ID: 1112078466

View in Genome Browser
Species Human (GRCh38)
Location 13:95938788-95938810
Sequence CCAATCCAGCAGCACCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112078458_1112078466 11 Left 1112078458 13:95938754-95938776 CCCTTGACAATTTCTCATCTCCC 0: 1
1: 0
2: 6
3: 29
4: 277
Right 1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG 0: 1
1: 0
2: 3
3: 20
4: 199
1112078457_1112078466 22 Left 1112078457 13:95938743-95938765 CCTGGGAGTTACCCTTGACAATT 0: 1
1: 0
2: 4
3: 18
4: 114
Right 1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG 0: 1
1: 0
2: 3
3: 20
4: 199
1112078460_1112078466 -9 Left 1112078460 13:95938774-95938796 CCCCTCTACCTTATCCAATCCAG 0: 1
1: 0
2: 0
3: 12
4: 158
Right 1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG 0: 1
1: 0
2: 3
3: 20
4: 199
1112078456_1112078466 23 Left 1112078456 13:95938742-95938764 CCCTGGGAGTTACCCTTGACAAT 0: 1
1: 0
2: 1
3: 7
4: 108
Right 1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG 0: 1
1: 0
2: 3
3: 20
4: 199
1112078461_1112078466 -10 Left 1112078461 13:95938775-95938797 CCCTCTACCTTATCCAATCCAGC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG 0: 1
1: 0
2: 3
3: 20
4: 199
1112078459_1112078466 10 Left 1112078459 13:95938755-95938777 CCTTGACAATTTCTCATCTCCCC 0: 1
1: 0
2: 2
3: 21
4: 320
Right 1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG 0: 1
1: 0
2: 3
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112078466 Original CRISPR CCAATCCAGCAGCACCTGGA TGG Intronic
900104240 1:975511-975533 CCAGTGCAGCAGCCCCTGCAGGG - Exonic
900207607 1:1438286-1438308 CCAGTGCAGCTGCGCCTGGAGGG + Intronic
900653882 1:3745486-3745508 CCAATTCAGCAGCACAAGCATGG + Intergenic
903195097 1:21680186-21680208 CCACTCCAGAAGCCCCTGGCAGG - Intronic
905314688 1:37074619-37074641 CCAAATCAGAATCACCTGGAGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905951966 1:41959504-41959526 TCAGGCCAGCAGCATCTGGATGG - Intronic
906197395 1:43937379-43937401 CCCACCCAGCAGCTCCGGGATGG + Intergenic
909520567 1:76563511-76563533 TCAAATCAGCAGCACCTTGATGG + Intronic
910599134 1:89011834-89011856 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910603503 1:89056941-89056963 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910608517 1:89114103-89114125 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910621908 1:89264773-89264795 CAGGTCCAGCAGCTCCTGGAGGG + Exonic
910637215 1:89422175-89422197 CAGGTCCAGCAGCTCCTGGAGGG - Intergenic
911184180 1:94886786-94886808 CTAATCCACCTGTACCTGGAGGG + Intronic
912527859 1:110298041-110298063 CCAGTCCAGCAGAGCTTGGAAGG - Intergenic
914234445 1:145795412-145795434 CCAATCAAGCAGGACGTGGGCGG - Intronic
1065447094 10:25814141-25814163 CCAATCTATTAGCCCCTGGAGGG - Intergenic
1071152551 10:82652183-82652205 GCCCTGCAGCAGCACCTGGAGGG + Intronic
1072726326 10:97816330-97816352 CCACTGCAGCAGAGCCTGGAGGG + Intergenic
1075074576 10:119342287-119342309 CCAATCCAGCAGCACCGGTTTGG - Intronic
1075767167 10:124902726-124902748 CCAATCCAGCAGCATCTCTTAGG - Intergenic
1076487607 10:130834902-130834924 CAAATCCAGCCACACCTTGAGGG + Intergenic
1079373634 11:19872809-19872831 CCAAACCAGCAGCACCTCCATGG - Intronic
1082097989 11:48146635-48146657 CCAATCCACTACTACCTGGATGG - Intronic
1083310943 11:61783534-61783556 CGAATTCTCCAGCACCTGGATGG - Exonic
1084166011 11:67375041-67375063 CCATTCCAGGGGCACCAGGAAGG - Intronic
1084422045 11:69065386-69065408 CCCATCCTGAGGCACCTGGAAGG + Intronic
1084536888 11:69762619-69762641 CCAAGCCATCAGCAGCTGGGGGG - Intergenic
1088745922 11:112804987-112805009 CCAGTCCAGATGCTCCTGGAGGG + Intergenic
1088753213 11:112863486-112863508 CCAATCCTTCAGCCACTGGAGGG - Intergenic
1089730371 11:120515216-120515238 CTCTTCCAGCAGCACCTTGAAGG - Intronic
1090075377 11:123577434-123577456 CCAACCCCGCAGAACCAGGACGG + Exonic
1091216849 11:133907449-133907471 CCAAGACAGCAGCACCAAGAAGG + Intergenic
1091218345 11:133917136-133917158 GAAAGCCAGAAGCACCTGGACGG + Intronic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1102510555 12:113412464-113412486 CCAGTCCATCAGCTGCTGGAGGG + Intronic
1103146347 12:118598363-118598385 CCTAGCCAGCTGCACCAGGAAGG - Intergenic
1103721334 12:122977076-122977098 CCAAACCAGCAGGAGCTGGAAGG + Intronic
1104736699 12:131139608-131139630 CCGGTCCCGCAGCACCAGGAGGG + Exonic
1105803493 13:23933505-23933527 CAAATTCAGCAGCACCTGGAAGG - Intergenic
1106688294 13:32085896-32085918 CCAAAGCATGAGCACCTGGAGGG - Intronic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1112299352 13:98216243-98216265 CCAGGCCAGCAGCAGCTGAAAGG + Intronic
1113145547 13:107203741-107203763 CCAAGCCAGGAGCACTTGCAGGG - Intronic
1117258081 14:54000686-54000708 CCTCTGCAGCAGCTCCTGGAGGG - Intergenic
1120555238 14:85921417-85921439 CCAGGCCAGCAGCAGCTGCATGG - Intergenic
1123216716 14:106814813-106814835 CCCATCCAGGAACATCTGGAGGG + Intergenic
1124469643 15:29971859-29971881 ACCATCCAGCAGCCACTGGATGG + Intergenic
1127131848 15:55874273-55874295 CCAAACAAGCAGAAACTGGAGGG + Intronic
1127963760 15:63908745-63908767 CCCATCCCCCAGCCCCTGGATGG - Intronic
1128249846 15:66156396-66156418 TCAAGCCACCAGCACCTGGTGGG + Intronic
1128865845 15:71115040-71115062 CCATTCCGGCAGCATCAGGATGG - Intronic
1129674369 15:77624606-77624628 CCAAGCCTGCTGCTCCTGGAGGG - Intronic
1131539070 15:93260908-93260930 CAAATCCTGCAGCTCCTGCAAGG - Intergenic
1132252124 15:100341840-100341862 CCAAACCAGCAGCAGCAGCACGG + Exonic
1132983029 16:2748978-2749000 CCATGCCAGCTGCACGTGGAAGG + Intergenic
1133054271 16:3137694-3137716 CACATCCAGGGGCACCTGGATGG + Intronic
1134569535 16:15279519-15279541 CAAATCCAGCAGAAGATGGAGGG - Intergenic
1134732844 16:16476530-16476552 CAAATCCAGCAGAAGATGGAGGG + Intergenic
1134934598 16:18235441-18235463 CAAATCCAGCAGAAGATGGAGGG - Intergenic
1136714304 16:32264536-32264558 CCAATCCAGCTGCCCCAGGCTGG - Intergenic
1136753588 16:32664881-32664903 CCAATCCAGCTGCCCCAGGCTGG + Intergenic
1136814525 16:33205484-33205506 CCAATCCAGCTGCCCCAGGCTGG - Intronic
1136821001 16:33315564-33315586 CCAATCCAGCTGCCCCAGGCTGG - Intergenic
1136827564 16:33372103-33372125 CCAATCCAGCTGCCCCAGGCTGG - Intergenic
1136832630 16:33470874-33470896 CCAATCCAGCTGCCCCAGGCTGG - Intergenic
1137028152 16:35498830-35498852 CCAATCCAGCTGCCCCAGGCTGG + Intergenic
1142177042 16:88650192-88650214 CCACTGCAGCAGCTCCAGGAAGG - Intronic
1142404635 16:89880960-89880982 CCATCCCAGCAGCACCATGATGG - Intronic
1202993101 16_KI270728v1_random:28458-28480 CCAATCCAGCTGCCCCAGGCTGG - Intergenic
1203055747 16_KI270728v1_random:925233-925255 CCAATCCAGCTGCCCCAGGCTGG + Intergenic
1146095871 17:29929997-29930019 ACAACCCAGCAGCGCCTAGATGG - Exonic
1146238207 17:31187520-31187542 CCAATCCAGCTGCTTCAGGATGG - Intronic
1146527405 17:33578746-33578768 TCAATACAGCCCCACCTGGAAGG + Intronic
1151278512 17:73054505-73054527 CCAAACTAGAAGCACCTTGAGGG - Intronic
1151715308 17:75828059-75828081 CCAATCCTGCAGCTGCTGGAGGG - Exonic
1152441212 17:80311401-80311423 ACAATCCAGCAGCACAGGGCTGG - Intronic
1152890589 17:82879532-82879554 CCAGACCAGCAGCACCAGAAGGG - Intronic
1155528689 18:26743824-26743846 TCAAGCCAGAATCACCTGGAGGG + Intergenic
1158507225 18:58057505-58057527 CCTCTGCAGCTGCACCTGGATGG + Intronic
1163114477 19:15180814-15180836 CCAATCCACCAGCGTCTGGAGGG + Exonic
1163504569 19:17697874-17697896 CAAATGCAGATGCACCTGGAGGG - Intergenic
1163790397 19:19302821-19302843 CCAACCCACCAGCACTTGGCTGG + Intronic
1165008881 19:32828806-32828828 CCAACCCAGCAGCACTCGGCGGG - Intronic
1167083321 19:47291970-47291992 CTATTCCAGAAGCACCTGTAAGG - Intronic
1168279270 19:55295596-55295618 GTCATCCAGGAGCACCTGGAGGG + Intronic
1168294598 19:55372678-55372700 CCAATCCAGCACCACTGGAAGGG + Intergenic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
925514591 2:4666478-4666500 CCAAACCAGCAGCACTTGGATGG - Intergenic
926122847 2:10254239-10254261 CCAGGCCAGCAGAACCTGGGAGG - Intergenic
927922193 2:26981626-26981648 GCAATCCAGCCACACCCGGAAGG - Intronic
929769265 2:44878414-44878436 AGAATCCAGCAGCCCCTGGGAGG + Intergenic
930015607 2:46968451-46968473 CCAAGCCTGCAGCACCTGGGTGG + Intronic
930872714 2:56184485-56184507 CCAACCCAGCGGCCCCTGGGCGG + Exonic
931801780 2:65765717-65765739 CCAATCCAGAGGCACGTGGCAGG + Intergenic
931830693 2:66048057-66048079 CGAATGCAGCAACACATGGAAGG + Intergenic
932462788 2:71894051-71894073 CTACTCCAGCTCCACCTGGAAGG + Intergenic
932640578 2:73441459-73441481 CCAACCCAGCAGCAACAGGTAGG - Intronic
934649899 2:96084808-96084830 CCAGCCCAGCAGCCCCTGGCTGG - Intergenic
936146956 2:109986662-109986684 CCAGCCCAGCACCACCTGGAAGG + Intergenic
936197736 2:110384821-110384843 CCAGCCCAGCACCACCTGGAAGG - Intergenic
938300413 2:130207343-130207365 CTAACCCAGCACCACCTCGAGGG - Intergenic
938456315 2:131467134-131467156 CTAACCCAGCACCACCTCGAGGG + Intronic
940980919 2:160002287-160002309 CAACTCAAGCAGCACTTGGAAGG + Intronic
944632805 2:201643555-201643577 CAAACCCAGCAGCGCCTGGCAGG - Intronic
948040356 2:234896660-234896682 CCAGGCCAGGATCACCTGGACGG + Intergenic
948975112 2:241459166-241459188 TCAAACCAGCAGCCCCTGCATGG - Intronic
1169091352 20:2863079-2863101 CCTGTCCAGCAGCACCTGGATGG - Exonic
1169966557 20:11224258-11224280 CAAATGCAGTTGCACCTGGAAGG - Intergenic
1170040357 20:12033770-12033792 CCAATGCAGCAGAACTGGGAAGG + Intergenic
1171724649 20:28604804-28604826 CCAAACCATCAACACCTGGGAGG - Intergenic
1171753416 20:29078244-29078266 CCAAACCACCAACACCTGGAAGG + Intergenic
1171788844 20:29499317-29499339 CCAAACCACCAACACCTGGAAGG - Intergenic
1171858686 20:30375182-30375204 CCAAACCACCAACACCTGGGAGG + Intergenic
1172127993 20:32636649-32636671 CAAGTCCAGCAGCACATGGGGGG - Intergenic
1172401030 20:34651610-34651632 CCAATCCACCAGAACCAGAAGGG + Intronic
1172636593 20:36414249-36414271 CCATTCCAGCAGGGTCTGGATGG - Intronic
1174183391 20:48688938-48688960 CCACGCCAGCAGCAGCTAGAGGG + Intronic
1174541834 20:51295999-51296021 CCACTTCAGCAGCACATGGAGGG - Intergenic
1174896685 20:54456946-54456968 CCAATCCAGAAACAAGTGGATGG - Intergenic
1175920053 20:62446458-62446480 CCAAAGCAGCAGCCCCAGGAGGG + Intergenic
1175996165 20:62813186-62813208 CCAGCCCAGCAGGACCTGCAGGG + Exonic
1176052887 20:63129956-63129978 ACACCACAGCAGCACCTGGAGGG - Intergenic
1178853312 21:36231042-36231064 ACAATCCAGCAGCAGGTGGCAGG - Exonic
1179380789 21:40897361-40897383 TCACTCCAGCTGCAGCTGGAGGG + Intergenic
1180116918 21:45713715-45713737 CCATTCCAGCAGCCTCTCGATGG + Intronic
1180298200 22:10963495-10963517 CCAAACCATCAACACCTGGGAGG - Intergenic
1180410211 22:12600304-12600326 CCAAACCACCAACACCTGGAAGG + Intergenic
1182430526 22:30296102-30296124 CCACTCCAGCTGCGGCTGGAAGG + Intronic
1182898797 22:33880857-33880879 CCAACCCAGCAGCAGAGGGATGG + Intronic
1183737300 22:39651048-39651070 GCCATCCACCAGCCCCTGGATGG + Intronic
1183815020 22:40292575-40292597 CCAATCCAGCAGGAGATTGAAGG + Intronic
1184518715 22:44979474-44979496 CCCTTCCTGCAGCCCCTGGAGGG + Intronic
1184669390 22:46004831-46004853 CCAAGCAGGCAGCACCTGCATGG + Intergenic
1185219727 22:49623325-49623347 CAAATCCAGCAGGCCCTGGATGG + Intronic
1185279804 22:49965206-49965228 GAGATCCAGGAGCACCTGGAGGG + Intergenic
950836060 3:15920087-15920109 ACAAGTCAGCAGCACCTTGATGG - Intergenic
950903077 3:16514053-16514075 CCCAGCCATCAGCACCTTGATGG - Intergenic
952638328 3:35558199-35558221 CCAATTCAGGACCACCAGGAGGG + Intergenic
952711140 3:36433110-36433132 ACCATCCAGAAGCACCTGCAAGG + Intronic
954445755 3:50545988-50546010 GCATTCCAGGAGCACCTGGGTGG - Intergenic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
955835744 3:63053226-63053248 CCACTCCTGCAACACCAGGAGGG - Intergenic
956405279 3:68922324-68922346 CCAATGCTGGAGCACCTGGAAGG - Intronic
956573871 3:70729665-70729687 CCAGTCCAGCAGAATCAGGAAGG - Intergenic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
961727524 3:128942484-128942506 CCCATCCCGAAGCACCTGGTTGG + Intronic
961900250 3:130203050-130203072 CCACTCCAGCTGCACCTAAAAGG - Intergenic
963139739 3:141937584-141937606 CCCCTCCCTCAGCACCTGGAAGG + Intergenic
963437917 3:145295338-145295360 TGAATCCAGTATCACCTGGAAGG + Intergenic
964370056 3:155990991-155991013 CAAATCCAGCAGCACTAGGGTGG - Intergenic
966914940 3:184579469-184579491 TCATTCCAGGAGCAACTGGAGGG - Exonic
967806319 3:193717181-193717203 CCATCCCAGCAGCACCTTGCAGG - Intergenic
968446261 4:653844-653866 CGACCACAGCAGCACCTGGAGGG - Exonic
968471287 4:783516-783538 CCCAGCCAGCAGCATCAGGAAGG + Intergenic
968637959 4:1692123-1692145 CCAGCCCAGCATCACTTGGAGGG + Intergenic
969099425 4:4757633-4757655 GAATTTCAGCAGCACCTGGAAGG + Intergenic
969742849 4:9045698-9045720 CCACTCCAGCTGCAGCTGAAAGG + Intergenic
970941759 4:21642218-21642240 TCAAACCAGCAGCATCAGGATGG - Intronic
970941773 4:21642352-21642374 TCAAACCAGCAGCAACAGGATGG - Intronic
971235638 4:24839659-24839681 CCATTGCAGCCCCACCTGGAAGG - Intronic
977616170 4:99089263-99089285 CCATTCCAGCAGTTCCTGAAGGG + Intergenic
979096053 4:116552993-116553015 CCAGTACAACAGCACCTTGAGGG - Intergenic
991078628 5:62570095-62570117 TTAATCCAGCAGAAGCTGGAGGG + Intronic
994077504 5:95669916-95669938 TCATTCCTGCAGAACCTGGAGGG + Intronic
994144011 5:96372522-96372544 CCAATGCAGCAGTCCCTGGTGGG - Intergenic
997297360 5:132776693-132776715 CCTATCCCGCAGCACCTGTGCGG + Intronic
999423738 5:151467810-151467832 GAAAACCAGCAGCACCAGGAAGG - Exonic
999545182 5:152621330-152621352 TCAATTCAGCAGCACCTATAAGG + Intergenic
999978585 5:156936964-156936986 CCAGTCCTGTACCACCTGGATGG + Intronic
1001787137 5:174423567-174423589 GTCTTCCAGCAGCACCTGGAAGG + Intergenic
1002081345 5:176739507-176739529 CCACACCAGCAGCACCTGCTGGG - Intergenic
1002430608 5:179201909-179201931 CCACTCCAGCAGCCCCTGCTGGG - Intronic
1004569384 6:16830916-16830938 ACACACCAGAAGCACCTGGAGGG + Intergenic
1005999839 6:30956207-30956229 CCAAGGCAGCCCCACCTGGACGG + Intergenic
1007907833 6:45481270-45481292 CCAATCCAGCTAAACATGGATGG - Intronic
1012239909 6:96860082-96860104 CCAATCCAGCAGTGGCTGAAAGG + Intergenic
1015944213 6:138483544-138483566 CCACTCCAGCTGCAACTGCAGGG + Intronic
1017657910 6:156647580-156647602 CCAAACCAGCAGCCCTGGGAGGG - Intergenic
1017823462 6:158064905-158064927 CCCAACCAGCAGCAGCTTGATGG - Exonic
1017845575 6:158255182-158255204 CCCCTCCAGCAACACCTGCAGGG - Intronic
1018733719 6:166672062-166672084 CTAATCCAGCAGCAACTAGCGGG - Intronic
1021474709 7:21047888-21047910 CCCAATCAGAAGCACCTGGAGGG + Intergenic
1022262771 7:28722407-28722429 CCCATCCACCAGCCTCTGGAAGG + Intronic
1024566319 7:50684006-50684028 CCAATCCTGCAGAACATGGCAGG + Intronic
1024674199 7:51623551-51623573 CCAAGACAGCAGCACCAGGAAGG + Intergenic
1034313784 7:150111713-150111735 CCACCCCAGCAGCACCTCGCGGG + Intergenic
1034693993 7:153038027-153038049 CCAATCTAGAAGCAAATGGAAGG + Intergenic
1034793114 7:153989079-153989101 CCACCCCAGCAGCACCTCGCGGG - Intronic
1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG + Intergenic
1035547338 8:493341-493363 CTAATACATCAGCATCTGGAAGG - Intronic
1035566492 8:644631-644653 CCACTCACGCAGCTCCTGGAAGG - Intronic
1035729366 8:1843645-1843667 GCAATACAGCAGCACCTGTGAGG - Intronic
1035729808 8:1845984-1846006 CCAGTCCAGCTGCACCCAGAGGG - Intronic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1039288945 8:36073171-36073193 CCAATCCCGAAGCACCTCGCTGG + Intergenic
1045339076 8:101235426-101235448 TTAATCCAGCAGCTTCTGGAGGG - Intergenic
1045479786 8:102582742-102582764 CCAAGCCAGCAGCTAGTGGATGG + Intergenic
1046744508 8:117862588-117862610 CAATTCCAGCAGTGCCTGGATGG - Intronic
1048255674 8:132903399-132903421 CCATTCCATCTGCACCTGCATGG - Intronic
1050079777 9:1904215-1904237 CCACTCCAGCTGCAACTGAAAGG + Intergenic
1050332673 9:4561441-4561463 CCAGTGCAGCAACACCTGAAGGG - Exonic
1050717132 9:8542623-8542645 CCAATAGAGCTGCCCCTGGATGG + Intronic
1051641070 9:19225342-19225364 CTAATACAGCAGTACCTGGAAGG - Intergenic
1053724961 9:40990372-40990394 CCAAACCACCAACACCTGGGAGG + Intergenic
1054341007 9:63861629-63861651 CCAAACCACCAACACCTGGGAGG - Intergenic
1055566500 9:77574249-77574271 ACAATCAAGCTGCACCTTGACGG + Intronic
1057138910 9:92715084-92715106 CTAACCCAGCAGCAGCGGGACGG - Exonic
1057465217 9:95307775-95307797 CCCTTCCAGCAGCAACTGGCAGG - Intronic
1061593744 9:131615397-131615419 CCAACCCTGCAGCACCGGCAGGG + Intronic
1062248579 9:135583096-135583118 CCCATCCAGCAGCTCCTGGCAGG + Intergenic
1062582695 9:137235516-137235538 CAAGTCCGGCAGCCCCTGGAGGG + Intronic
1203449859 Un_GL000219v1:101622-101644 CCAAACCACCAACACCTGGAAGG - Intergenic
1185713525 X:2323181-2323203 CCAACCAACAAGCACCTGGAAGG + Intronic
1187318584 X:18220622-18220644 CCAATCCTGCCGCCCCTGAATGG + Intronic
1188894904 X:35654924-35654946 ACAATCCAGCAGCACCTAAAGGG - Intergenic
1189880841 X:45490625-45490647 GCAATCTAGCAGCAACTGGAAGG - Intergenic
1190470554 X:50775092-50775114 CCAAAGCAGCAGCATCAGGAGGG - Intronic
1193663596 X:84287756-84287778 ACAGTCCAGCAGCAGCTGGCTGG - Intergenic
1197864324 X:131001460-131001482 CTAATCCAGAATCATCTGGAAGG + Intergenic
1198512360 X:137365229-137365251 CAACTCCAGCAGCACCAGAACGG - Intergenic
1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG + Intronic