560012-11560034 TTTCTTAGCTTTTAAAGAACAGG - Intronic
1187044789 X:15636348-15636370 CTATTCAGCCTTTAAAAAGAAGG + Intronic
1187060787 X:15785328-15785350 TTATTCAGCCTTTAAAAAGAAGG + Exonic
1187309846 X:18131425-18131447 CTATTCAACCTTTAAAAAGCAGG + Intergenic
1187329164 X:18320006-18320028 TTATTCATCTTTTAAAATGTTGG - Intronic
1187560706 X:20400385-20400407 TTATTCAACCTTTAAAAAGCAGG - Intergenic
1187751238 X:22467395-22467417 TTAATCAGCCTTTACAAAGGAGG - Intergenic
1187802887 X:23084034-23084056 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1187832650 X:23398601-23398623 TTACTATTCTTTTAAAAAACGGG - Exonic
1188049537 X:25467672-25467694 CTATTCAGCCTTTAAAAAGAAGG - Intergenic
1188098213 X:26047914-26047936 TTATTCAGCCTTAAAAAAGGAGG + Intergenic
1188160056 X:26788753-26788775 CAACTCAGCTTTAAAAAAGAAGG - Intergenic
1188316525 X:28681323-28681345 TTATTCAGCCTTTAAAAAGAAGG + Intronic
1188460685 X:30423476-30423498 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1188654682 X:32677912-32677934 TTATTCAGTCTTTAAAAAGAAGG + Intronic
1188678816 X:32976407-32976429 CTATTCAGCTTTTGAAAAGTAGG + Intronic
1188735758 X:33713120-33713142 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1188799930 X:34516561-34516583 TTACTTTTCTCTTAAAAAGCTGG + Intergenic
1189151809 X:38716784-38716806 TTATTCAGCCTTGAAAAAGAAGG - Intergenic
1189264629 X:39704580-39704602 CTATTCAGCCTTTAAAAAGGGGG + Intergenic
1189535659 X:41932940-41932962 TTATTCAGCCTTAAAAAAGAAGG + Intergenic
1189860776 X:45269491-45269513 CTATACAGCTTTTAAAAAGAAGG - Intergenic
1189932562 X:46029841-46029863 TTATCCAGCTTTAAAAAAGAAGG - Intergenic
1190156661 X:47999068-47999090 TCATTCAGCCTTTAAAAAGAAGG + Intronic
1190409344 X:50119695-50119717 TTATTCAGCCTTAAAAAAGAAGG - Intergenic
1190582328 X:51901405-51901427 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1190588483 X:51972433-51972455 TTATTCAGTCTTTAAAAAGAAGG + Intergenic
1190947299 X:55108504-55108526 GTATTCAGCCTTTAAAAAGAAGG + Intronic
1191024741 X:55901475-55901497 TTATTCAGCCTTTAAAAAGGAGG - Intergenic
1191157001 X:57284437-57284459 TTATTCAGCTTTTAAAAAGCAGG + Intergenic
1191664434 X:63684773-63684795 TTATTCAGACTTTAAAAAGAAGG + Intronic
1191670918 X:63747831-63747853 TTTCTCCTCTTTGAAAAAGCAGG - Intronic
1191819707 X:65291454-65291476 TTATTCAGTCTTCAAAAAGCAGG + Intergenic
1191909369 X:66131444-66131466 TCATTCAGCCTTTAAAAAGAAGG - Intergenic
1192136840 X:68610077-68610099 TTATTCAGCCTTTAAAAGGAAGG + Intergenic
1192188328 X:68973069-68973091 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1192253416 X:69433363-69433385 TTACTCATCCTTTAAAAAGAAGG - Intergenic
1192413588 X:70956920-70956942 TTACTCAGCCCTTAAAAGGAAGG + Intergenic
1192574400 X:72231232-72231254 TTATTCAGCCGTTAAAAGGCAGG + Intronic
1192605232 X:72509540-72509562 TTATTCCGCCTTTAAAAAGAAGG + Intronic
1192605741 X:72515357-72515379 TTATTCAGCCTTGAAAAAGAAGG - Intronic
1192771526 X:74196840-74196862 TTATTTAGCCTTTAAAAAGAAGG - Intergenic
1192838110 X:74824445-74824467 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1192893272 X:75412732-75412754 TTATTCAGTTTTTAAAAAGAAGG + Intronic
1192965331 X:76171193-76171215 TTATTCAGCTTTAAAAATGTAGG + Intergenic
1193024417 X:76829881-76829903 TTCCTGAGCTCTTAAAAAGTTGG + Intergenic
1193104834 X:77658968-77658990 TCTCTCATTTTTTAAAAAGCTGG - Intronic
1193125023 X:77861709-77861731 TTATTCAGCTTTGAAAAGGAAGG + Intronic
1193305008 X:79938736-79938758 TTATTCAGCCTTTAAAAAGAAGG - Intergenic
1193584549 X:83304748-83304770 CCACTCAACTTTTAAAAAGAAGG + Intergenic
1194334985 X:92634769-92634791 TTACTCATAATTTAAAAAGTGGG - Intergenic
1194383731 X:93226707-93226729 TTATTCAGCCTTTAGAAAGAAGG - Intergenic
1194460698 X:94164029-94164051 TTACTCAGCTTAAAAAAATAAGG - Intergenic
1194631065 X:96284711-96284733 TTATTCATCTTTAAAAAAGAGGG + Intergenic
1194748664 X:97659032-97659054 TTATTCAGCCTTTAAAATGAAGG - Intergenic
1194862841 X:99025431-99025453 TTATTCAGCCTTTAGAAAGAAGG - Intergenic
1195071865 X:101289230-101289252 CTATTCAGCCTTTAAAAAGAAGG - Intronic
1195401045 X:104461650-104461672 TTTTTCAGCTTTTAAAAGGAGGG - Intergenic
1195537984 X:106030610-106030632 TTATTCAGCTTTAAAGAAGAAGG - Intergenic
1195632767 X:107076381-107076403 TTATTTAGCCTTAAAAAAGCAGG + Intronic
1195864930 X:109421395-109421417 TTACTCAGCCTTAAAAAGGAAGG + Intronic
1195929261 X:110057349-110057371 TTATCCAGCCTTTAAAAAGAAGG - Intronic
1196264159 X:113622085-113622107 TTATTCAGCCTTGAAAAAGGAGG + Intergenic
1196335471 X:114527065-114527087 TTATTCAGCCTTTAAAAAGAAGG + Intergenic
1196362696 X:114884107-114884129 TTACTCAGCCTTAAAAGAGAAGG - Intronic
1196902070 X:120394523-120394545 TTATTCACCCTTTAAAAAGAGGG + Intergenic
1197015168 X:121616181-121616203 TTACTCAGCTTTAAAAGAGAAGG - Intergenic
1197113820 X:122807769-122807791 CTATTCAGCTTTGAAAAAGAAGG + Intergenic
1197179932 X:123523333-123523355 TTATTCAGCCTTAAAAAAGATGG - Intergenic
1197231614 X:124010460-124010482 TTACACACCTTTTAAAAGGAAGG - Intronic
1197237718 X:124087061-124087083 TAGCACAGATTTTAAAAAGCAGG - Intronic
1197558227 X:127984122-127984144 TTATTCAGCATTTAAAGAGAGGG - Intergenic
1197921589 X:131600072-131600094 TTATTCAGCCTTCAAAAAGGAGG - Intergenic
1198013715 X:132587255-132587277 TTCCTCAGCTTTTCAAGAGAGGG - Intergenic
1198491196 X:137143439-137143461 TTGCTCAGCCTCTTAAAAGCTGG + Intergenic
1198563053 X:137872208-137872230 TTACTAAGCCTTTAAATAGCAGG + Intergenic
1198615009 X:138447481-138447503 TTATTCATCCTTTAAAAAGAAGG - Intergenic
1198628001 X:138601199-138601221 ATACTCTGCTTTTACAAAGAAGG - Intergenic
1198698330 X:139368006-139368028 CTATTCAGCCTTAAAAAAGCAGG - Intergenic
1198885958 X:141337561-141337583 CTATTCAGCTTTTTAAAAGAAGG - Intergenic
1198969140 X:142261175-142261197 TTATGCAGCCTTTAAAAAGAAGG + Intergenic
1199100651 X:143795869-143795891 TTACTCAGTTTTTGAAATGGTGG + Intergenic
1199460006 X:148073941-148073963 TTATTCAACCTTTAAAAAGAAGG + Intergenic
1200113520 X:153757757-153757779 CTACTCAGCCTTTAAAAAGAAGG + Intergenic
1200414335 Y:2891992-2892014 TTATTCAGTTTTTAAAAGGAAGG - Intronic
1200619452 Y:5423586-5423608 TCACTCAGCTTTAAAAAATGAGG + Intronic
1200643463 Y:5751825-5751847 TTACTCATAATTTAAAAAGTGGG - Intergenic
1200841756 Y:7788775-7788797 TTATTCAGCTTTAAAAAAGAAGG - Intergenic
1201055253 Y:9982545-9982567 TTTTTCAGCTTGTAAAAAACAGG - Intergenic
1201345463 Y:12979354-12979376 CTATTCAGCCTTTAAAAAGAAGG + Intergenic
1201927804 Y:19308449-19308471 TTCCTCTGCTTTTCTAAAGCAGG + Intergenic