ID: 1112071825

View in Genome Browser
Species Human (GRCh38)
Location 13:95861306-95861328
Sequence GCTGCTGATGGGGCTCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112071825 Original CRISPR GCTGCTGATGGGGCTCATCC AGG Intronic
900672726 1:3865852-3865874 GCCACAGGTGGGGCTCATCCAGG + Exonic
900704214 1:4068919-4068941 GGTTGTGATGGGGCTCAGCCTGG + Intergenic
901945823 1:12702672-12702694 GCTGCCAATGGGGTCCATCCAGG - Intergenic
907824136 1:57999317-57999339 GCTGCTGATGCTGCTGGTCCAGG - Intronic
908512919 1:64863393-64863415 GCTGTTGATGGAGCACATCCTGG - Intronic
910232578 1:85001414-85001436 TCTGCTGAGGGTGCTCTTCCTGG - Intronic
912810412 1:112789955-112789977 GCTCCTAATGGGGCACATCTAGG - Intergenic
915353285 1:155239904-155239926 GCTGAGTATGGGGCCCATCCAGG - Exonic
915462722 1:156079868-156079890 GCTGGTGGTGGGTCTCTTCCTGG + Intronic
917924801 1:179780541-179780563 GATGCTGATGTTGCTCATCTGGG - Intronic
918334058 1:183489925-183489947 GATGCTGATGATGCTCATCTGGG - Intronic
918598700 1:186325832-186325854 GGTGGTGATGGGACTGATCCAGG - Exonic
919821999 1:201479309-201479331 GGTGCTGATGTTGCTGATCCTGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
920403189 1:205690051-205690073 TCTGATGATGGGGGTCCTCCTGG + Intergenic
922513346 1:226187244-226187266 GTTGCAGACGGGGCTGATCCTGG + Intergenic
922565652 1:226600025-226600047 GATGCTGATGTGCCCCATCCTGG - Intronic
924612452 1:245585093-245585115 CCAGCTGATGGGGATCATGCTGG - Intronic
924825247 1:247531863-247531885 CCTGCCTCTGGGGCTCATCCTGG - Exonic
1062959429 10:1561650-1561672 GCAGCTGCTGGGCCTGATCCTGG + Intronic
1063123881 10:3123717-3123739 GGTGCTGAGGGGCCACATCCTGG + Intronic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1067461207 10:46460026-46460048 GCTTATGATGAGGCTCTTCCAGG + Intergenic
1067625988 10:47924575-47924597 GCTTATGATGAGGCTCTTCCAGG - Intergenic
1067721876 10:48733591-48733613 AATGCTGATGGGGCTGGTCCAGG - Intronic
1069784984 10:70982036-70982058 GGTGCTGTTGGGCCTCACCCAGG + Intergenic
1075407507 10:122204388-122204410 GCTGATGCTGGGGCTCTGCCTGG + Intronic
1076244020 10:128932317-128932339 GCAGCTCAGGGGCCTCATCCTGG + Intergenic
1078454655 11:11465611-11465633 TCTGCTGCTGGGGCTGATCAGGG + Intronic
1078578016 11:12517633-12517655 GCTGCTCATGGGGCTCCTGGAGG + Exonic
1081617053 11:44597324-44597346 GCTCCTGATGGGTCCCATCTGGG + Intronic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083381229 11:62270222-62270244 GTTGCTGATGGTCCTCATGCTGG + Exonic
1083463972 11:62833113-62833135 GAGGCTCTTGGGGCTCATCCTGG + Exonic
1083669765 11:64293096-64293118 GCTGCTCGTGGGGCTGCTCCAGG - Exonic
1084362410 11:68677550-68677572 GCTGCTGATGGGCCTGACTCAGG + Intergenic
1084514499 11:69629145-69629167 GCTACTGCTGTGGCTCAGCCTGG + Intergenic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1087396903 11:97610948-97610970 GTTTCAGCTGGGGCTCATCCGGG - Intergenic
1088314290 11:108491472-108491494 GCTACTCATGGGGCTGATGCAGG - Intronic
1089219927 11:116862255-116862277 GCTGCTGCTGGGTCTTCTCCAGG + Exonic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1092536633 12:9395122-9395144 GCTGCTCAGGTGGCTCAGCCTGG - Intergenic
1092558042 12:9578202-9578224 GCTGCTCAGGTGGCTCAGCCTGG + Intergenic
1094082775 12:26555670-26555692 GCGGCAGATGAGGATCATCCAGG + Intronic
1094513256 12:31109715-31109737 GCTGCTCAGGTGGCTCAGCCTGG - Intergenic
1096139110 12:49227454-49227476 GCTACTCAGGGGGCTCATGCAGG + Intronic
1099165099 12:79296068-79296090 GCTGCTGGTAGGGATCATTCAGG + Exonic
1099812017 12:87595216-87595238 GCTGCTGATCAGGCTGATACAGG - Intergenic
1101790278 12:107919625-107919647 CCTGCTGATGGGGCTCCTGGTGG + Intergenic
1104053786 12:125214231-125214253 GCTTCTGATGTGGCTGACCCAGG + Intronic
1105286947 13:19012230-19012252 GGTTCTGATGGACCTCATCCGGG - Intergenic
1107893361 13:44933580-44933602 GATGCTGATGTGGCTGGTCCTGG - Intergenic
1111888674 13:94054485-94054507 GCTGCTGATGCTGCTGATACTGG + Intronic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1112337038 13:98524368-98524390 GCTGCTGATGGAGGCCTTCCAGG - Intronic
1112353474 13:98655525-98655547 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1115351936 14:32405121-32405143 GCTTCTGATTGGGTTCATACAGG - Intronic
1115681811 14:35747708-35747730 GCAGCTGAGGGGGATCATTCAGG - Intronic
1119674557 14:76544195-76544217 GCTGGAGATGGGGCACATGCAGG - Intergenic
1119956511 14:78803953-78803975 GCTGCTGTTGGGTTTTATCCTGG - Intronic
1120726010 14:87942249-87942271 GATGCTGATGCTGCTCGTCCAGG + Intronic
1121437768 14:93930243-93930265 CCTGCTGATGGGTCTCTCCCCGG + Intergenic
1121713095 14:96053608-96053630 GCTGCTGTTGGGGCTCAGCCTGG - Intronic
1122021445 14:98841014-98841036 GCTGCTTATGTAGCTCATCCAGG + Intergenic
1122738700 14:103858489-103858511 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1122969546 14:105146957-105146979 GCAGCAGCTGGGGCTAATCCAGG - Intronic
1123120626 14:105914763-105914785 GAGGCTGCAGGGGCTCATCCAGG - Intergenic
1125289849 15:38133957-38133979 GATGCTGATGCTGCTGATCCAGG + Intergenic
1129393801 15:75233666-75233688 AGTGCTGATGGGGCTGGTCCAGG + Intergenic
1131091343 15:89627016-89627038 TCTGCTGATGGGGCGCCTCCTGG - Exonic
1132604258 16:787161-787183 GCAGCTGCGGGGGCACATCCAGG - Exonic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132807149 16:1780052-1780074 GCTGCTGTTCCGGCTCAGCCAGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133089245 16:3390593-3390615 GCTGCTGATGCGGCTGGCCCAGG - Intronic
1134310770 16:13073461-13073483 GCTGCTGATGATGCTAGTCCAGG - Intronic
1135335136 16:21595370-21595392 GCTGCTCATGAGGCTGATGCAGG - Intergenic
1137578164 16:49617559-49617581 GATGCTGATGGAGCTGGTCCTGG - Intronic
1140261560 16:73384872-73384894 GATGCTGATTGGGCTGAGCCTGG - Intergenic
1141014642 16:80437648-80437670 GCTGGGGATGGGGCTCAGCCAGG - Intergenic
1141321158 16:83010216-83010238 GCTGCTCATGCTGCTGATCCTGG + Intronic
1141568909 16:84922438-84922460 GATGCTGATTGGGCTGACCCAGG + Intergenic
1141629276 16:85277857-85277879 GCTGCTGCTGGGCCTCTGCCTGG + Intergenic
1141854127 16:86669591-86669613 TCGGCTCATGGGGCCCATCCTGG + Intergenic
1141890427 16:86923079-86923101 TCTGGTGATGGTGCTCTTCCCGG - Intergenic
1142052027 16:87965201-87965223 GGGCCTGATGGGGCTCATTCCGG - Intronic
1142997370 17:3768914-3768936 ACAGCTGAGGGGGCTCATCTGGG + Intronic
1144713338 17:17417556-17417578 GCTGTGGTTGGGGCTCATTCAGG + Intergenic
1146072151 17:29692793-29692815 ACTGCTGATGCTGCTGATCCAGG - Intronic
1147337863 17:39738112-39738134 ACTCCTGCTGGGGCTCCTCCAGG + Intronic
1147935098 17:44006603-44006625 GCAGCAGATGCGGCTCATCGTGG + Exonic
1150057367 17:62030499-62030521 GCCGCTGCAGGGGCTCATCCTGG - Intronic
1150568575 17:66364721-66364743 GCTGCTGACGGGGCTCCCTCAGG + Intronic
1150771659 17:68047136-68047158 GCTGCACATGGGCCTCATCTGGG + Intergenic
1151092788 17:71461884-71461906 CCTGCTGATTGTGCTAATCCCGG + Intergenic
1151349057 17:73520752-73520774 GCTGCTGCTGGAGCCCCTCCAGG - Intronic
1152087783 17:78231224-78231246 GTTGCTCATGGGGCTAGTCCTGG + Intergenic
1152090024 17:78241237-78241259 TCTGCTGATGAGGCTTCTCCTGG + Intergenic
1152427479 17:80226027-80226049 GCTGCTGATGGGGCTGCTCTGGG - Intronic
1155988398 18:32254582-32254604 GCTGCTCAAGTGGGTCATCCAGG - Intronic
1157304741 18:46508760-46508782 GCTGCAGATGAGGCTCCTCCTGG + Intronic
1158613093 18:58961230-58961252 GATGCTGATGCTGCTCATCTTGG + Intronic
1160106854 18:75986572-75986594 GCTGCAGATGGGCCTCAGCATGG - Intergenic
1160767700 19:815689-815711 GCTGCTGATGCTGCTCAGCTTGG - Exonic
1160917789 19:1506001-1506023 GCTCCTGCAGGGGCTCAGCCAGG + Exonic
1161465586 19:4428568-4428590 GGTGCTGGTGGGATTCATCCAGG - Intronic
1161996919 19:7718803-7718825 AATGCTGACGGGGCTCAGCCTGG + Intergenic
1163007436 19:14405825-14405847 CCTGCTGGTGCGGCCCATCCAGG + Exonic
1163080876 19:14941245-14941267 GATGCTGATGGGGCTGTTCCAGG + Intergenic
1164389360 19:27804982-27805004 GCTGCCTCTGGGCCTCATCCTGG - Intergenic
1165227726 19:34366160-34366182 GCTGCTGTTGCAGATCATCCTGG + Intronic
1165469780 19:35996514-35996536 TCTGTGGAGGGGGCTCATCCTGG + Intergenic
1165829386 19:38722965-38722987 GCTGCCCATCCGGCTCATCCTGG - Intronic
1165979603 19:39708907-39708929 CCTGGTGATGGGGATCTTCCAGG + Intronic
1166381954 19:42359282-42359304 GATGGGGATGGGGCTCCTCCTGG - Intronic
1166915988 19:46196418-46196440 GCTGTGGATGGGGCTGACCCAGG - Intergenic
1166918703 19:46213645-46213667 GCTGTGGATGGGGCTGACCCGGG - Intergenic
1166921138 19:46229956-46229978 GCTGTGGATGGGGCTGATCTGGG - Intronic
1167155376 19:47735361-47735383 CCTCCTGCTGGGGCTCACCCTGG - Intronic
1167443685 19:49525064-49525086 GCTGCTGCTGCGGGTCTTCCTGG + Intronic
926101834 2:10122858-10122880 GCCGCTGAAGGGGCTCAGCTTGG + Exonic
926253580 2:11170346-11170368 GCTGCTGAAGAGGCTGATGCTGG + Intronic
927228807 2:20799113-20799135 GCTACTGATGAGGCTGATACAGG + Intronic
928100528 2:28434795-28434817 GCTGCCGATGGGGCCCAGGCAGG + Intergenic
928328326 2:30337521-30337543 GCTGCTGAGGGACCTCCTCCCGG + Intergenic
928778919 2:34796874-34796896 GCTGCAGACTGTGCTCATCCAGG + Intergenic
932744746 2:74324522-74324544 GCTGCTGATGATGCTGATCCAGG + Intronic
933738802 2:85516819-85516841 GCTGCTGATGGAGGTGATCCAGG - Intergenic
935717699 2:105953321-105953343 TCTGCTGAGGGTGCTCTTCCTGG - Intergenic
938092238 2:128441393-128441415 GCTGCTGTTGGGGCTGCCCCTGG + Intergenic
940221377 2:151355430-151355452 GCTCCTCATGAGGCTTATCCTGG + Intergenic
942139782 2:172966466-172966488 GCTGCTGCTGCTGCTCCTCCAGG + Intronic
943165842 2:184324717-184324739 GATGCTGATAATGCTCATCCTGG - Intergenic
944772062 2:202924736-202924758 GCTGCTGCTGTTGCCCATCCAGG - Intronic
946689490 2:222299643-222299665 CCTCCCGATGGGGCTCCTCCTGG + Intronic
947809809 2:232997251-232997273 GCTGCTGCTGGGGCTGAGACTGG + Intronic
948160497 2:235819442-235819464 GATGCTGATGCTGCTAATCCAGG + Intronic
948372563 2:237498906-237498928 GCTGCTGATCGGGCAGCTCCTGG - Intronic
948781427 2:240324137-240324159 GCTGCTGATGGCTCACAGCCAGG - Intergenic
1169927120 20:10794949-10794971 GGTGGTGATGGGGCTGAACCTGG - Intergenic
1171194467 20:23186620-23186642 GCTGCTGAGCAGGCCCATCCAGG - Intergenic
1173598067 20:44272595-44272617 AGTGCAGAAGGGGCTCATCCAGG + Intronic
1173617284 20:44411415-44411437 GCTGCGGATAGGGCTCCTCAAGG - Intronic
1173837369 20:46134775-46134797 GCTCCTGAGGGGGCTCCTCCTGG + Intergenic
1174734996 20:52957376-52957398 GCTGCTGCTGCTGCTGATCCAGG - Intergenic
1175119949 20:56709726-56709748 GCTGGAGATGGGGGTGATCCTGG - Intergenic
1175835905 20:61994301-61994323 GTTCCTGCTGGGGCCCATCCCGG + Intronic
1175894739 20:62331055-62331077 GCTGCTGATGCAGCTGACCCGGG + Exonic
1177217627 21:18150510-18150532 TCTGCTGATGGGCCTTTTCCGGG + Intronic
1177876101 21:26633323-26633345 GGTGGTGATGGGAATCATCCTGG + Intergenic
1178341743 21:31791409-31791431 GCAGTTGATGGGGCTCATTAGGG - Intergenic
1179251670 21:39675781-39675803 GCTGCTGAGTGGGCCCAGCCAGG + Intergenic
1179900628 21:44391632-44391654 GCTGGTAACGGGGCCCATCCTGG + Intronic
1179920816 21:44506420-44506442 GCAGCAGAGGGGCCTCATCCCGG + Intronic
1179974398 21:44855890-44855912 GCTGCTAAGGCGGCTCGTCCAGG - Intronic
1179976920 21:44873532-44873554 GCTGCTCCTGCTGCTCATCCCGG - Exonic
1181772843 22:25139241-25139263 CCCCCTGATGGGGCTCACCCTGG + Intronic
1184635190 22:45822640-45822662 GCTACTCATGGGGCTCAGGCAGG - Intronic
1184692940 22:46125542-46125564 GCTGCTCCTGGGGCTCACCGTGG + Intergenic
1185041779 22:48507891-48507913 GCTGCAGATGGGCCTCGTGCTGG - Intronic
1185100641 22:48839204-48839226 GATGCTGCTGGGGGTCATGCAGG - Intronic
1185338418 22:50281049-50281071 GCTGGTGCTGGGGCGCCTCCTGG - Intronic
950515065 3:13459823-13459845 GCTGCTCATGGAACTCAGCCAGG - Intergenic
950604247 3:14064370-14064392 GCTGCTGCTGGGGCTGCTGCTGG - Exonic
951594676 3:24305177-24305199 GATGCTGATGTTGCTGATCCAGG - Intronic
951641675 3:24843657-24843679 GATGCTGATGCTGCTCATCGGGG - Intergenic
951849804 3:27126557-27126579 GCTGCTGCTGCTGCTGATCCAGG - Intronic
952740410 3:36728912-36728934 GATGCTGATGGTGCTGGTCCAGG - Intronic
953757030 3:45655569-45655591 GATGCTGATGGTGCTAGTCCAGG - Intronic
953985538 3:47439637-47439659 GCTGCTGCTGGGACATATCCTGG + Intronic
954147538 3:48641755-48641777 CCTGCGGTTGGGGTTCATCCTGG - Intronic
954642944 3:52112908-52112930 GATGCTGATGCTGCTGATCCAGG - Intronic
954789972 3:53124858-53124880 GCTGCTCAGGAGGCTCATACGGG + Intronic
955074483 3:55600885-55600907 GCTGCTGATGTCGCTCCTACTGG + Intronic
955399026 3:58578006-58578028 GCTGCTGAAGGGGCTGGTGCTGG - Intronic
955704055 3:61709956-61709978 GCTGCTGATGCTGCTGTTCCTGG + Intronic
961345192 3:126259651-126259673 GCTGCTGATGGCCCCAATCCCGG + Intergenic
961925672 3:130477603-130477625 GATGCTGATGTGGCTGGTCCAGG - Intronic
962425028 3:135262136-135262158 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
962676725 3:137763424-137763446 GCTGGGTATGGGGCTCTTCCCGG - Intergenic
963315612 3:143755202-143755224 GGGGCTGCTGGGGATCATCCTGG - Intronic
966824643 3:183953455-183953477 GCTGCTCCTGGGCTTCATCCTGG - Intronic
967266376 3:187695751-187695773 GCTGCAGATGGTGCTCAGCAGGG - Intergenic
967738550 3:192980313-192980335 GATGCTGATGCTGCTGATCCAGG + Intergenic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
969208773 4:5670286-5670308 GCTGCTGATGGTGATCATGATGG - Intronic
971253075 4:24989373-24989395 GCTGCTTAGTGGGCTTATCCTGG - Intergenic
971748857 4:30620030-30620052 GACGCTGATGTGGCTGATCCTGG + Intergenic
977571847 4:98637048-98637070 GCTGGTGATGGGGCTTCTCATGG - Intronic
981277679 4:142920923-142920945 GATGCTGATGTTGCTCATTCTGG - Intergenic
986361898 5:6986562-6986584 TCTGCTGAGGGCGCTCCTCCTGG - Intergenic
987523613 5:19019782-19019804 CCTGCTGATGGAGATCAGCCAGG + Intergenic
991631985 5:68665516-68665538 GCTGCTGAGGAGTTTCATCCAGG - Intergenic
993768530 5:91893957-91893979 TCTACTGATGGGCCTCATCTAGG - Intergenic
997528570 5:134568729-134568751 GCCGCTGATGGGGGTCAGCTTGG - Intronic
998621181 5:143795935-143795957 GCTTCAGATGGGGTTCTTCCTGG - Intergenic
999486457 5:152001906-152001928 GCTGCTGTTGGCCCTCATACAGG - Intergenic
999893188 5:156000898-156000920 GTTGCTGATGCTGCTGATCCAGG + Intronic
1000759548 5:165205364-165205386 CCTGCTGATGCCTCTCATCCTGG - Intergenic
1001706498 5:173744683-173744705 GCTTCTGATGGGGCCTATGCCGG + Intergenic
1002303554 5:178270748-178270770 TCTTCTGATGGGGCTAAGCCTGG + Intronic
1002580710 5:180208295-180208317 GGTGCTGGTGGAGCTCTTCCGGG - Intronic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1003891096 6:10564431-10564453 CCTGCTGATCTGGCTCTTCCTGG + Intronic
1004518900 6:16344036-16344058 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1004542392 6:16563355-16563377 GCAGGTGATGGGGATCATGCAGG + Intronic
1005809904 6:29507467-29507489 GCTGCTGATCAGGCTGTTCCAGG - Intergenic
1006055036 6:31377851-31377873 GCAGCTGCTGGGGCTCCACCAGG - Intergenic
1006267898 6:32940768-32940790 GCTGCTGCTGGGGCTCAGCCTGG - Exonic
1006371019 6:33643574-33643596 GCTGCTGACTGGGCTGAGCCTGG + Intronic
1007368676 6:41412244-41412266 GCTGCTAATGGTGCTCCTCTTGG + Intergenic
1012568095 6:100685441-100685463 GCTGCTGATGCTGCTGATCAGGG - Intronic
1015086524 6:129300312-129300334 ACTGCAGATCGGGCTCATCAAGG + Intronic
1015892206 6:137980197-137980219 TATGCTGATGGGACTGATCCAGG - Intergenic
1016873345 6:148840247-148840269 GCTGCTTCTGGTGCTCATGCTGG + Intronic
1017761358 6:157572345-157572367 GCTGATGATCGGGATCATCTAGG - Intronic
1019077141 6:169396757-169396779 GCTGCTCATGCGGCTAATCTGGG - Intergenic
1019304623 7:327391-327413 CCTGCTGAAAGGACTCATCCTGG - Intergenic
1019496092 7:1341310-1341332 ACTGCAGCTGGGGCTGATCCAGG - Intergenic
1024463013 7:49679453-49679475 GCTGCAGATGTGGCTCTTCATGG + Intergenic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1024638449 7:51309924-51309946 GCTGCAGCTGGGGCTCCCCCAGG - Intronic
1025992665 7:66507266-66507288 GCTCCTGAGGGGGCTGATACAGG - Intergenic
1029471649 7:100758481-100758503 GCTGCTTCTGTGGCTCCTCCAGG - Intronic
1033157634 7:138970669-138970691 GATGCTGATGCTGCTGATCCGGG + Intronic
1034858939 7:154579981-154580003 TCTGATTATGGGGCTCATTCCGG - Intronic
1035035843 7:155893229-155893251 GCAGCTGTGGGGGCTCATTCAGG - Intergenic
1035477847 7:159156277-159156299 GCGGCTGATGGTGCCCAGCCTGG + Intergenic
1036207972 8:6819205-6819227 GCTTCTTCTGGGGCCCATCCAGG + Intronic
1040384073 8:46901574-46901596 GCTGCAGAGAGGGGTCATCCAGG - Intergenic
1040448803 8:47523615-47523637 GCTGGTGATGGGGGTCAGGCTGG + Intronic
1042666599 8:71213671-71213693 GGTGCTGATGGGATTCATCCAGG - Intronic
1042841726 8:73130891-73130913 GATGCTCATGGGTCTCCTCCAGG - Intergenic
1042870014 8:73389937-73389959 GCTGCTGATGTGGCTGTTCCCGG + Intergenic
1044834319 8:96280987-96281009 GCTACAGATGGGGCTCATGCCGG + Intronic
1045106268 8:98895731-98895753 GCTGCTGATTGTGTTGATCCTGG + Intronic
1045183433 8:99811532-99811554 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1046726841 8:117684973-117684995 GCTGCAGATGAGGATCATCTAGG - Intergenic
1046792323 8:118335229-118335251 GCTCCCAATGTGGCTCATCCAGG + Intronic
1046962533 8:120125812-120125834 GCTGCTGATGGAGATCATAGGGG + Intronic
1048506215 8:135024572-135024594 ACGGCTGATGGGGCCCATCTAGG - Intergenic
1048987938 8:139745274-139745296 GCTTCCGAAGGGGCTCACCCAGG - Intronic
1049214934 8:141403143-141403165 GAGGCTGATGGGGCTCATCCTGG - Intronic
1049445845 8:142631118-142631140 ACTGTTGATGGGGCTCCTTCGGG - Intergenic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1050189861 9:3013540-3013562 GAGGCTAATGGGGCTCATCAGGG - Intergenic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1053386557 9:37695728-37695750 GCTGCTGATGGGGTGGATGCAGG - Intronic
1056332674 9:85534682-85534704 GCACCTGCTGGGCCTCATCCTGG - Intergenic
1057040547 9:91844643-91844665 GCTGGACATGGGGCCCATCCGGG - Intronic
1058138554 9:101334427-101334449 TCTGCTGATGGAGCCCATCTCGG + Intergenic
1058350417 9:104014886-104014908 GATGCTGATGCTGCTGATCCAGG + Intergenic
1058868542 9:109183209-109183231 GCTGCTGAGAGGTCACATCCTGG + Intronic
1060015222 9:120080947-120080969 CCTGCTGTGGGGGCTGATCCAGG - Intergenic
1060960357 9:127676451-127676473 GCTGCTGATGGTCCTCACTCAGG + Intronic
1061225082 9:129276731-129276753 CATGCTGATGGGGCTGACCCAGG - Intergenic
1062173288 9:135147338-135147360 GCCGCTGATGGGGCTGGCCCTGG + Intergenic
1062333558 9:136055146-136055168 GCTGGGTATGGGGCTCATCATGG - Intronic
1186402155 X:9269872-9269894 GATGCTGATGTTGCTCATCTGGG + Intergenic
1186710678 X:12192821-12192843 GATGCTGATGCTGCTGATCCAGG + Intronic
1186882446 X:13879885-13879907 GATGCTGATGTTGCTCGTCCAGG + Intronic
1187274512 X:17806059-17806081 GCTGCTGCAGGGGCTAATACTGG + Intronic
1187581030 X:20607542-20607564 GCTGCTGATGCTGTTGATCCAGG + Intergenic
1188490658 X:30735660-30735682 GCTACTGAGGAGGCTAATCCTGG - Intergenic
1188887564 X:35569117-35569139 GGTGCTGATGTGGCTCCTTCAGG + Intergenic
1189277741 X:39798992-39799014 GATGCTGATGCTGCTCTTCCAGG + Intergenic
1189759877 X:44310395-44310417 GCCGCTGAAGGGGCTCAGCCTGG - Intronic
1190296469 X:49030412-49030434 GCTGCTGATGGGGAGCATTCTGG + Exonic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1198993312 X:142542432-142542454 GTGTCTGATGGTGCTCATCCTGG + Intergenic
1199927571 X:152484112-152484134 GCTGCTAATGCTGCTGATCCAGG - Intergenic
1200034609 X:153319411-153319433 GAGGCTGCTGCGGCTCATCCGGG - Intergenic
1201329571 Y:12803318-12803340 CCTGCTGATGTGGCTCAACAGGG + Intronic
1201636433 Y:16127969-16127991 GCTACTGATGGAGATCAGCCAGG + Intergenic