ID: 1112066108

View in Genome Browser
Species Human (GRCh38)
Location 13:95794905-95794927
Sequence CTCAGACATGTCTACAAATA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112066103_1112066108 29 Left 1112066103 13:95794853-95794875 CCATCTCAATGTAGTGTTTTAAT 0: 1
1: 0
2: 1
3: 19
4: 300
Right 1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG 0: 1
1: 0
2: 1
3: 10
4: 154
1112066107_1112066108 -4 Left 1112066107 13:95794886-95794908 CCTAATATTTGAAATGGGTCTCA 0: 1
1: 1
2: 2
3: 56
4: 413
Right 1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112066108 Original CRISPR CTCAGACATGTCTACAAATA TGG Exonic
901204898 1:7489012-7489034 CTCTGACATTTCTGCAAAGAGGG + Intronic
906538560 1:46566780-46566802 AACAGACATTTCTCCAAATAAGG - Intronic
906585070 1:46968478-46968500 CTCAGCCATCTCTACATGTATGG - Intergenic
909588942 1:77323886-77323908 CTCATACATTTCCAAAAATAAGG + Intronic
909750259 1:79150869-79150891 TTCTGAGTTGTCTACAAATAAGG - Intergenic
911589947 1:99735666-99735688 CTCAAAAATGTTTACAAAAAAGG - Intronic
911814833 1:102334346-102334368 CACAGACATGTCTGCAATGAAGG + Intergenic
914739159 1:150448961-150448983 CTAAGACATTTCTAAATATAAGG - Intronic
916268003 1:162910654-162910676 TTCTGACATGGCTACAAATCTGG - Intergenic
918419071 1:184343569-184343591 CTCACACATGACTACAATAATGG - Intergenic
919177037 1:194032315-194032337 CACAGACATTTCTCCAAAGAAGG + Intergenic
921614301 1:217248608-217248630 CTCACAAATGTCTTCTAATATGG - Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1063912415 10:10844973-10844995 CTCACACTTTTCTACAAAAATGG - Intergenic
1064698453 10:17991785-17991807 CTGATAAATGTCTACAGATATGG + Intronic
1071296752 10:84226593-84226615 CTCAAACTTTTCTAAAAATATGG - Intergenic
1073888612 10:108070616-108070638 CTCCAACATTTCTAGAAATATGG + Intergenic
1074134129 10:110612409-110612431 TTCAGAGCTGTCTACAAATCTGG + Intergenic
1075964298 10:126597860-126597882 CTGAGCCATTGCTACAAATATGG + Intronic
1076359931 10:129880800-129880822 CTCAGACATGACCAAAACTAGGG - Intronic
1077406538 11:2384842-2384864 CTCTGCCTTGTCTACAAACAAGG - Intronic
1079283837 11:19111252-19111274 CTGAGCCATGTCTACAAAGTGGG + Intergenic
1079804015 11:24906942-24906964 CTCAGAGTTGTCTAGAAGTAAGG + Intronic
1083732083 11:64657848-64657870 CACACACATGTCTACAGATGGGG + Intronic
1083870061 11:65481678-65481700 CTCATACAGGTCTCCATATAGGG + Intergenic
1087266549 11:96067947-96067969 ATCAAACATGTTTATAAATAGGG + Intronic
1091079294 11:132651550-132651572 CCTAGTCATGTTTACAAATAAGG - Intronic
1091150171 11:133321041-133321063 CTCAGCCATGTCTTCATGTACGG + Intronic
1091363058 11:134993473-134993495 CTCAGTCATGCCAACAATTATGG - Intergenic
1092913804 12:13171703-13171725 CTAAGACATGTCTTGAAATGTGG - Intergenic
1092962089 12:13606097-13606119 CTCTGACAAGTCTACACATGGGG + Intronic
1093494412 12:19739411-19739433 CTCAAACATCTCTTCAAATGAGG - Intergenic
1097376585 12:58850555-58850577 CCCAGACATTTCTAAAAATATGG + Intergenic
1099190349 12:79555101-79555123 CTCAGACAAGTCATCAAATCAGG + Intergenic
1100161828 12:91869626-91869648 CTCATACATGTATATATATATGG - Intergenic
1100872806 12:98929400-98929422 CTCATTAATTTCTACAAATAAGG - Intronic
1101191227 12:102335537-102335559 CTCAGACTTGTCTAAAATCAAGG + Intergenic
1103206354 12:119132121-119132143 CACAGACATCTCTACCAAGAAGG - Intronic
1106206524 13:27601412-27601434 CTCAGCAATGTCTGCAGATAGGG - Intronic
1107219464 13:37964351-37964373 CTCCTACATTTTTACAAATAAGG - Intergenic
1108549188 13:51526232-51526254 CACAGACACGTCCAGAAATAAGG + Intergenic
1110412310 13:75217966-75217988 ACCAGAAATGTCTATAAATAAGG - Intergenic
1110517340 13:76430028-76430050 CTCAGACATTTATACAAGTTTGG - Intergenic
1110933884 13:81258582-81258604 TTCAGACATGTTGAAAAATATGG + Intergenic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1112086780 13:96040488-96040510 CACAGACATTTTTCCAAATAAGG + Intronic
1113182871 13:107651390-107651412 CTCAGATATTTATTCAAATAAGG - Intronic
1114528784 14:23382320-23382342 CTCAGAACTGCCTACATATAGGG + Intronic
1118245094 14:64102420-64102442 CTCAGACAGGAATAAAAATAAGG + Intronic
1119822399 14:77628768-77628790 ATCAGCAATGTCTACAAAAAAGG - Intergenic
1120510263 14:85404791-85404813 CTCATACATGTCTAGGAACAGGG + Intergenic
1122422107 14:101584133-101584155 CTCAGCCATGTCTGCAGATCCGG + Intergenic
1125320587 15:38483843-38483865 CTCATACATATGTACAATTATGG - Intronic
1126654664 15:50964217-50964239 CAAAGACATGTCTTCAAATTTGG + Intronic
1127545418 15:59990158-59990180 CTCAGAAATGTATACAGAAAAGG + Intergenic
1130228942 15:82081904-82081926 CTCAGTCTTGTCTGCAAATTTGG + Intergenic
1130244556 15:82233124-82233146 TTCACACATGTGTACACATACGG + Intronic
1130456079 15:84110016-84110038 TTCACACATGTGTACACATACGG - Intergenic
1141172868 16:81702146-81702168 CTCACACATGTGTACACAGAAGG + Intronic
1203016183 16_KI270728v1_random:355165-355187 CACGGAGATGGCTACAAATAGGG - Intergenic
1203034518 16_KI270728v1_random:628323-628345 CACGGAGATGGCTACAAATAGGG - Intergenic
1145785247 17:27589233-27589255 CTCAGACACCTCTGCAAATAGGG - Intronic
1146681507 17:34811563-34811585 CTCAGACATTTGAAAAAATAGGG - Intergenic
1149316357 17:55442615-55442637 CTCAGACTTGTCCCCAAATAGGG + Intergenic
1150870260 17:68901323-68901345 AACAGACATTTCTACAAAGAAGG + Intronic
1152886153 17:82851569-82851591 CTCAGACACGTGTACAGAAAAGG + Intronic
1155027678 18:21957283-21957305 CTCAGAAATGTCTTCAAATGTGG + Intergenic
1155575797 18:27245232-27245254 TTAAAACATGTCTACAACTATGG + Intergenic
1156104283 18:33638729-33638751 CTCAGTCATGTCTATAAAACTGG + Intronic
1157193006 18:45597014-45597036 CTCAGACAAGTCTCCAAAGAAGG + Intronic
1157730368 18:49999047-49999069 CTCACACATGTTTACTAATGTGG + Intronic
1158608121 18:58914262-58914284 ATCAGACCTGTTTACAAAAAAGG - Intronic
1159263627 18:66049855-66049877 CTATGACATGTCTAGATATAAGG + Intergenic
1168428000 19:56254837-56254859 CTTAGACATTTCTCCAAAGAAGG - Intronic
925629837 2:5880637-5880659 CTCAGACCTGCGTACACATAGGG - Intergenic
925818232 2:7774154-7774176 CCCAGACAGGTCTACAGATGTGG + Intergenic
929799409 2:45086488-45086510 CTTAAACATGTCTATCAATAGGG - Intergenic
935901528 2:107798525-107798547 TTCAGGGATGTGTACAAATAAGG + Intergenic
939131984 2:138246141-138246163 CTCATACATTTCTACAGTTATGG - Intergenic
941046832 2:160685691-160685713 CTCAGACTTCTGTACAATTACGG + Intergenic
941154973 2:161966172-161966194 CTCAGAAATTTATACCAATATGG + Intronic
944063509 2:195594691-195594713 CTCAGACAGTTTGACAAATAAGG - Intronic
944265384 2:197719092-197719114 CATAGTTATGTCTACAAATATGG + Intronic
1170271952 20:14537387-14537409 CTCAGAATTGTCTACACCTAGGG + Intronic
1174541920 20:51296492-51296514 CTCAGACATGTCTAAGAACTGGG + Intergenic
1175713828 20:61242305-61242327 TGCAGACATTTCTAGAAATAGGG + Intergenic
1177648651 21:23932921-23932943 CTTAGGCATGTCTACAATTAAGG + Intergenic
1178151595 21:29800818-29800840 CTCCGACTTGTCTACATACAGGG - Intronic
1179718801 21:43303893-43303915 TTCAGAAATGTCTAGAAAAAAGG + Intergenic
1182007681 22:26974903-26974925 CTCAGAGATGTGTAAAAATCTGG + Intergenic
949662729 3:6298932-6298954 CTCAGACATGACCAGAAATAGGG + Intergenic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
955117982 3:56024841-56024863 CTCAGACACTTCTCCAAATATGG + Intronic
955533410 3:59898410-59898432 CGCACACATATATACAAATATGG - Intronic
956489987 3:69760548-69760570 CTCAGAAATCTCTAGAAAAAGGG + Intronic
958787104 3:98609458-98609480 GTCAGACATGTGTTCAAATCTGG + Intergenic
960104546 3:113780312-113780334 CTTACACGTGTCTAAAAATATGG + Intronic
962375554 3:134856050-134856072 CTCACACAGGAATACAAATAAGG + Intronic
964850702 3:161093341-161093363 CTCAGGCATGTAGATAAATAAGG + Intronic
965907904 3:173732962-173732984 CACAGAAATATATACAAATATGG + Intronic
968378393 4:65171-65193 CACAGACATGGCTACAGACAAGG - Intronic
968394723 4:224261-224283 CACAGACATGGCTACAGACAAGG - Intergenic
973860209 4:55056700-55056722 CTCTCACAAGTCTACAATTAAGG + Intergenic
974197924 4:58600641-58600663 CTGACAAATGGCTACAAATATGG + Intergenic
974601250 4:64083231-64083253 TTCACACATGGCTATAAATAAGG - Intergenic
975442341 4:74425833-74425855 CTCAGACATGTCATCTAAGATGG - Intergenic
981932610 4:150207363-150207385 CCCAGACATGTATACAAAGAGGG - Intronic
982866122 4:160514006-160514028 TTCAGACATTTATACCAATATGG - Intergenic
983160828 4:164412321-164412343 CTCAGAATTGTCTTCAACTAAGG - Intergenic
983354912 4:166644674-166644696 GTCAGAAATGTCTACAATTTGGG + Intergenic
983435655 4:167711645-167711667 CTGAGACGTGGCTATAAATACGG + Intergenic
988094814 5:26591976-26591998 CCAATACATGTCTAAAAATAAGG + Intergenic
992157883 5:73972660-73972682 TTCAGAAATGTATAGAAATAGGG - Intergenic
992575554 5:78106890-78106912 CTCAGAGAGGTCTAAAAATTTGG + Intronic
993935391 5:93994354-93994376 TTCATATATGTCTTCAAATATGG - Intronic
994247498 5:97496678-97496700 CTCAAACATGTTTAAAAGTAAGG + Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
999097352 5:148991808-148991830 GTCAGAGAACTCTACAAATATGG + Intronic
999513154 5:152273758-152273780 CTCAGAGATTTCTACAAACCAGG + Intergenic
1000168375 5:158677480-158677502 TTCAGATCTGTCTTCAAATAGGG + Intergenic
1000619182 5:163463089-163463111 CTCAGAAATGCCTTCAAATCTGG + Intronic
1002853081 6:1013462-1013484 AGCTGACAAGTCTACAAATAAGG - Intergenic
1006778795 6:36617646-36617668 CTAAAACATATCTCCAAATATGG - Intergenic
1008465551 6:51826305-51826327 CCCATTCATGTCTTCAAATAAGG + Intronic
1009896904 6:69763006-69763028 CTAACACATATCTAAAAATATGG + Intronic
1010471989 6:76239623-76239645 CTGACAAATGTCTACAAAAATGG + Intergenic
1011957731 6:93044171-93044193 TTCAAACATGTTTACAGATAAGG + Intergenic
1011957840 6:93045359-93045381 TTCAAACATGTTTACAGATAAGG + Intergenic
1013327826 6:109065199-109065221 CTCAGACATGCCTAAAGTTAAGG - Intronic
1014008012 6:116443269-116443291 CTCAGACATATATACCATTAGGG - Intergenic
1014290049 6:119547806-119547828 CTGAGAGAAATCTACAAATAAGG - Intergenic
1017053258 6:150413951-150413973 TTCAGACATTTCTAGAAAAAGGG + Intergenic
1017457175 6:154612066-154612088 CCCAGAAATGTCTACAAATAAGG + Intergenic
1018063577 6:160109503-160109525 ACCAGACATTTCTACAAATGAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1024237946 7:47412280-47412302 CTCAGGAATGTGTACAAATTTGG + Intronic
1024331124 7:48156338-48156360 ATCAGACCTGTGTACAAATTTGG + Intergenic
1025799736 7:64774565-64774587 CACAGACATGGCTACAGACAAGG - Intergenic
1027515314 7:79135477-79135499 CACATACATGTCAAAAAATAGGG + Intronic
1031174784 7:118336811-118336833 CTCAGACAAGCCTAGATATATGG + Intergenic
1031954547 7:127929062-127929084 TTCAGAAATGTCTATAAATAGGG + Intronic
1032627863 7:133612148-133612170 CTCAGACATTTATATATATATGG + Intronic
1038635335 8:29282047-29282069 CTCCCACCTGTCTAAAAATAAGG - Intergenic
1044517228 8:93153690-93153712 CAAAGAAATGTCCACAAATAAGG - Intronic
1044747369 8:95383743-95383765 GACAGACATGTATACAAAAAAGG - Intergenic
1046338089 8:112816123-112816145 CTGAGACATGTCAACAGAAAGGG - Intronic
1046591901 8:116216960-116216982 CTCAGCCAAGTCTTGAAATATGG - Intergenic
1046833447 8:118773566-118773588 ATCAGACATATCTACTTATAGGG + Intergenic
1047035571 8:120935054-120935076 CTCAGTCATGTCTACTGACAAGG + Intergenic
1047045007 8:121042738-121042760 ATCATAAATGTCAACAAATATGG + Intergenic
1047627761 8:126674005-126674027 CACAGGCATGTCTATAAGTAAGG + Intergenic
1050124225 9:2339718-2339740 TTCAGTCATGTCTAGAAATTTGG - Intergenic
1051697533 9:19785500-19785522 CTCAGACATCTCTAAAGAGATGG + Intronic
1058790253 9:108437658-108437680 GTCAGATATTCCTACAAATAGGG + Intergenic
1203570845 Un_KI270744v1:129079-129101 CACAGACATGGCTACAGACAAGG + Intergenic
1186356081 X:8792007-8792029 CTCAGACATGTAGCCAAAAATGG + Intronic
1188164968 X:26850987-26851009 CCCAGACAGGTCTACAAAGGTGG - Intergenic
1192600232 X:72454975-72454997 AACAGACAAATCTACAAATATGG + Intronic
1192775698 X:74242194-74242216 CAAAAACATGTCTATAAATAAGG + Intergenic
1195493733 X:105505108-105505130 CTCCCTCATGTCCACAAATATGG + Intronic
1196476705 X:116095142-116095164 CTCAAACAACTCTACAGATAAGG - Intergenic
1201618877 Y:15932837-15932859 CTCAGGCATCTCTAAGAATACGG + Intergenic
1202247395 Y:22833892-22833914 CTCAGACATGCCTGCACTTAGGG - Intergenic
1202400383 Y:24467640-24467662 CTCAGACATGCCTGCACTTAGGG - Intergenic
1202470397 Y:25202446-25202468 CTCAGACATGCCTGCACTTAGGG + Intergenic