ID: 1112081705

View in Genome Browser
Species Human (GRCh38)
Location 13:95979415-95979437
Sequence CCAGGGATGAAACGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112081705 Original CRISPR CCAGGGATGAAACGGGTGAA GGG (reversed) Intronic
900359095 1:2279370-2279392 CCAGGAAGGAAATGGGGGAAGGG - Intronic
900891787 1:5454796-5454818 TCAGGGATGAAACGGAAAAATGG - Intergenic
902785909 1:18732601-18732623 GCAGGGTAGAAAGGGGTGAAAGG + Intronic
903341865 1:22659622-22659644 CCAGGGATAAAAGGAGAGAAAGG + Exonic
913978073 1:143481335-143481357 ACTGGGATGAAACCGGTTAAGGG - Intergenic
914072477 1:144306964-144306986 ACTGGGATGAAACCGGTTAAGGG - Intergenic
914106677 1:144659392-144659414 ACTGGGATGAAACCGGTTAAGGG + Intergenic
914348613 1:146820983-146821005 CCAGGGCAGAGAGGGGTGAATGG - Intergenic
917028444 1:170665405-170665427 CCTGGGATGAACAGGGTGACCGG - Intronic
919805877 1:201380741-201380763 CCAGGCATGCAAAGGGGGAATGG + Intronic
923934819 1:238748455-238748477 CCAGTGATGAAATGGGGGAATGG + Intergenic
924461569 1:244264329-244264351 CCAAGGATGAAGTGGGTGAAGGG + Intergenic
1071582823 10:86789019-86789041 TCAGGGATGAAAAGGGTGTCAGG + Intronic
1071987445 10:91066406-91066428 CCAGGAAGGAAAAGGGTGGAAGG + Intergenic
1072000109 10:91186669-91186691 CCCGGGATGGAACTGGTGAAAGG - Intronic
1072049815 10:91692101-91692123 CCAGGGACGAAATGGGGCAATGG + Intergenic
1072415860 10:95246236-95246258 CCAGGGAAGAAGCGGGTGTGAGG + Intronic
1077013099 11:388186-388208 CCAGTGATAAAATGGGAGAATGG + Intergenic
1078088116 11:8246901-8246923 GCTGGGATGAAAGGGATGAAAGG + Intronic
1081612041 11:44568575-44568597 CCAGGGAGGATAGGGGTGAGAGG + Intronic
1085420317 11:76352709-76352731 CCAGCGAAGAAGAGGGTGAAGGG - Exonic
1085817227 11:79752097-79752119 CCAGGGAGGCAACTGGTGAGAGG + Intergenic
1086251666 11:84822794-84822816 CAAGGGATTAAATGGGTAAAAGG + Intronic
1088963306 11:114692361-114692383 CCAAGGATGAAGGGGGAGAATGG - Intronic
1089561175 11:119343998-119344020 CCCGGGATGAGACAGGAGAAGGG - Intronic
1090345221 11:126063470-126063492 CCAGGCAAGAACCGGGAGAAGGG - Intergenic
1091971122 12:4787994-4788016 GCAGGGATTGAACTGGTGAAAGG - Intronic
1094409744 12:30156624-30156646 CAAGAGATGAAACGAATGAAAGG + Intergenic
1094414033 12:30199657-30199679 TCAGGTAAGAAAGGGGTGAAAGG + Intergenic
1095561509 12:43571597-43571619 CCAGTGAAGAAGAGGGTGAAGGG - Intergenic
1097560713 12:61202610-61202632 CCATGGATGAAACGGCTGAGTGG - Intergenic
1101548251 12:105737149-105737171 CCAGGGATTCACAGGGTGAATGG - Intergenic
1102364181 12:112317636-112317658 CCAGTGATCATACGGGTCAATGG + Intronic
1103204273 12:119116149-119116171 CCAGGGTTGAAACAGATGAGAGG - Intronic
1105221277 13:18330125-18330147 ACTGGGATGAAACCGGTTAAGGG + Intergenic
1105900953 13:24752760-24752782 CCAGGGATGATACTGGTCCAGGG + Intergenic
1108091689 13:46856050-46856072 CCAGGGATGAAGCAGGGTAAGGG - Intronic
1109030529 13:57182992-57183014 CCAATGATGAAATGGGAGAATGG - Intergenic
1109715724 13:66219600-66219622 CTAGGGATGAAAGGGGAGGATGG + Intergenic
1112081705 13:95979415-95979437 CCAGGGATGAAACGGGTGAAGGG - Intronic
1114222577 14:20710073-20710095 CCTTGGATGAAAAGGGTGAAGGG + Intergenic
1119658802 14:76436210-76436232 CCAGCCATGAGACGGGTGCAGGG + Intronic
1120443496 14:84565764-84565786 CCAGTGATGAAATGTGAGAATGG - Intergenic
1121519555 14:94576763-94576785 GCAGAGATGACACAGGTGAATGG - Intronic
1121908540 14:97768756-97768778 AGAGGGAGGAAAGGGGTGAAAGG + Intergenic
1128344605 15:66845530-66845552 GCAGGGATGAGACTGGAGAAGGG + Intergenic
1133374688 16:5274593-5274615 CCAGGGAGGAGACGTATGAAAGG - Intergenic
1134001812 16:10788692-10788714 TCAGGGGTGAAACGGGGAAAGGG + Intronic
1135656602 16:24255916-24255938 CCCGGGAAGGAACGGGGGAAGGG + Exonic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139847314 16:69930100-69930122 CACGGGAAGAAAAGGGTGAAGGG - Intronic
1139985425 16:70894565-70894587 CCAGGGCAGAGAGGGGTGAATGG + Intronic
1144714917 17:17427188-17427210 CTAAGGATGAAATGGGAGAATGG + Intergenic
1146692978 17:34889458-34889480 CTAGGGAAGAAAGGGGTGGAAGG - Intergenic
1148745462 17:49915695-49915717 AGAGGGAAGAAAGGGGTGAATGG + Intergenic
1149020832 17:51962327-51962349 CCAAGGAAGAAATGAGTGAAGGG - Intronic
1151163734 17:72186882-72186904 CCAGGGATGAGACTGATAAAAGG - Intergenic
1153428285 18:4989493-4989515 CCAATGATGAAATGGGAGAATGG - Intergenic
1155839760 18:30630657-30630679 CCAGTGATAAAATGGGAGAATGG - Intergenic
1156038374 18:32792245-32792267 TCAGGGATGAAAGTGGTGGAGGG + Intergenic
1162115912 19:8429241-8429263 GGAGGTATGAAATGGGTGAACGG - Intronic
1163475783 19:17525420-17525442 CCAGGCACAAAACAGGTGAAGGG + Intronic
1168121458 19:54254517-54254539 CCTGGGATGCAAATGGTGAAAGG - Intronic
1168367373 19:55799997-55800019 AAAGGGATGAAGGGGGTGAAAGG + Intronic
925751597 2:7094657-7094679 CAAGGGATGAATCGGGAGAAGGG + Intergenic
926492720 2:13544500-13544522 CCAGGGAGGGACCGGGTGAGAGG + Intergenic
926530688 2:14040970-14040992 TCAGGGATGGAACAGGTGAGTGG + Intergenic
929823352 2:45291014-45291036 CCAGGGATGAAAGGGTTAAAGGG - Intergenic
931662349 2:64577818-64577840 CCATGGAGGAAACTGGTGAAGGG - Intronic
934182778 2:89642343-89642365 ACTGGGATGAAACCGGTTAAGGG - Intergenic
934293070 2:91716532-91716554 ACTGGGATGAAACCGGTTAAGGG - Intergenic
937155590 2:119716543-119716565 CCAGGGGAGAAATGGGTGTAAGG + Intergenic
938599327 2:132821304-132821326 CTAGGGATGAAACAGGTTTAGGG + Intronic
941087363 2:161133477-161133499 CCACGGATTAAACAAGTGAAAGG - Intergenic
941095958 2:161239260-161239282 CCAGGGGTGAAAAGAGTGACAGG + Intergenic
941717890 2:168782830-168782852 CAAGGGAAGAATCGGGAGAAGGG + Intergenic
944000281 2:194826818-194826840 CCAGGGATGAAACAAAAGAAAGG + Intergenic
944357260 2:198805945-198805967 ACAGGGATGGAAAGGGAGAAGGG - Intergenic
948282882 2:236761900-236761922 CCAGGGGTGAAAACGATGAAGGG - Intergenic
948301392 2:236909777-236909799 CCAGGGATGAGGAGGGGGAAGGG - Intergenic
1168856993 20:1015541-1015563 ACAGGGCAGAAACGGGGGAAAGG - Intergenic
1169066308 20:2695997-2696019 CCAGGGAGGAAGCGGGTGGAGGG - Intronic
1170877991 20:20268319-20268341 CCAGGGATGTGAGGGGAGAATGG + Intronic
1172186293 20:33033052-33033074 CCAGGGATGAAACCTATCAAGGG + Exonic
1173173634 20:40747306-40747328 CCAGGGAGGAAACGTTTGCATGG + Intergenic
1176159013 20:63639204-63639226 CCAGGGGTGAATGGGGTGAGTGG + Intergenic
1176729701 21:10480938-10480960 ACTGGGATGAAACCGGTTAAGGG + Intergenic
1179395110 21:41032393-41032415 CCAGGGAAGAAACAGCTGGAAGG - Intergenic
1179445105 21:41425652-41425674 CCAGGGTGGAAACGGGTGTGTGG - Intronic
1179913130 21:44460681-44460703 CCCGGGGTGAAAGTGGTGAATGG - Exonic
1181103612 22:20558185-20558207 CCAGGGAGGCAAGTGGTGAAGGG - Intronic
1181748862 22:24975131-24975153 CCGAGGAGGAAACTGGTGAAGGG - Intronic
1183829650 22:40411004-40411026 CCAGGGCTGAGACAGGTTAAGGG - Exonic
1184832680 22:46999605-46999627 CAAGTGATGAAACAGGTGAGGGG - Intronic
949670547 3:6395162-6395184 CCAGGACTGAAACGGGTGAGTGG - Intergenic
951286902 3:20824341-20824363 CCAGGGAGGAAACAGGTTAAGGG - Intergenic
952003175 3:28809834-28809856 CCAGTGATGAAATGGGAGATTGG - Intergenic
954427587 3:50451574-50451596 CCAGGGATGAAAATAGTGGAGGG - Intronic
956557726 3:70541018-70541040 CCAGTGATGAATTGGGAGAATGG - Intergenic
957712743 3:83884533-83884555 CCAGGGAGGAAACCGGTGGTAGG - Intergenic
957865143 3:86013258-86013280 CCAGTGAAGAAGAGGGTGAAGGG + Intronic
962061410 3:131931636-131931658 ACAGGGATGAAATGGGGGAGGGG - Intronic
962209279 3:133463460-133463482 CAAGGGAGGAATCGGGAGAAGGG - Intronic
965822865 3:172702038-172702060 CCAGAGAAGAGAAGGGTGAAAGG - Intronic
971491412 4:27215958-27215980 CCAGGGATGATACGGATAAACGG - Intergenic
971859922 4:32089563-32089585 CCAGTGATGAAATGAGAGAATGG - Intergenic
973988331 4:56377642-56377664 GCTTGGATGAAACAGGTGAAGGG + Intronic
974026732 4:56739352-56739374 ACAGGCATGCAACGGGTGGATGG + Intergenic
977092800 4:92700619-92700641 CCAGGGAAGACACGGGTTTAAGG + Intronic
988604331 5:32667048-32667070 CCAGTGATGGAATGGGAGAATGG - Intergenic
992616834 5:78553261-78553283 CAAGGGATGAAAGAGGGGAATGG - Intronic
993772861 5:91952744-91952766 GCAGGGATGAGAAGGGGGAAGGG + Intergenic
994244946 5:97468186-97468208 CCAATGATGAAATGGGAGAATGG - Intergenic
995596936 5:113757439-113757461 CCAGGGATGAAAAGGAAGAGAGG + Intergenic
996401630 5:123069229-123069251 CCAGGGAGTAAACGGGTGTGTGG + Intergenic
1000006165 5:157186831-157186853 GCAGGGGTGAAGCGGGTGCAGGG - Intronic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1003090506 6:3098314-3098336 ACAGGGATGAAATAGCTGAATGG + Intronic
1004587135 6:17013363-17013385 CCAGGAATGAAATGGTGGAATGG + Intergenic
1004799148 6:19126788-19126810 CCAGGGATTAAGCAGGAGAAAGG + Intergenic
1007100657 6:39244084-39244106 GCAGGAATGAACCGGGTGCATGG - Intergenic
1007433591 6:41791585-41791607 CCAGGGCTGAAAAGTGTGACAGG - Exonic
1007955746 6:45916438-45916460 CCAGGAATGAAAGGGGTAGAGGG - Intronic
1009242820 6:61201284-61201306 CCAGTGGTGAAATGGGAGAATGG - Intergenic
1009311455 6:62158091-62158113 ATAGGGATGAAATGGATGAAAGG - Intronic
1011431822 6:87295434-87295456 TCAGGGAAGAATGGGGTGAAGGG + Intronic
1011978747 6:93343730-93343752 CCAAGGATGAAATGGATGAATGG - Intronic
1018125096 6:160674820-160674842 TCAGGGATGACACAAGTGAATGG + Intergenic
1019292931 7:259074-259096 CCAGCCATGAAACGGGGGAAAGG - Intronic
1022655824 7:32318662-32318684 CCAGCGGTGACATGGGTGAAGGG + Intergenic
1023025484 7:36046029-36046051 GTAGGGTTGAAACTGGTGAAGGG + Intergenic
1029894063 7:103962955-103962977 CCAGGGAAGACACTGGGGAAAGG + Intronic
1032503413 7:132417231-132417253 CCAGAGATGAAATGGCAGAAAGG + Intronic
1034520939 7:151619240-151619262 CCAGTGATGAAGCTGGAGAACGG + Intronic
1034599884 7:152240635-152240657 ACTGGGATGAAACCGGTTAAGGG - Intronic
1040489729 8:47908690-47908712 CCAGGGAACAAGCAGGTGAAAGG + Intronic
1042224321 8:66503826-66503848 CCAGGGAACAGACGGCTGAATGG - Intronic
1043303293 8:78761986-78762008 CCAGCGAAGAAGAGGGTGAAGGG - Intronic
1044008434 8:86964297-86964319 CCAATGATGAAACGGGAGAATGG - Intronic
1045110650 8:98936879-98936901 CCAGGGATGGTATGGGGGAAAGG + Intronic
1048421439 8:134282251-134282273 TCAGAGAAGAAAAGGGTGAAGGG + Intergenic
1048870307 8:138791751-138791773 ACAGGGATGAATGTGGTGAAAGG - Intronic
1049755145 8:144308121-144308143 TCAGTGAAGAAACTGGTGAAGGG - Intronic
1051167478 9:14279703-14279725 CCAGAGATGAAGAGTGTGAAAGG - Intronic
1053076886 9:35141059-35141081 CCAATGATGAAATGGGAGAATGG + Intergenic
1057410902 9:94815841-94815863 ACAGGGCTGAAAAGGCTGAAAGG - Intronic
1060718476 9:125956793-125956815 GCAGGCAGGAAACTGGTGAAGGG - Intronic
1203584575 Un_KI270746v1:53136-53158 ACTGGGATGAAACCGGTTAAGGG - Intergenic
1187055733 X:15739776-15739798 CCAGGGAAGAAGTGGGTGAGAGG + Intronic
1187613245 X:20965760-20965782 CAAGGGATGAAAGGCGGGAATGG - Intergenic
1188144305 X:26590652-26590674 CCTGGGAGGGACCGGGTGAAAGG - Intergenic
1188983903 X:36752580-36752602 ACAGGGAGTAAATGGGTGAAGGG + Intergenic
1189763263 X:44343792-44343814 GCGGGGATGAAGCGGGTGGAGGG - Intergenic
1190320486 X:49176783-49176805 CCAGGGATACAGCAGGTGAAGGG + Intronic
1194535128 X:95096490-95096512 TAAGGGAAGAAACTGGTGAAAGG + Intergenic
1195598150 X:106716419-106716441 CCAGGGATTAAAAGTGGGAAGGG + Intronic
1197562910 X:128047007-128047029 CCAGGAATGGACCTGGTGAAGGG - Intergenic
1198506027 X:137302254-137302276 CTAGGGATGAATGGGGGGAAAGG + Intergenic