ID: 1112073066

View in Genome Browser
Species Human (GRCh38)
Location 13:95876345-95876367
Sequence GGCTGGCCTGGCATTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 2, 2: 4, 3: 47, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112073063_1112073066 -9 Left 1112073063 13:95876331-95876353 CCTGAATTTGTGGGGGCTGGCCT 0: 1
1: 1
2: 3
3: 28
4: 171
Right 1112073066 13:95876345-95876367 GGCTGGCCTGGCATTGAGGCTGG 0: 1
1: 2
2: 4
3: 47
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112073066 Original CRISPR GGCTGGCCTGGCATTGAGGC TGG Intronic
900165136 1:1241503-1241525 GGCTTGCTGGGCAGTGAGGCGGG - Intergenic
900321745 1:2087915-2087937 GGGAGGCCTGGCTTCGAGGCTGG + Intronic
900459767 1:2797292-2797314 TGCTGGCCTGGGATGGGGGCTGG + Intronic
900597775 1:3490340-3490362 GGCTGGTGTGGCCTTGAGGAGGG - Exonic
900631137 1:3636219-3636241 GGCTGGCCAGGCACTGACGCTGG - Intronic
901007033 1:6176976-6176998 GCCAGCTCTGGCATTGAGGCAGG - Intronic
901221892 1:7588070-7588092 GGCTGGCCTGGCAGTGGCCCAGG + Intronic
901420784 1:9149913-9149935 TGCTGGCCTGTCACTGCGGCTGG + Intergenic
902973637 1:20072993-20073015 GGTTGGATTGGGATTGAGGCAGG + Intronic
902987939 1:20166799-20166821 GGAAGGCCTGGCAATGGGGCAGG - Intronic
903777815 1:25804592-25804614 GGCTGGACTGGCAGTGTGGCTGG - Intronic
905208638 1:36358064-36358086 GGCTGGGCTGGAAGTCAGGCTGG - Intronic
905296999 1:36960656-36960678 GATTGGACTGGCCTTGAGGCTGG - Intronic
905788951 1:40779981-40780003 GCCTGGCCAGGCCCTGAGGCTGG - Intergenic
905974711 1:42165904-42165926 GGCTGTCCTGGCATCGGGCCAGG - Intergenic
906593273 1:47048217-47048239 GTCTGGCCTGTCAATCAGGCTGG - Intronic
906656376 1:47551479-47551501 TTCTGGCCTGGAATTGAGGGTGG + Intergenic
906948925 1:50318730-50318752 TGCTGGGCTGGCACTGAGGGAGG - Intergenic
907836567 1:58114466-58114488 GGATGTCCTGGCAATGAGACTGG - Intronic
909800120 1:79796614-79796636 GGCGGGCCTGCCACTGAGGTGGG + Intergenic
909800169 1:79796824-79796846 GGCTGGCCTGGTGTTGAGGTGGG + Intergenic
910101487 1:83582858-83582880 GGCTGCCCTGGCTTGAAGGCAGG + Intergenic
911574373 1:99557465-99557487 AGCTGGCATGGCATTGAGTTGGG + Intergenic
913366664 1:118047407-118047429 GGCTGGCCTGGCATTGGGGCAGG - Intronic
913366676 1:118047451-118047473 GGTGGGCCTGGCAGTGAGGTGGG - Intronic
913366716 1:118047637-118047659 TGCTGGCCTGACAATGAGGAGGG - Intronic
914333225 1:146691789-146691811 GGCTGGCCTGGCTTTCAGCTGGG + Intergenic
914392597 1:147235974-147235996 GGCTGGCATGGGATCCAGGCTGG - Intronic
914928574 1:151909600-151909622 GGCTGGCCGGGGTGTGAGGCCGG + Exonic
915585024 1:156839877-156839899 GGTTGCCATGGCAGTGAGGCAGG - Intronic
915669926 1:157479481-157479503 GGGTGGCCTGGCACTAAGGCAGG + Intergenic
917637533 1:176951349-176951371 GGCTGCCCAGGCATGGATGCAGG + Intronic
918092745 1:181311509-181311531 GGCTGCTCTGGCAGTGAGCCTGG + Intergenic
918130141 1:181620250-181620272 TGCTTTCCTGGCAGTGAGGCTGG - Intronic
919782028 1:201227217-201227239 GGCTGCCCTGGCAGTGGGGCAGG + Intronic
922221753 1:223613645-223613667 GGCTGGCCTGGCATCACTGCAGG + Intronic
1063114805 10:3066525-3066547 GACTGGCCTGGCGGGGAGGCGGG - Intronic
1064283994 10:13976305-13976327 GGCTGACCTGGGAGGGAGGCAGG + Intronic
1064318006 10:14276212-14276234 GGCAGGCATGACAGTGAGGCAGG - Intronic
1066165786 10:32787691-32787713 AGCTGGCCTGGCATTGGGGTGGG - Intronic
1066165903 10:32788253-32788275 GGCTGACCTGACAATGGGGCAGG - Intronic
1066165935 10:32788440-32788462 GACTGGCCTGGTACTGAGGCAGG - Intronic
1067018169 10:42772861-42772883 GGCAGGCCTGGGATCCAGGCTGG + Intergenic
1067040669 10:42951722-42951744 GCCTGGCCTGGCACTGTGCCCGG - Intergenic
1067793856 10:49306885-49306907 AGCTGGCCTGGCAGTGGGGGTGG + Intronic
1070670523 10:78374402-78374424 AGGAGGCCTGGGATTGAGGCTGG + Intergenic
1070767442 10:79065033-79065055 GGCTGGGCTGGGATGGGGGCGGG - Intergenic
1070841921 10:79493311-79493333 GGCTGGCCTGGAATTGAAGGAGG + Intergenic
1072020648 10:91396092-91396114 GGCTGAACTGGCACTGAGGCAGG - Intergenic
1072191163 10:93077183-93077205 AGCTGGCCAGGCATTGTGACTGG + Exonic
1072253779 10:93601394-93601416 GGCTGTCCTGGAGGTGAGGCCGG - Exonic
1072614916 10:97043010-97043032 AGCTGGCCTGGCTAGGAGGCTGG - Exonic
1072980424 10:100093573-100093595 GGCTGGCCGGGCAGGGGGGCGGG - Intergenic
1073805920 10:107097590-107097612 GTGTGGCCTGGCAGAGAGGCTGG - Intronic
1074460106 10:113628988-113629010 GGCTGACCTGGCATGGATGAAGG - Exonic
1076095658 10:127733521-127733543 GGCTTGCCTTGCTCTGAGGCTGG - Intergenic
1076491074 10:130862070-130862092 GCTTGGGCTGGCAATGAGGCAGG + Intergenic
1076706463 10:132304774-132304796 GGCCGGGCAGGCAGTGAGGCAGG - Intronic
1076768494 10:132650683-132650705 GGCTGGCCTGGCAGGGAAGGTGG + Intronic
1076903470 10:133351131-133351153 AGCTGGCCTGGAATTCTGGCCGG - Intronic
1077014514 11:393766-393788 GGCTGGGCTACCATGGAGGCTGG + Intronic
1077034670 11:488864-488886 GGCCGGCCAGGGATTGAGGAGGG - Intronic
1077298205 11:1835765-1835787 GGGTGGCCTGGCCTGGAGGCGGG + Intronic
1077508088 11:2941381-2941403 GGCTTGCCTGGCTCTGAGTCAGG - Intergenic
1079132171 11:17753448-17753470 GGCTGGGCTGTCAGTCAGGCTGG + Intronic
1079150296 11:17893065-17893087 AGCTGGCCTGGCACTCAGGTAGG - Intronic
1079257972 11:18848892-18848914 GGCATGTCTGACATTGAGGCAGG + Intergenic
1079825364 11:25184557-25184579 GGCTGGCCTGTATGTGAGGCTGG - Intergenic
1080508067 11:32937603-32937625 GGATGGACTGGCATAGAGACTGG - Intronic
1081687029 11:45049903-45049925 GGATGGCTTGGCATAGAAGCTGG + Intergenic
1082129477 11:48471019-48471041 GACTGGCCTGGTACTGAGGCAGG + Intergenic
1082247617 11:49942683-49942705 GACTGGCCTGGTACTGAAGCAGG - Intergenic
1082563007 11:54641912-54641934 GACTGGCCTGGTACTGAGGCAGG + Intergenic
1082785296 11:57313319-57313341 GGCTCCCCTGGCCTTGGGGCAGG + Exonic
1083194883 11:61079956-61079978 GCCTGGCCTGGCAGAGAGGGGGG - Intergenic
1083681621 11:64354236-64354258 TGCAGGCCAGGCAGTGAGGCAGG - Intronic
1083937857 11:65879823-65879845 GTCTGGAGTGGCATGGAGGCAGG - Exonic
1084360972 11:68668282-68668304 GCCTGGAGTGGCATTAAGGCCGG - Intergenic
1084421007 11:69060567-69060589 GGCTTGACTGGCATTGTGGTTGG + Intronic
1084662872 11:70557489-70557511 GGCAGTCCTGGCTCTGAGGCTGG + Intronic
1085506759 11:77065232-77065254 GGGTGGCCTGGGACAGAGGCAGG + Intergenic
1086305944 11:85482069-85482091 GGCTGGCCTGGCCTTGGGGTTGG - Intronic
1089099796 11:115952733-115952755 GGCTGGCCTGGCATAAAAGTAGG + Intergenic
1092261918 12:6957516-6957538 GGATGGGCTGGCAGAGAGGCAGG - Intronic
1093342763 12:17998565-17998587 AGCTGACCTGGCACTGAGGTGGG - Intergenic
1094372360 12:29751798-29751820 GGATGGCCTGGCAGTGAGGAGGG + Exonic
1094473755 12:30825614-30825636 GAATGGCCTGGGAATGAGGCAGG + Intergenic
1095448098 12:42302444-42302466 GGCTGGCCGGGCACAGTGGCAGG + Intronic
1096455464 12:51781241-51781263 GGCAGGCCTGGAATTGGGGATGG + Intronic
1096574264 12:52543029-52543051 GGGAGGCCTGGTATTGGGGCTGG - Intergenic
1096679021 12:53242493-53242515 TGCTGCCCTGGCAAGGAGGCAGG + Intergenic
1096865200 12:54558475-54558497 AGCTGGCTGGGCATTGTGGCGGG - Intronic
1097187218 12:57202325-57202347 GGCTGGCCTGGCAGGGAGGGTGG - Intronic
1097573250 12:61357681-61357703 GGCAGGCCTGGGATCCAGGCTGG + Intergenic
1098518187 12:71403013-71403035 GCCTGGCCTAGCATTGGGCCTGG - Intronic
1101923203 12:108949848-108949870 GGCTGGCCAGCCTTTGTGGCAGG + Intronic
1102028183 12:109725375-109725397 GGCTGGCCTGGCTCTGAGGCTGG - Intronic
1102108371 12:110345142-110345164 GGCTGGCTCTGCATTCAGGCTGG + Intronic
1102934312 12:116883645-116883667 GGCTTTCCTGGTATTTAGGCTGG - Intergenic
1103883982 12:124187503-124187525 CGCAGGCCTGGCGCTGAGGCTGG + Intronic
1103996750 12:124834982-124835004 GGCAGACCTGGCATGGAGCCTGG - Intronic
1104419920 12:128626920-128626942 GGCTGGGGTGGCAGTGGGGCTGG - Intronic
1105402045 13:20104765-20104787 GGGTGGCCAGGCAATGGGGCAGG + Intergenic
1108095681 13:46898155-46898177 GGCAGGCATGGCAGTGAGGGGGG - Intergenic
1108281211 13:48863991-48864013 GGCATGCCTGGCTGTGAGGCTGG - Intergenic
1108705542 13:52982258-52982280 AGCTGGCATGGCAAAGAGGCTGG - Intergenic
1108759477 13:53545606-53545628 GGCTGACCTGGCACTGAGACAGG + Intergenic
1109982404 13:69925031-69925053 GGCAGGCATGGGATTCAGGCTGG + Intronic
1110808937 13:79790985-79791007 GGCTGGCCTGGTGCTGGGGCAGG + Intergenic
1112073066 13:95876345-95876367 GGCTGGCCTGGCATTGAGGCTGG + Intronic
1112583482 13:100696375-100696397 GGCTCACCTGATATTGAGGCAGG + Intergenic
1113903329 13:113807999-113808021 TGCTGGCCTGGCACAAAGGCTGG - Intronic
1115531998 14:34336269-34336291 GGTTGGCCTAGAAGTGAGGCAGG - Intronic
1116432821 14:44866583-44866605 GACTGACCTGGCACTGCGGCAGG + Intergenic
1116436251 14:44897737-44897759 GGGAGGCCTGGCACCGAGGCGGG - Intronic
1116940401 14:50785245-50785267 TGCTGGCCCGGCGTTGGGGCTGG - Intronic
1119135431 14:72214020-72214042 GGCTGACCTGGCACTAATGCTGG + Intronic
1119332101 14:73802574-73802596 GGCTGGCCAGGCAAGGAGACAGG + Intergenic
1119530218 14:75354883-75354905 GGCTGGCATGACAGTGAGGATGG - Intergenic
1119766852 14:77195840-77195862 GGCTGGCCTGGATTTGGAGCTGG + Intronic
1121866529 14:97367418-97367440 GGCTGGCCTGCCTGTGAGCCTGG + Intergenic
1122068204 14:99188531-99188553 GGCTGGCCTGGGGCTGGGGCTGG + Intronic
1122143802 14:99677031-99677053 GGCTGGGCAGGCCTTGGGGCAGG + Exonic
1122330846 14:100911439-100911461 AGCTCGTCTGGCATTGAGGCTGG + Intergenic
1122371606 14:101232040-101232062 TGGTGGCCTGGCCTTGAAGCTGG + Intergenic
1122716908 14:103701361-103701383 GGCTGGCGTGACCTTGGGGCTGG + Intronic
1123004672 14:105315349-105315371 GGCCGGCACCGCATTGAGGCAGG - Exonic
1123417267 15:20102969-20102991 GGCTGGCTTGGCTGGGAGGCTGG + Intergenic
1123447967 15:20343563-20343585 GGCTGGCTTGGCTTGGTGGCTGG - Intergenic
1125749148 15:42016993-42017015 GGCTGGCCTGGTGAGGAGGCAGG + Intronic
1126530987 15:49710911-49710933 GGCTGGCCTGGCACTGTAGTGGG + Intergenic
1127998108 15:64166691-64166713 GGCTGGCCTGGGATTTGGTCTGG + Exonic
1129955889 15:79636540-79636562 GGCTGGGCTGCCCTTGGGGCTGG - Intergenic
1131321696 15:91399887-91399909 GGCCAGCCTGGCATTGGGGTTGG + Intergenic
1132852551 16:2031299-2031321 GGCTGGCCTTGCAGGGGGGCTGG + Intronic
1133221185 16:4319834-4319856 GGCTGGGCAGGCACGGAGGCCGG + Intronic
1135782208 16:25313921-25313943 GGCCAGCCTGGCACTGTGGCAGG + Intergenic
1136669038 16:31839517-31839539 GGCTGGCCTGGTGGTGGGGCTGG - Intergenic
1136787734 16:32945724-32945746 GGCTGGGCTGGCATGGGGGCTGG + Intergenic
1136882047 16:33908065-33908087 GGCTGGGCTGGCATGGGGGCTGG - Intergenic
1137337227 16:47562019-47562041 AGCTGGCCTAGCTTTAAGGCTGG + Intronic
1137678148 16:50314440-50314462 GGGTGGACTGGCCTAGAGGCAGG - Intronic
1137743324 16:50802222-50802244 GGCTGGAGTGGCTTGGAGGCTGG - Intergenic
1138144395 16:54595759-54595781 GGCTGGGCTGGCATTGGGAGAGG - Intergenic
1139112239 16:63905079-63905101 GGCTAACCTGGCACTGGGGCTGG + Intergenic
1139436689 16:66940658-66940680 AGCTGAGCTGGCAATGAGGCCGG - Exonic
1139593945 16:67947589-67947611 GGGTGGTCTGGCATTGGGGTGGG - Intronic
1140000395 16:71019463-71019485 GGCTGGCCTGGCTTTCAGCTGGG - Intronic
1140374389 16:74433247-74433269 GGCTGGGGTGGGAGTGAGGCAGG - Intergenic
1141502440 16:84453249-84453271 GGCTTGGCTGGCAGTGGGGCTGG + Intronic
1141670748 16:85490531-85490553 GGCTGGCCTGGGAGCCAGGCAGG - Intergenic
1141749410 16:85948207-85948229 CGCCGCCCTGGCCTTGAGGCCGG + Intergenic
1142060047 16:88023364-88023386 GGCCGGCTTGGCCTGGAGGCTGG + Intronic
1203089962 16_KI270728v1_random:1207381-1207403 GGCTGGGCTGGCATGGGGGCTGG + Intergenic
1142494902 17:300972-300994 GGCTGGCCTCACAGTGAGGCTGG + Intronic
1142759912 17:2036121-2036143 GGCGGGGCTGGCAGGGAGGCAGG + Intronic
1142766697 17:2068397-2068419 GGGTGGTCTGGCAGGGAGGCTGG - Intronic
1143326428 17:6101383-6101405 AGCTGGCCGGGCAGTGGGGCTGG + Intronic
1143406022 17:6677695-6677717 GGCTGGCCCTGCAGGGAGGCTGG - Intergenic
1144665340 17:17098551-17098573 GGCTGGCGTGGCATCGGTGCAGG + Intronic
1144686871 17:17231931-17231953 AGCTGGGCTGGCAGTGAGGCAGG + Intronic
1145018593 17:19413926-19413948 GGCTGGGCTGGCCTCAAGGCCGG - Intronic
1145115925 17:20210841-20210863 GCCAGGCCTGGCATGGAGGGAGG - Intronic
1145977347 17:28992002-28992024 TGCTGGCTGGGCAGTGAGGCAGG - Intronic
1147148089 17:38497842-38497864 GGCTGGGCTGGCATGGGGGCTGG + Intronic
1147313497 17:39607934-39607956 ATATGGCCTGGCATAGAGGCTGG - Exonic
1147442564 17:40456368-40456390 GGCTGGGCTGGGATTGGGGTGGG + Intronic
1147465674 17:40608845-40608867 GGCAGGCCTGGCATTGGAGCTGG + Intergenic
1147814672 17:43200436-43200458 GGCAAGCCTGGGGTTGAGGCTGG + Exonic
1148124176 17:45228460-45228482 AGCTGGGCTGGCTTTGAGCCTGG - Intronic
1148491931 17:48028814-48028836 GGCTGCCTTGGCCTTGAGGTTGG - Intronic
1150176875 17:63066416-63066438 GGCTCACCTGGCACTGGGGCAGG + Intronic
1150573491 17:66409196-66409218 GGCTGGGATGGGATGGAGGCAGG + Intronic
1150763877 17:67987921-67987943 AGTTAGCCGGGCATTGAGGCCGG + Intergenic
1151560731 17:74868156-74868178 GGCTGGCCTGGGATGGAGAGAGG - Intronic
1151819792 17:76491285-76491307 GGATGGCCTGGCCTTGGGACAGG - Intronic
1152067320 17:78118924-78118946 GGCTGGGCTGGCAGGGTGGCCGG - Intronic
1152237065 17:79144175-79144197 GCCTGGCCTGGCTCAGAGGCAGG - Intronic
1152487331 17:80602453-80602475 GGCTGGCCGGGCAGAGGGGCTGG + Intronic
1159815658 18:73071196-73071218 GGCTGGACTGGCAGTCCGGCTGG + Intergenic
1160355676 18:78226536-78226558 GACTGGCCTGGAATTGAGGATGG + Intergenic
1160448489 18:78945681-78945703 GGCTGGCCTAACATGGAGCCAGG + Intergenic
1160887679 19:1358922-1358944 GGGTGGCCTGGCACTGGGGTTGG + Intronic
1162444393 19:10713265-10713287 GGCTGACCTGGCATTGGGAGAGG + Exonic
1162490174 19:10986949-10986971 GGCTGGCCTGGCATCCCGGGGGG - Exonic
1162557644 19:11397393-11397415 GGCTGCCCTGCCCTTGGGGCCGG - Intronic
1162802256 19:13118157-13118179 GGCTGGCCTCGCCTGGAGGGCGG + Intronic
1163254050 19:16144155-16144177 TGCTGGCCTGGCACAGAGGAGGG - Intronic
1163866488 19:19777417-19777439 GGCTGGGATGGCACTCAGGCTGG - Intergenic
1164214640 19:23134343-23134365 GGCTGGCCGGGCAGAGGGGCAGG - Intronic
1164514649 19:28923343-28923365 GGGTGTCCTGGCACTGAGGGAGG + Intergenic
1165742918 19:38214166-38214188 GGTTGCCATGGCATTGTGGCTGG - Intronic
1165859137 19:38898172-38898194 GACAGGCCTGGACTTGAGGCTGG + Intronic
1166055099 19:40283857-40283879 AGTTGGCCTTGCAGTGAGGCCGG - Intronic
1166368703 19:42290135-42290157 GGCTGGCCTGGCTGACAGGCTGG + Intronic
1167413717 19:49360011-49360033 GGCTGGACGGGCAGTGAGGAAGG - Exonic
925348607 2:3186959-3186981 GGCTGGCATGGGAATGAGGCAGG - Intergenic
927149208 2:20186124-20186146 GGCTGGCCTGGAATGGTGGGTGG - Intergenic
927513669 2:23659776-23659798 GGCTGGCCAGGCCTGGAGGAGGG - Intronic
927946348 2:27137405-27137427 CCCTGGCCTGGCCCTGAGGCAGG + Exonic
930731251 2:54729985-54730007 GGCTGGCTGGGCATGGTGGCAGG + Intronic
930959128 2:57237445-57237467 GGCTTGCCTGGCATTAGGGATGG - Intergenic
931196142 2:60053892-60053914 GTCTGCCCAGGCTTTGAGGCAGG + Intergenic
931641397 2:64383687-64383709 TGCTGGCCTGGCAGCCAGGCGGG + Intergenic
932619052 2:73255226-73255248 GGCTGCCCTGACAATCAGGCAGG - Exonic
932995406 2:76845531-76845553 GGCAGGCCTGACCTGGAGGCTGG + Intronic
934243744 2:90291742-90291764 GGCTGGCTTGGCAGGGTGGCTGG - Intergenic
934264242 2:91501003-91501025 GGCTGGCTTGGCATGCTGGCTGG + Intergenic
937067160 2:119026165-119026187 CCCTGGCCTGGCAGTGCGGCAGG - Intergenic
938264426 2:129916366-129916388 GGCAGCCATGGCATGGAGGCTGG + Intergenic
939240983 2:139559488-139559510 GGAAGCCCTGGGATTGAGGCAGG - Intergenic
941151533 2:161920130-161920152 GGCAGGCCTGGGATCCAGGCTGG + Intronic
942382430 2:175405759-175405781 GGCAGGCCTGGAGTTGTGGCTGG + Intergenic
942595654 2:177589606-177589628 GGCTGACTTGTCATTGAGTCCGG + Intergenic
946165101 2:217858943-217858965 GGCTGGGCTGGGGTTGGGGCTGG - Intronic
947565352 2:231189876-231189898 GGGAGGCCTGGGATGGAGGCTGG + Intergenic
947740997 2:232484938-232484960 GGCTGCCCTGGGCTTGAGGGAGG - Intronic
948090018 2:235285696-235285718 GTCTTGCCAGGCAATGAGGCCGG + Intergenic
948481296 2:238252126-238252148 GGCTGCCTTGGGATTGAGGGCGG + Intronic
948544143 2:238714381-238714403 GTCTGGCCTGGCCATGAGCCAGG + Intergenic
948562598 2:238864538-238864560 GGCTGACCTGGCCTGGGGGCCGG - Intronic
948892332 2:240913586-240913608 GGCCGGCTAGGCACTGAGGCAGG - Intergenic
1168895131 20:1319099-1319121 GGCTGGCCTGGGGTGGGGGCAGG - Intronic
1170208732 20:13826927-13826949 GACTGGCCTGGGAGTGAAGCAGG + Intergenic
1170777489 20:19390522-19390544 GAATGGCCTGGCACTGGGGCAGG + Intronic
1171971841 20:31569659-31569681 GGCTGGCCAGGCACTGGGGTGGG - Exonic
1172875016 20:38158830-38158852 AGCTGGCCAGGCCTTGAGCCGGG + Intronic
1173139737 20:40471276-40471298 GGATTGCCTGTCATTCAGGCAGG - Intergenic
1174805149 20:53598804-53598826 GGCTTGCCAGGACTTGAGGCTGG - Intronic
1174806028 20:53605159-53605181 GGCCAGCATGGCATTGTGGCTGG + Intronic
1174855659 20:54042853-54042875 GGCTGGCCCAGCAGCGAGGCAGG + Intronic
1175001220 20:55632662-55632684 GGCAGGCATGGGATTGAGACCGG - Intergenic
1175809548 20:61850567-61850589 GCGTGGTCTGGCATTGGGGCGGG - Intronic
1176107019 20:63394207-63394229 GGCAGGGCAGGCAATGAGGCAGG + Intergenic
1176732781 21:10517559-10517581 GGCCAGCATGGCATTGTGGCTGG - Intergenic
1177064427 21:16411978-16412000 TTCTGGCCAGGCATTCAGGCAGG - Intergenic
1179390968 21:40990669-40990691 GGCAGGCTTGGCTTTGAGGCAGG + Intergenic
1179487983 21:41722892-41722914 GGCAGGCCTGGCCTGGAGGAAGG + Intergenic
1179822397 21:43944293-43944315 GGCTGGCCCTGCATTGCGGCTGG + Intronic
1179828475 21:43981610-43981632 GGTGGGCCTGGCATTGTGCCTGG - Intronic
1181513101 22:23397557-23397579 GGCTGGCCTGGCAATGACCTGGG + Intergenic
1181557796 22:23681767-23681789 GGCTGGCCCCGCATTGGGCCAGG + Intergenic
1181674309 22:24441825-24441847 GACTGGCCTGGCCCTGAGACTGG + Exonic
1181845398 22:25704188-25704210 GGCTGGGCTGTCACGGAGGCGGG + Exonic
1183408654 22:37642469-37642491 GGCTGGCCTGGTGCTCAGGCAGG + Intronic
1184080153 22:42213578-42213600 GGCAGGACTAGCATTGAGTCTGG + Exonic
1184117554 22:42431132-42431154 GGCTGGCCTGGGGCTGAGGCTGG + Intronic
1184257446 22:43295275-43295297 GGCAGGCCTGGCCTGGAAGCCGG - Intronic
1184349988 22:43937160-43937182 GGCTGCCTTGGCTGTGAGGCTGG + Exonic
1184517213 22:44970151-44970173 TACTGGCCTGGGATCGAGGCAGG - Intronic
1184731364 22:46372769-46372791 GGCTGGACAAGCATTGGGGCTGG + Intronic
1184863678 22:47191000-47191022 GGCTGGCCTGGCACCGAGGAGGG + Intergenic
1185002515 22:48254499-48254521 GGGTGTCCTGACATGGAGGCAGG - Intergenic
1185117963 22:48948900-48948922 GGCTGGAGTGGGAGTGAGGCTGG - Intergenic
1185118013 22:48949086-48949108 GGCTGGAGTGGGAGTGAGGCTGG - Intergenic
1185230044 22:49674711-49674733 AGCTGGCTTGGCATGGAGTCTGG - Intergenic
1185344146 22:50304142-50304164 GGCTGGCCTGGCTGTGGAGCTGG - Intronic
1185389770 22:50552912-50552934 GGCTGGCCGGGCAAGGTGGCTGG + Intronic
1185421210 22:50735365-50735387 GGCTGGCTGGACATTGAGGATGG + Intergenic
949505017 3:4719502-4719524 TGCTGGCCCGGGATTAAGGCAGG + Intronic
950460706 3:13120697-13120719 GGCTGGCCAGGTAGAGAGGCAGG + Intergenic
950557075 3:13702431-13702453 GGCTGGCCTACCATTGGGGTGGG + Intergenic
950975567 3:17239254-17239276 GGCTGGTCTTCCATTGTGGCAGG - Intronic
951266799 3:20577513-20577535 AGCTGGCCTGGCACTAAGGGTGG - Intergenic
953388191 3:42519036-42519058 GGCTGTCCTGACAGGGAGGCAGG - Intronic
953772124 3:45785795-45785817 GGCTGGGCTGGCCTTGGGGCTGG + Intronic
953880186 3:46687387-46687409 AGCTGGGCTGGCCTTGGGGCGGG - Intronic
953975922 3:47381500-47381522 GGCGGTCCTGGCATGGAGGAGGG - Intronic
954663232 3:52237218-52237240 GGCTGGGCAGGCATTGGGGCTGG - Intronic
955510839 3:59678818-59678840 GGGTGGCCAGCCATTGAGCCTGG + Intergenic
958864748 3:99486829-99486851 GGCTGGCCTGGCAGTGAGATTGG - Intergenic
959111039 3:102123399-102123421 GGCTGAACTGGCACTGGGGCAGG + Intronic
959625571 3:108446023-108446045 GTCTGGACTGGCACTGGGGCAGG - Intronic
960639128 3:119810133-119810155 GGCAGGCCTGGCACTGTCGCCGG - Exonic
961048627 3:123727248-123727270 GACAGGCCTGGCACTGAGGGAGG + Intronic
961720875 3:128895273-128895295 GGCTGGGCTGTGATTGACGCTGG + Intronic
961882676 3:130073566-130073588 GGTTGGTGTAGCATTGAGGCTGG - Intergenic
962834889 3:139181257-139181279 GGCTGGCCTGGCACTGTGGCAGG + Intronic
963941492 3:151100076-151100098 GGCTGAACTGGCCCTGAGGCAGG + Intronic
964764136 3:160162245-160162267 GGCTGGGAAGGCATAGAGGCTGG + Intergenic
965638727 3:170811172-170811194 AGCTTGCCTGCCATTGGGGCAGG - Intronic
967448068 3:189590407-189590429 GGATGGCCTGGCACTAGGGCGGG - Intergenic
969608949 4:8216539-8216561 TGCTGCCCTGGCCTTGTGGCTGG + Intronic
973346422 4:49060440-49060462 GGCTGGCCTGGTGTTTAGGTGGG + Intronic
973721898 4:53732124-53732146 GCCTGGCCTGTCATCCAGGCTGG - Intronic
974328356 4:60444404-60444426 GGTTGGCCTGGTACTGGGGCAGG + Intergenic
974754602 4:66187123-66187145 GGCTGCCCTGGCACTGGGGCAGG + Intergenic
974809552 4:66928345-66928367 AGCTGGCCTGGCATCTAGGGAGG + Intergenic
975421157 4:74166638-74166660 GGCTGGCCTGGCACTGGGATGGG - Intronic
975495656 4:75033616-75033638 GGCTGGCCTGGAATTTAGAGAGG - Intronic
975689078 4:76948266-76948288 GGCTGCCCTGGAACTGATGCTGG - Intergenic
975896148 4:79093310-79093332 GCCAGGGCTGGGATTGAGGCAGG - Intergenic
977670675 4:99691843-99691865 GGCTGGCCTGGTGCTGGGGCAGG + Intergenic
981577122 4:146217081-146217103 GGCTGTCCTGGTGCTGAGGCTGG - Intergenic
983382694 4:167017672-167017694 GGCTGGGCTGGCAGTGAGGATGG - Intronic
985391511 4:189495819-189495841 GGCTGGCCACGCATCTAGGCTGG - Intergenic
988540161 5:32101157-32101179 GGCTGGGCTGGGACTGAGTCTGG + Exonic
992183003 5:74216193-74216215 GTCTGGCCTGGAATTGGTGCTGG - Intergenic
992779498 5:80115027-80115049 GGAAGTCCTGGCATTGAGCCAGG - Intronic
997523256 5:134536774-134536796 GGCTGCCCTGCCAAGGAGGCCGG + Intronic
998003853 5:138644339-138644361 GGCTGGGCTGGAGCTGAGGCTGG - Intronic
998152834 5:139766793-139766815 GACTGGCCTGGGTTTGAGTCTGG + Intergenic
999388374 5:151171938-151171960 GGCTGGCCTGGGTTTGAGTCTGG + Intergenic
1001534229 5:172487564-172487586 GGCTTGTTTGGCCTTGAGGCTGG + Intergenic
1001995599 5:176155002-176155024 TGCCAGCCTGGCACTGAGGCAGG + Intergenic
1002323335 5:178388703-178388725 GGCTGGGCTGGGCTGGAGGCAGG - Intronic
1003306722 6:4935813-4935835 GGCAGGCCTGGAAATCAGGCAGG - Intronic
1004339836 6:14798533-14798555 GGCTGGACTCCCAGTGAGGCTGG - Intergenic
1006944622 6:37777300-37777322 GGCTGGGCTGGGCTTGAGGATGG - Intergenic
1008009164 6:46445017-46445039 GACTGGCCTGGCACTGTGGTAGG - Intronic
1015773521 6:136792197-136792219 GGCTGGCCAGGCGGTGCGGCTGG - Exonic
1016192538 6:141288643-141288665 GGCCAGCCTGGTACTGAGGCAGG + Intergenic
1016192640 6:141289121-141289143 GGCTAGCCTGGCACTGGGGTGGG + Intergenic
1017977677 6:159372497-159372519 AGCTGGCCTAGCATAGAGGAGGG - Intergenic
1018433821 6:163743967-163743989 GGCTGGCCTGGCTTTGGGTCAGG - Intergenic
1018950403 6:168375049-168375071 GGCTGGCCTGACAATGGGTCTGG - Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1021190461 7:17613701-17613723 GGCTGGCCTGGCACTGAAATGGG + Intergenic
1023737014 7:43244335-43244357 GGATGGCCTGGCTCTGAGTCAGG - Intronic
1024030508 7:45456223-45456245 GGCTGGCCAGGCACTGGGGATGG + Intergenic
1025258337 7:57400100-57400122 TGCTGGCCTGGCAGTGTGGGAGG + Intergenic
1026067999 7:67092575-67092597 GGCTGACCTGTCAATCAGGCTGG - Intronic
1026370042 7:69690454-69690476 GGCAGGCATGGGATTCAGGCCGG - Intronic
1026513782 7:71049497-71049519 GGCTGGCCTGGCATTGAACCAGG - Intergenic
1026708926 7:72719731-72719753 GGCTGACCTGTCAATCAGGCTGG + Intronic
1026812015 7:73475632-73475654 GGCTGGCCCGGCATGGTGGCTGG + Intronic
1026933590 7:74238829-74238851 GGCTGGGCTGGCAGTGGGGACGG - Intronic
1027911946 7:84261740-84261762 GGCAGGCATGGCATCCAGGCTGG + Intronic
1029245253 7:99194897-99194919 GCCTGGCCTGGCTTTGAGTTTGG + Intronic
1031239391 7:119219082-119219104 GGCAGGCCTGACATTGGGGTGGG + Intergenic
1032315018 7:130829464-130829486 GCCCAGCCTGGCATTGAGGTAGG + Intergenic
1032364334 7:131285207-131285229 GGCTGGCCTGGGAGGGAAGCTGG + Intronic
1032756739 7:134898071-134898093 GGCTAGCCAGGCATGGTGGCGGG - Intronic
1033285885 7:140040219-140040241 GGCTGGCGTGACATGGAGGAGGG - Intronic
1033728426 7:144147182-144147204 GGATAGCCTGGCATTGGGGTGGG - Intergenic
1034545368 7:151785597-151785619 GGCTAGCCTGGGATGAAGGCAGG - Intronic
1036071970 8:5450827-5450849 GGCAGGCCTGGCTTTGACGCAGG - Intergenic
1036733296 8:11284758-11284780 GGCGGGCCGGGCGGTGAGGCTGG - Exonic
1037099949 8:15032665-15032687 GGCTGACCTGGCAATGGGGTAGG - Intronic
1037915485 8:22770364-22770386 GGCTGGCCTGGCATTGAGGGAGG - Intronic
1038436580 8:27540759-27540781 GGCTGGCCTGGCACTAACGAGGG - Intronic
1039067003 8:33617615-33617637 GGCTGGCCTGGCACTGGGATAGG + Intergenic
1039267512 8:35841792-35841814 GGCTGGTCTGGCACTGAGGTGGG - Intergenic
1041622547 8:59989924-59989946 GGCTGACCTGGCACTGGGGTAGG + Intergenic
1044549390 8:93495410-93495432 GGCTGACCTGGCAATGAGGTAGG + Intergenic
1045599182 8:103693860-103693882 GGCTGACCTGGCATTGAAGTTGG + Intronic
1046880418 8:119300831-119300853 AGCTGGCCTGGTGCTGAGGCAGG - Intergenic
1047421490 8:124711497-124711519 GGCTGGGCTGGGCTGGAGGCTGG - Intronic
1048328501 8:133456397-133456419 GACTGGCCCTGCATTCAGGCAGG - Exonic
1049382652 8:142325155-142325177 AGCGGGCCTGGAAGTGAGGCCGG + Intronic
1049480845 8:142821761-142821783 GGCTGGGCTGGCATGTGGGCTGG + Intergenic
1052072569 9:24100333-24100355 GCCTGGTCTGGCACTGGGGCAGG - Intergenic
1053283394 9:36835860-36835882 GCCTGGCCTGGCCGTGGGGCAGG + Exonic
1054837914 9:69699372-69699394 GGCTGGCCTGGTGGTGGGGCAGG + Intergenic
1055360193 9:75481371-75481393 GGCTGTGCTGGCCTAGAGGCTGG + Intergenic
1056248881 9:84727938-84727960 GGCTGGCCTGGAATTGACGATGG + Exonic
1056378314 9:86035452-86035474 GGCTGCCCTGTCAGTGAGCCAGG - Exonic
1057967265 9:99516480-99516502 GGCAGGGCTGGCACTGAGGTTGG - Intergenic
1059430713 9:114248629-114248651 GGCAGGCCTGTTCTTGAGGCTGG - Intronic
1060799121 9:126532501-126532523 GGGTGGCCTGGAACAGAGGCAGG - Intergenic
1060925393 9:127452069-127452091 GGCTGACCTGGCTTTGCGGATGG - Exonic
1061044401 9:128157022-128157044 GCCTGACCTGGCATTGAGGATGG + Intergenic
1061199549 9:129129137-129129159 GACTGGGCTGGCAGTGAGGGTGG + Intronic
1062274351 9:135723777-135723799 GGGTGGCCTGGCACTGAAGGCGG - Intronic
1062530316 9:136996766-136996788 GGCTGCCCTGGACTTGAGTCTGG + Exonic
1187995679 X:24924116-24924138 GGCTGGCATGGCATTGTGTTTGG + Intronic
1189256638 X:39645123-39645145 GGCTGGCGTGGAAGTGGGGCAGG - Intergenic
1190486176 X:50927317-50927339 TGCTGGCTTGGCACTGAGGGTGG + Intergenic
1190717407 X:53115481-53115503 GGCTAGCCTGGCACTGGGGTGGG + Intergenic
1191197491 X:57740652-57740674 TGCTGACCTGGCATTGGGGTGGG + Intergenic
1192382964 X:70636530-70636552 GGTTGGCCTGGCACTGGGGTGGG - Intronic
1192451831 X:71249727-71249749 GGCTGACCTTGCATTGGGGTGGG - Intronic
1192771423 X:74195709-74195731 GCCTGGCCTGGCAGTGGGGCAGG + Intergenic
1192873981 X:75209711-75209733 GGGTGGCCTGGGATTAGGGCAGG + Intergenic
1194085693 X:89524997-89525019 GGCTGGCATGGCATACTGGCAGG + Intergenic
1194916627 X:99716894-99716916 GGTTGGCCTGGTAGTGGGGCAGG - Intergenic
1195672197 X:107479194-107479216 GGCTGGGCTGGAATTAAGGAAGG + Intergenic
1196126669 X:112108853-112108875 GTCTGGCCTGGCCCTGAGACAGG + Intergenic
1196349143 X:114704698-114704720 TGCTGGCCAGGCAATCAGGCAGG + Intronic
1197070111 X:122286407-122286429 GGTTGGCCAGGCATTGAGTCTGG - Intergenic
1197082982 X:122440986-122441008 GGCTGGCCTGGTGCTGAGGCAGG + Intergenic
1197846615 X:130810596-130810618 TGCTGACCTGACATTGGGGCAGG - Intronic
1198182616 X:134224115-134224137 GGCTGGCCTGGCACTGGGGCAGG + Intergenic
1198304145 X:135364255-135364277 AGCTGCCTGGGCATTGAGGCAGG + Intergenic
1199010615 X:142754142-142754164 GGCTGGCCTAGCAATGGAGCAGG + Intergenic
1199724679 X:150568679-150568701 GGCTGGCCTGGCTCGGAGCCGGG + Intronic
1200076690 X:153554725-153554747 GGCTGGGGTGGTATTGATGCTGG + Intronic
1200438339 Y:3180880-3180902 GGCTGGCATGGCATACTGGCAGG + Intergenic
1201260955 Y:12158636-12158658 GGCTGGCCAGCCAGCGAGGCTGG - Intergenic