ID: 1112091605

View in Genome Browser
Species Human (GRCh38)
Location 13:96090098-96090120
Sequence GCTCCTGTCACACCGGCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 73, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112091597_1112091605 13 Left 1112091597 13:96090062-96090084 CCGTACCTAGGGCAGGTTTTTGC 0: 1
1: 0
2: 1
3: 7
4: 93
Right 1112091605 13:96090098-96090120 GCTCCTGTCACACCGGCTGGCGG 0: 1
1: 0
2: 2
3: 73
4: 376
1112091598_1112091605 8 Left 1112091598 13:96090067-96090089 CCTAGGGCAGGTTTTTGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1112091605 13:96090098-96090120 GCTCCTGTCACACCGGCTGGCGG 0: 1
1: 0
2: 2
3: 73
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112091605 Original CRISPR GCTCCTGTCACACCGGCTGG CGG Intergenic
900205831 1:1431516-1431538 GCTCCTGGCCCTCAGGCTGGGGG - Intergenic
900534628 1:3170754-3170776 GCTCCCGTCACCAGGGCTGGAGG + Intronic
900562366 1:3313639-3313661 GCTCCACTCACCCCGCCTGGGGG + Intronic
900995829 1:6123178-6123200 GCTTCTGTCACTCAGCCTGGGGG - Intronic
901087777 1:6622154-6622176 GCTGCTGCCTGACCGGCTGGGGG + Exonic
902064207 1:13670835-13670857 GCTCTTGTTGCACAGGCTGGAGG - Intergenic
902087385 1:13874014-13874036 GCTCCAGTCAAGCCGTCTGGGGG - Intergenic
903603963 1:24561312-24561334 ACTCTTGTCACCCAGGCTGGAGG - Intronic
903660599 1:24975136-24975158 GCTTCTATCACCCAGGCTGGAGG - Intergenic
903926784 1:26836051-26836073 GATCCTGTCTTGCCGGCTGGTGG + Intronic
904107949 1:28101596-28101618 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
905935993 1:41824904-41824926 GCTCTTGTTGCACAGGCTGGAGG + Intronic
906786414 1:48619847-48619869 GCTTCTCTCACAGAGGCTGGAGG - Intronic
908242872 1:62202715-62202737 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
908295112 1:62705646-62705668 GGTCTTGTCACCCAGGCTGGAGG + Intergenic
908660958 1:66434673-66434695 GCTCCTGTTGCCCAGGCTGGAGG + Intergenic
912854078 1:113151733-113151755 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
914051123 1:144133264-144133286 GCTCTTTTCACCCAGGCTGGAGG + Intergenic
914128058 1:144832178-144832200 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
914174832 1:145268604-145268626 GCTCTTGTCCCTCAGGCTGGAGG + Intergenic
914426637 1:147583922-147583944 GCTCTTGTCATTCAGGCTGGAGG - Intronic
914994833 1:152534379-152534401 GCTCCTGCCGCCCCGGCAGGAGG - Intronic
915381245 1:155442548-155442570 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
915479285 1:156174076-156174098 ACTCTTGTCACCCAGGCTGGAGG - Intronic
915505040 1:156349490-156349512 GCTCTTGTCCCCCAGGCTGGAGG - Intronic
918262101 1:182805396-182805418 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
918332310 1:183472198-183472220 GCTTCTGAGAGACCGGCTGGTGG - Intronic
919941620 1:202290829-202290851 GCTCCTGTTGCCCAGGCTGGAGG - Intronic
920240139 1:204540728-204540750 GCTCTTGTCCCCCAGGCTGGAGG - Intronic
920277306 1:204816078-204816100 ACTCTTGTCACCCGGGCTGGAGG - Intergenic
921263267 1:213402301-213402323 GCTCCTGCACCACCAGCTGGCGG - Intergenic
924285049 1:242477215-242477237 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1063249038 10:4253842-4253864 GCTCCTGTCGCACACGCTGGTGG - Intergenic
1063690044 10:8278525-8278547 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1063827689 10:9916726-9916748 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1063855348 10:10244988-10245010 GCTCTTGTCACCCAGACTGGAGG - Intergenic
1063942065 10:11140981-11141003 CCTTCTGTCACGCAGGCTGGAGG - Intronic
1064640306 10:17408786-17408808 GCTCTTGTTACACAGGCTGGAGG + Intronic
1067112668 10:43411191-43411213 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1067628379 10:47942400-47942422 GTACCTCTCACACCAGCTGGTGG - Intergenic
1070850895 10:79560792-79560814 GCTCCAGAGACACTGGCTGGGGG - Intergenic
1070856302 10:79610482-79610504 GCTCCAGGGACACAGGCTGGTGG + Intergenic
1071183089 10:83009700-83009722 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1073037209 10:100572389-100572411 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1073297043 10:102446972-102446994 GCTCTTGTCACCCAGGCTGCTGG - Intergenic
1073420679 10:103421449-103421471 GCTGCTGTCACTGCGGCTGTCGG + Exonic
1074857171 10:117481963-117481985 GCTCTTGTCACCCAGGCTGCTGG - Intergenic
1075586053 10:123658983-123659005 GCTCCTGTCGCCCAGGCTGGAGG - Intergenic
1076657162 10:132032323-132032345 GCTCCCATCACACAGGCTGGAGG + Intergenic
1076674223 10:132139998-132140020 GGGCCTCTCACACCAGCTGGCGG + Intronic
1077122902 11:918626-918648 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1077970948 11:7189122-7189144 ACTCTTGTTACACAGGCTGGAGG - Intergenic
1078213869 11:9294453-9294475 GCTCTTGTTACACAGGCTGGAGG - Intronic
1078553674 11:12300259-12300281 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1079001404 11:16760163-16760185 ACTCTTGTCACTCAGGCTGGAGG + Intergenic
1079064099 11:17274861-17274883 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1079387593 11:19994511-19994533 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1081155980 11:39691402-39691424 GCTACAGTCACACCAGCAGGTGG + Intergenic
1081484152 11:43515230-43515252 GCTGCTCTCAGACAGGCTGGCGG - Intergenic
1081695326 11:45105583-45105605 TCTGCTGTCACCACGGCTGGAGG - Intronic
1081920530 11:46771440-46771462 ACTCCCGTCACCCAGGCTGGAGG + Intronic
1083178859 11:60971608-60971630 GCTGCTGTTACAGGGGCTGGTGG - Intergenic
1083629234 11:64087289-64087311 GCTCCTGTCACTTCGGATGTGGG + Intronic
1084477004 11:69394764-69394786 GCTCCTGTCCCCACGGCGGGGGG - Intergenic
1084890000 11:72232114-72232136 GCCCATGTCACAGCGTCTGGTGG + Intronic
1085097100 11:73770077-73770099 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1085241993 11:75064605-75064627 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1087058293 11:93954731-93954753 CCTCCTGACACACCAGCTTGTGG + Intergenic
1087635781 11:100699553-100699575 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1088300825 11:108356501-108356523 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1089188218 11:116635479-116635501 GCTCCTCTGGCACCTGCTGGAGG + Intergenic
1089756721 11:120692762-120692784 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1089912693 11:122118229-122118251 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1090353740 11:126124932-126124954 GCTCCTGTCACCCTGGTTGGAGG + Intergenic
1090368345 11:126227093-126227115 GGTTCTGTCACCCAGGCTGGAGG + Intronic
1092224248 12:6736543-6736565 GCTGTTGTCACCCAGGCTGGGGG - Intergenic
1092464061 12:8712377-8712399 ACTCTTGTCACCCAGGCTGGAGG - Intronic
1093059097 12:14584110-14584132 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1093616341 12:21230361-21230383 GCTCTTGTTACCCAGGCTGGAGG + Intronic
1095291522 12:40484584-40484606 GACCCTGTCACACCAGCTGATGG - Exonic
1095292286 12:40489883-40489905 GACCCTGTCACACCAGCTGATGG - Exonic
1095292298 12:40489973-40489995 GTCCCTGTCACACCAGCTGATGG - Exonic
1096115233 12:49051438-49051460 GCACCTGTCACCCCGGCCTGAGG - Exonic
1096529379 12:52233545-52233567 CCTCCTGGCGCACCCGCTGGAGG - Exonic
1098028017 12:66226272-66226294 GCTCTTGTCGCACAGGCTGGAGG + Intronic
1098340509 12:69445733-69445755 TACCCTGTCACACAGGCTGGAGG - Intergenic
1100369264 12:93951117-93951139 CCTCCTGTCACCCAGGCTGGAGG - Intergenic
1100824732 12:98463771-98463793 GGCTCTGTCACCCCGGCTGGAGG - Intergenic
1101191727 12:102340924-102340946 TCACCTGTCACTCAGGCTGGAGG + Intergenic
1103516024 12:121508961-121508983 GCACATGTCACACCTGCTGGTGG + Intronic
1103534486 12:121625484-121625506 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1103574771 12:121869315-121869337 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1103680008 12:122685892-122685914 GCTCTTGTCATCCAGGCTGGAGG - Intergenic
1104042743 12:125141126-125141148 GCTCCTGCCACCCCATCTGGGGG - Intronic
1104107964 12:125681060-125681082 GCACCTGACACACAGGATGGTGG + Intergenic
1104467164 12:128999840-128999862 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1104958526 12:132477337-132477359 GCAGCTGTCACACAGCCTGGTGG + Intergenic
1108067117 13:46589631-46589653 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1108947054 13:56040203-56040225 GCTGCTCCCAAACCGGCTGGAGG - Intergenic
1109296634 13:60541198-60541220 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1109748977 13:66665137-66665159 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1110231873 13:73175732-73175754 CCTCTTGTCACCCAGGCTGGAGG + Intergenic
1111868969 13:93806368-93806390 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1111936574 13:94564055-94564077 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1111967749 13:94878060-94878082 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1112091605 13:96090098-96090120 GCTCCTGTCACACCGGCTGGCGG + Intergenic
1112581470 13:100679863-100679885 GCTCCTGTCCAAGGGGCTGGGGG - Intergenic
1113832178 13:113304687-113304709 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1114338306 14:21715671-21715693 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1117043595 14:51790555-51790577 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1117180334 14:53185116-53185138 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1117303836 14:54453904-54453926 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1118201293 14:63676440-63676462 ACTTCTGTCACCCAGGCTGGAGG + Intergenic
1118339112 14:64879873-64879895 GCTCCTGGCACAGCGGCCGCCGG + Exonic
1118633935 14:67730634-67730656 ACTCTTGTCACTCAGGCTGGAGG + Intronic
1118733827 14:68688235-68688257 ACTCTTGTCACCCAGGCTGGAGG - Intronic
1118847192 14:69556448-69556470 GTTCTTGTCACCCAGGCTGGAGG - Intergenic
1120167555 14:81217757-81217779 GGGCCTGTCACCCAGGCTGGAGG - Intronic
1120922637 14:89768907-89768929 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1121379666 14:93452411-93452433 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1121642896 14:95497993-95498015 TGTCCTGTCACCCAGGCTGGAGG - Intergenic
1122204511 14:100141848-100141870 GTCCCTGTCACCCAGGCTGGGGG + Intronic
1122228167 14:100291693-100291715 GCTGCTGCCACTCCTGCTGGAGG - Exonic
1122584757 14:102797767-102797789 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1124865086 15:33482450-33482472 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1125563953 15:40660928-40660950 GGTTCTGTCACCCAGGCTGGAGG - Intronic
1125598021 15:40899829-40899851 GCTACTGGCAGACCGGGTGGAGG + Exonic
1126881569 15:53104050-53104072 GCTCTTGTCACCCATGCTGGAGG - Intergenic
1127492909 15:59482299-59482321 GCTCTTGTCATCCAGGCTGGAGG + Intronic
1128582722 15:68820328-68820350 GCTCCCGTGACTCCGTCTGGGGG - Intronic
1128615665 15:69106941-69106963 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1128971230 15:72108793-72108815 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1128977749 15:72165899-72165921 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1130411706 15:83653756-83653778 GCTCTTGGCACAACGCCTGGCGG + Intergenic
1130564154 15:84980648-84980670 GCTCCTCCCCCACCAGCTGGAGG - Intronic
1131440998 15:92459630-92459652 GCTCTTGTCACCCAGACTGGAGG + Intronic
1131568423 15:93506890-93506912 GCTCCTGTCCCACTGGCTCGCGG + Intergenic
1132041372 15:98527266-98527288 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1132478555 16:154271-154293 GCTCCTGTCCCACTGCCTGCTGG + Exonic
1132480733 16:165027-165049 GCTCCTGTCCCACTGCCTGCTGG + Intronic
1132577049 16:668931-668953 GCTGCTGCCACCCCGGCAGGAGG - Intronic
1132752984 16:1467397-1467419 TCTCCTGCCACACGGGCTGACGG + Intronic
1133192774 16:4146735-4146757 GCTCCTGTCACCCAGGCTGGAGG + Intergenic
1133274880 16:4632045-4632067 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1134034562 16:11019734-11019756 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1134135742 16:11675290-11675312 GCTCCTGTCGCCCAGGCTGGAGG + Intronic
1134455332 16:14391221-14391243 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1134550344 16:15135957-15135979 GCGCCGGGCACCCCGGCTGGTGG + Intronic
1134819846 16:17238030-17238052 GTACCTGGCACACAGGCTGGGGG + Intronic
1135018977 16:18947784-18947806 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1135429209 16:22368240-22368262 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1135493873 16:22934363-22934385 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1135887322 16:26322193-26322215 GCTCCTGTGAAAGCGGCTGCAGG - Intergenic
1138498787 16:57425632-57425654 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1138656868 16:58496386-58496408 ACTCCTGTCACACCACATGGAGG + Intronic
1139602713 16:67996391-67996413 GCTCCTGTTGCCCAGGCTGGAGG + Intronic
1139841845 16:69888155-69888177 GCCCCAGCCACACCGGCTGAAGG + Exonic
1140747996 16:77998044-77998066 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG + Intronic
1141945426 16:87305865-87305887 GCTGCTGGCACAACTGCTGGCGG - Exonic
1141995784 16:87635661-87635683 GCTCGAGTGACACCTGCTGGCGG + Intronic
1142854912 17:2724106-2724128 CCTCCTGTCTCACAGGCAGGTGG + Intergenic
1143094262 17:4468819-4468841 GCTCTTGTCACCGAGGCTGGAGG + Intronic
1143409126 17:6697958-6697980 GCACCTGTCTCAGCGGCAGGAGG - Intronic
1143767990 17:9150168-9150190 ACTCTTGTCACCCAGGCTGGAGG - Intronic
1143810376 17:9466921-9466943 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
1144496345 17:15748645-15748667 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1144547583 17:16212231-16212253 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1145043833 17:19596689-19596711 GCTTTTGTCACCCAGGCTGGAGG - Intergenic
1146005176 17:29156245-29156267 GCGCCTGTCTCACTGGCTGTAGG - Intronic
1148446648 17:47742100-47742122 GCTCTTGTCATCCAGGCTGGAGG + Intronic
1148584951 17:48770883-48770905 ACTCTTGTCACCCAGGCTGGAGG - Intronic
1148612661 17:48974701-48974723 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1148712214 17:49690068-49690090 GCTCCTGTTGCCCTGGCTGGAGG - Intergenic
1149589191 17:57815979-57816001 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1149759986 17:59220487-59220509 GCACCAGTGGCACCGGCTGGGGG + Exonic
1149937317 17:60820977-60820999 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1150646673 17:66982938-66982960 GCACCTGCCTCACAGGCTGGCGG - Intronic
1151019001 17:70590857-70590879 CCTCTTGTCACCCAGGCTGGAGG + Intergenic
1151909585 17:77073248-77073270 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1152505336 17:80746127-80746149 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1152742100 17:82022904-82022926 GCTCCGGTCTCATTGGCTGGAGG - Exonic
1152787882 17:82260903-82260925 CCTGCTGTCACCCAGGCTGGAGG + Intronic
1153007224 18:508174-508196 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1153321877 18:3781382-3781404 GCTCCTGTTGCCCAGGCTGGAGG + Intronic
1155189418 18:23416176-23416198 GCTCTTATCACACAAGCTGGAGG - Intronic
1155232534 18:23787247-23787269 ACTCTTGTCACCCAGGCTGGAGG - Intronic
1155534695 18:26805176-26805198 TCTCAGGTCACACCGGCTAGAGG + Intergenic
1155956219 18:31959159-31959181 ACTCTTGTCACTCAGGCTGGAGG + Intergenic
1156266704 18:35495379-35495401 TCTTCTGTCACCCAGGCTGGAGG - Intronic
1156652100 18:39236609-39236631 GCTCTTGTCACCCAGGCTGAAGG + Intergenic
1157583142 18:48784874-48784896 ACTCCTCTCACACATGCTGGAGG + Intronic
1158714527 18:59866325-59866347 GCTCTTGTCACCCACGCTGGAGG + Intergenic
1160188490 18:76695314-76695336 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1160590560 18:79942334-79942356 GCCCAGGTCACACTGGCTGGAGG + Intronic
1160709023 19:542280-542302 GCCCCTGTCCCGCAGGCTGGGGG - Intergenic
1161110029 19:2463923-2463945 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1162277894 19:9672810-9672832 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1162445623 19:10720695-10720717 GGTTCTGTCACCCAGGCTGGAGG - Intronic
1163145235 19:15375094-15375116 CCTCCTGAAACACCGGGTGGTGG + Intronic
1163247561 19:16106560-16106582 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1163280069 19:16310646-16310668 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1164070605 19:21764605-21764627 GGTTCTGTCACCCAGGCTGGAGG - Intronic
1164166676 19:22684342-22684364 GCTCCTGTCACCCAGCCTGGAGG + Intergenic
1165054524 19:33165866-33165888 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1165495110 19:36148044-36148066 GCTCTTGTCACCCAGGTTGGAGG - Intronic
1165507418 19:36243064-36243086 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
1166641995 19:44501115-44501137 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1166754045 19:45179617-45179639 GCTCCTGCAACTTCGGCTGGCGG + Exonic
1166819309 19:45567305-45567327 CCCCCTGTCACCCAGGCTGGAGG - Intronic
1167481571 19:49735158-49735180 CATTCTGTCACACAGGCTGGAGG - Intergenic
1167735985 19:51294791-51294813 GCTCCTGTCAGCCTGGCTGCTGG - Intergenic
1167750055 19:51373966-51373988 ACTCTTGTCACTCAGGCTGGAGG + Intergenic
1168367122 19:55798027-55798049 GCCCTTGTCACCCAGGCTGGTGG + Intronic
1168645607 19:58057107-58057129 GCTCCTGTGACAAGGGCTGGAGG - Intergenic
1202690530 1_KI270712v1_random:85904-85926 GCTCTTTTCACCCAGGCTGGAGG + Intergenic
925171778 2:1754583-1754605 GCTCCTGCCATGCTGGCTGGTGG + Intergenic
926346216 2:11948197-11948219 GCTCTTGTCGCCCTGGCTGGAGG + Intergenic
927387318 2:22549970-22549992 GCTCTTGTCACCTAGGCTGGAGG - Intergenic
927508149 2:23627938-23627960 GCTCTTGTCACCCAGGCTGGAGG + Intronic
927692243 2:25216261-25216283 GCGCCGGGCACTCCGGCTGGCGG - Intergenic
927703942 2:25285701-25285723 GGTCCTGACACACAGGATGGAGG - Intronic
930106266 2:47642404-47642426 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
931375199 2:61701010-61701032 GCTCTTGTCACCCAGGATGGAGG + Intergenic
932274832 2:70443920-70443942 GCTTCTTTCACAAGGGCTGGTGG + Intergenic
932467131 2:71931156-71931178 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
933955884 2:87370100-87370122 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
934240037 2:90262135-90262157 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
934273154 2:91554619-91554641 GCTCTTTTCACCCAGGCTGGAGG + Intergenic
934324123 2:91994713-91994735 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
934791175 2:97061724-97061746 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
934815268 2:97320806-97320828 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
934822427 2:97387677-97387699 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
937581375 2:123493088-123493110 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
937682995 2:124664717-124664739 GCTCTTATCACCCAGGCTGGAGG + Intronic
938606309 2:132896100-132896122 ACTCTTGTCACCCAGGCTGGAGG - Intronic
938858361 2:135340136-135340158 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
940697921 2:157003201-157003223 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
941563213 2:167075672-167075694 GCTCTTGTCACCCAGGCTGGAGG + Intronic
942052940 2:172157457-172157479 GCTCTTGCCACCCAGGCTGGAGG - Intergenic
942472443 2:176275269-176275291 ACTCTTGTCACCCAGGCTGGAGG + Intronic
942893355 2:181018994-181019016 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
943629782 2:190238495-190238517 GCTCTTGTCACCCAGGCTGGAGG + Intronic
944542437 2:200766732-200766754 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
946442201 2:219706316-219706338 ACTCCTGTCACCCAGGCTGGAGG + Intergenic
947729760 2:232421240-232421262 GCTCCTTTCCAACCGGTTGGTGG - Intergenic
947737826 2:232466162-232466184 GCTTTTGTCACCCAGGCTGGAGG - Intergenic
1168856913 20:1015007-1015029 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1171999345 20:31760414-31760436 GGTTCTGTCACCCAGGCTGGTGG + Intronic
1172529481 20:35619997-35620019 GCTCTTGTCACCCAGGCTGCTGG + Intronic
1173517366 20:43674267-43674289 GCTCTTGTCACCCAGGCTAGAGG + Intronic
1174042046 20:47707020-47707042 GCTCTTGTCACCCAGTCTGGAGG + Intronic
1175417028 20:58808544-58808566 GTTCCTGTCACCCTGGCTGCTGG + Intergenic
1175444698 20:59012036-59012058 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1175986661 20:62767334-62767356 GCTCTTGTCACCCAGGCTAGAGG - Intergenic
1177638410 21:23815559-23815581 ACTCCTGTCACCCCTGCTGCTGG - Intergenic
1177921960 21:27163535-27163557 GATTCTGTCACCCAGGCTGGAGG + Intergenic
1179550715 21:42141849-42141871 GCTCCTGACACGCCAACTGGTGG - Intronic
1179731381 21:43369638-43369660 GCTGCTGTGACACCGACTGCTGG - Intergenic
1180543712 22:16478399-16478421 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
1180857779 22:19059217-19059239 GCTCCTCACACAGCTGCTGGGGG - Intronic
1180913096 22:19466968-19466990 CCTCCTGTCCCACAGGCAGGGGG - Intronic
1182420138 22:30244988-30245010 GGTCATGGCACACCGGATGGGGG + Intronic
1182545362 22:31072493-31072515 CCTCTTGTCACCCAGGCTGGAGG + Intronic
1182888862 22:33799471-33799493 GCTCTTGTTGCACAGGCTGGAGG + Intronic
1183531396 22:38355623-38355645 TCTCTTGTCACCCAGGCTGGAGG + Intronic
1183574224 22:38676913-38676935 TGCCCTGTCACACAGGCTGGAGG - Intergenic
1184061983 22:42088686-42088708 GCTCTTGTCTCCCAGGCTGGAGG - Intronic
1184246078 22:43236415-43236437 GCTGCTGTCACTCAGGCTCGTGG - Intronic
1184496922 22:44847402-44847424 GCTACTGCCACAGGGGCTGGTGG - Intronic
1184558659 22:45248266-45248288 GCTCTTGTCACTGAGGCTGGAGG + Intergenic
1184566712 22:45296417-45296439 GTTCTTGTCACCCAGGCTGGAGG - Intergenic
1184584779 22:45440528-45440550 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1184830689 22:46984332-46984354 GGTTCTGTCGCCCCGGCTGGAGG - Intronic
1185292748 22:50035342-50035364 GTTCCATTCACACCTGCTGGGGG + Intronic
951142326 3:19178650-19178672 GCTCCAGTAAAACCTGCTGGAGG - Intronic
952485668 3:33807394-33807416 GCTCCTGTCACCCTGGCCAGTGG + Intronic
953528433 3:43715191-43715213 GCTCTTGTCACCCAGGCTGGAGG + Intronic
953531206 3:43741212-43741234 GCTCCAGTCACAGCAGCTTGGGG - Intergenic
953721547 3:45360233-45360255 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
953993961 3:47505231-47505253 ACTCTTGTCACCCAGGCTGGAGG - Intronic
954368012 3:50156283-50156305 CCTCCTGTCCCATCTGCTGGGGG - Intronic
955812623 3:62807292-62807314 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
958192910 3:90205607-90205629 GCCTCTGTCACCCAGGCTGGAGG - Intergenic
958790740 3:98648245-98648267 GCTCATGTCGCCCAGGCTGGAGG + Intergenic
961225768 3:125244528-125244550 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
961708129 3:128805683-128805705 GCTCTTATCACCCAGGCTGGAGG + Intronic
962066538 3:131987417-131987439 GCTCTTGTCACACAGGCTGCAGG + Intronic
962086996 3:132201711-132201733 GCACCTGTCACATAGTCTGGTGG - Intronic
962906548 3:139808731-139808753 GGCTCTGTCACACAGGCTGGAGG - Intergenic
963757771 3:149253706-149253728 GCTCTTGTTACTCAGGCTGGAGG + Intergenic
963986232 3:151597882-151597904 GCTCCTGTCACCCAGGCTGGAGG - Intergenic
964749279 3:160039648-160039670 GCTCCTGTCACCCCAATTGGAGG + Intergenic
966379033 3:179325052-179325074 ACTCCTGTTACCCAGGCTGGAGG + Exonic
966537481 3:181050896-181050918 GCTCCTCTCCCAGCAGCTGGAGG + Intergenic
966747703 3:183294382-183294404 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
967322262 3:188206235-188206257 GCTCTTGGCGCACCTGCTGGAGG + Intronic
967349163 3:188492661-188492683 GCTTTTGTCACCCAGGCTGGAGG - Intronic
967500795 3:190195183-190195205 TCTCTTGTCACCCAGGCTGGAGG + Intergenic
968017324 3:195349447-195349469 GCTCCTGTTGCTCAGGCTGGAGG - Intronic
968529703 4:1084934-1084956 ACGCCAGTCACACTGGCTGGTGG - Intronic
969293032 4:6252732-6252754 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
969612732 4:8236259-8236281 GGTCCTGCCACACAGGCAGGTGG - Exonic
970845878 4:20536523-20536545 ACTCTTGTCACCCAGGCTGGAGG - Intronic
971208049 4:24589126-24589148 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
971367975 4:25992907-25992929 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
971592056 4:28480904-28480926 GCTCTTGTCTCCCAGGCTGGAGG + Intergenic
972351551 4:38241162-38241184 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
972478693 4:39477494-39477516 GCTCTTGTCACCCAGGCTGGAGG - Exonic
972618685 4:40724613-40724635 GCCCTTGTCACCCAGGCTGGAGG - Intergenic
972690703 4:41395263-41395285 GCTCTTGTCACCCAGTCTGGAGG + Intronic
973640007 4:52893330-52893352 GCTCCTGTAATTCCGGCTGCTGG - Intronic
978550745 4:109923651-109923673 ACTCTTGTCACCCAGGCTGGAGG + Intronic
982005568 4:151059901-151059923 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
982503954 4:156194966-156194988 GCTCTTGTTACCCAGGCTGGAGG - Intergenic
984348712 4:178565033-178565055 GCTCTTGTCACCCAGGCTGCAGG + Intergenic
984394981 4:179185856-179185878 GCTCTTGTCATCCAGGCTGGAGG - Intergenic
984982127 4:185292429-185292451 GCTCTTGTCACCCGGGCTGGAGG + Intronic
985103624 4:186481712-186481734 GGCCCTGTCACCCAGGCTGGAGG + Intronic
985229780 4:187802225-187802247 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
985576544 5:675866-675888 CCTCCTCTCACACCGGCCAGTGG + Intronic
987194124 5:15508008-15508030 GCTCTTGTCACCCAGGTTGGAGG - Intronic
987896837 5:23957364-23957386 GCACCTGTCACTCCAGCTGCTGG + Intronic
988488705 5:31689099-31689121 GCTCTTGTCACTCAGGCTGGAGG + Intronic
988530813 5:32025632-32025654 ACTCTTGTCACCCAGGCTGGAGG + Intronic
989650311 5:43681429-43681451 ACTCTTGTCACCCAGGCTGGAGG + Intronic
991332265 5:65504422-65504444 GCTCTTGTCTCCCAGGCTGGAGG - Intergenic
991576750 5:68112527-68112549 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
992777244 5:80099108-80099130 GCAGCTGTCACTCCTGCTGGAGG + Intergenic
995448437 5:112272746-112272768 GCTCTTGTCACCCAGACTGGAGG - Intronic
996077685 5:119216063-119216085 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
996234002 5:121105010-121105032 GCTGGTGTCACCCAGGCTGGAGG - Intergenic
997382426 5:133447185-133447207 CCGGCTGTCACACAGGCTGGTGG - Intronic
997552931 5:134769571-134769593 GCTCTTGTCTCCCAGGCTGGTGG + Intronic
997713273 5:136023819-136023841 GCTGATGTCAGACTGGCTGGAGG + Intergenic
998142919 5:139709956-139709978 GCACCTGACCCACCGGATGGCGG - Intergenic
1000802275 5:165743199-165743221 TCACCTGTCACACAGGCTGGAGG + Intergenic
1002161536 5:177316821-177316843 GCTCTTGTCCCCCAGGCTGGAGG + Intergenic
1002169044 5:177365223-177365245 GCTCTTGTCACCCGGGCTGGAGG + Intronic
1002707997 5:181175860-181175882 GCTCTTGTCACCCAGGTTGGAGG - Intergenic
1003174448 6:3744728-3744750 GCTCTTGTCACCCAGGCTGGAGG + Intronic
1004212247 6:13660503-13660525 ACTCTTGTCACTCAGGCTGGAGG + Intronic
1004379752 6:15122586-15122608 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1005071315 6:21865002-21865024 CCTTCTGTCACCCAGGCTGGAGG + Intergenic
1005578755 6:27213783-27213805 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1006814483 6:36840678-36840700 GCTCCTGCCACCCAGTCTGGTGG + Intergenic
1007274426 6:40662909-40662931 GCTCCTGTCAGACTGGGAGGGGG + Intergenic
1007329255 6:41091560-41091582 GCTCCTGCCAAACTGGCTGCTGG - Exonic
1007454077 6:41962714-41962736 ACTCTTGTCACGCAGGCTGGCGG - Intronic
1007612140 6:43156862-43156884 GCTCTTGTCACCCACGCTGGAGG - Intronic
1008744474 6:54652435-54652457 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1012534153 6:100275592-100275614 CCTCCTGTCAGATCAGCTGGAGG - Intergenic
1016751994 6:147640462-147640484 GCTCTTGTCACCCAGGCTGGAGG - Intronic
1017908357 6:158772099-158772121 GCTCCTGCCACACCAGCTACAGG + Intronic
1018406732 6:163493162-163493184 GCTCTTGTCACTCAGGCTGGAGG + Intronic
1019584446 7:1790089-1790111 GCTCTTGTCACCCAGGCTGGAGG - Intergenic
1019827477 7:3296459-3296481 TCACCTGTCACCCAGGCTGGAGG - Intergenic
1020090824 7:5339595-5339617 GCTCTTGTCACCCAGGATGGAGG + Intronic
1020227753 7:6293624-6293646 GCTCTTGTCGCCCAGGCTGGAGG + Intergenic
1020306208 7:6837021-6837043 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1020797483 7:12693944-12693966 GCTCTTGTCACCCAGGCTAGAGG - Intergenic
1021380692 7:19962412-19962434 GCTCTTGTCATCCAGGCTGGAGG + Intergenic
1022983278 7:35624810-35624832 GCTCCAGTCACAGCTCCTGGGGG + Intergenic
1023267074 7:38417877-38417899 GCTGCTGTCACACCTGCCGTTGG - Exonic
1024167323 7:46747784-46747806 ACTCTTGTCACTCAGGCTGGAGG - Intronic
1024212774 7:47219728-47219750 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1025209214 7:57011242-57011264 CGTTCTGTCACCCCGGCTGGAGG - Intergenic
1025662732 7:63565613-63565635 CGTTCTGTCACCCCGGCTGGAGG + Intergenic
1027011471 7:74748876-74748898 GCTCTTGTTACCCAGGCTGGAGG - Intronic
1027076569 7:75197166-75197188 GCTCTTGTTACCCAGGCTGGAGG + Intergenic
1027272000 7:76526768-76526790 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1027875784 7:83766636-83766658 GTTCTTGTCACCCAGGCTGGAGG + Intergenic
1028103015 7:86844920-86844942 GCTCTTGTCACCCAGGCTAGAGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029445580 7:100610825-100610847 TGTGCTGTCACACAGGCTGGAGG - Intergenic
1029446484 7:100615729-100615751 ACTCCTGTCCCACCATCTGGAGG + Intergenic
1029933719 7:104400069-104400091 GATCTTGTCACCCAGGCTGGAGG - Intronic
1031000074 7:116405009-116405031 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1032024842 7:128432958-128432980 ACTCCTGTCACCCAGGCTGAAGG + Intergenic
1032168955 7:129568211-129568233 GCTCTTGTCACCCAGGCCGGAGG - Intergenic
1032197932 7:129799929-129799951 AGTCCTGGCACCCCGGCTGGTGG - Intergenic
1034536407 7:151728430-151728452 GGTCCTGTCTCACAGGATGGGGG + Intronic
1034631342 7:152532789-152532811 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1035339790 7:158152861-158152883 GCTCTTGTCCCACTGGTTGGTGG - Intronic
1035339806 7:158152965-158152987 GCTCTTGTCCCACTGGTTGGTGG - Intronic
1035715290 8:1749458-1749480 GTTCCTGCCACAGAGGCTGGTGG - Intergenic
1036598907 8:10240871-10240893 GATCCTGTAAAACCAGCTGGGGG - Intronic
1037012821 8:13866057-13866079 GCCGTTGTCACACAGGCTGGAGG + Intergenic
1037449906 8:19006259-19006281 GCTCTTGTCACCCAGGCCGGGGG - Intronic
1037686142 8:21141208-21141230 GCTCCTATCACCCAGGCTGGAGG - Intergenic
1037968077 8:23149268-23149290 ACTCTTGTCACCCAGGCTGGAGG + Intronic
1038008063 8:23451052-23451074 GCTCTTGTCGCCCAGGCTGGTGG + Intronic
1038434156 8:27522926-27522948 ACTCTTGTCACCCAGGCTGGAGG - Intronic
1038858145 8:31355692-31355714 ACTCTTGTCACCCAGGCTGGAGG - Intergenic
1038920419 8:32077331-32077353 GCTCTTGTCGCCCAGGCTGGAGG - Intronic
1039321263 8:36434679-36434701 ACTCCTGTCACCCAGGCTGGAGG + Intergenic
1039955392 8:42203279-42203301 GCTCCTGACACACGCACTGGTGG - Intronic
1041089824 8:54291681-54291703 GCTCTTGTCTCCCAGGCTGGAGG - Intergenic
1042533163 8:69834535-69834557 GCTCCTCACGCAGCGGCTGGTGG - Intronic
1044090725 8:87996760-87996782 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1044584527 8:93857262-93857284 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1045298182 8:100890366-100890388 GCTCTTGTCATCCAGGCTGGAGG + Intergenic
1045609957 8:103827803-103827825 GCTCTTGTCACCCAGGCTGGTGG - Intronic
1047778618 8:128093522-128093544 GCTCTTGTCCCCCAGGCTGGAGG - Intergenic
1048045031 8:130765147-130765169 GCTCCTGTCCCACCTGCTTCAGG + Intergenic
1048104921 8:131397375-131397397 GCTCTTGTCGCCCAGGCTGGAGG - Intergenic
1048446351 8:134496364-134496386 GCTCATGTCACAGTGGATGGAGG - Intronic
1049301563 8:141873310-141873332 GCTCCTGTCACTTCTGCTTGTGG + Intergenic
1049721606 8:144118588-144118610 GCTCTTGTCACCTAGGCTGGAGG - Intergenic
1049853464 8:144847149-144847171 GCCCCTGGCACACAGGCTGGTGG + Intronic
1050558617 9:6810836-6810858 GCTCTTGTCACCCAGGCTCGGGG - Intronic
1052194102 9:25691549-25691571 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1052854614 9:33399469-33399491 GCACCTGTAATACCAGCTGGGGG + Intronic
1052930543 9:34051945-34051967 GCGCTTGTCACCCAGGCTGGAGG - Intergenic
1053525715 9:38828331-38828353 CCTTCTGTCACCCAGGCTGGAGG - Intergenic
1053693005 9:40606048-40606070 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
1054197948 9:62052766-62052788 CCTTCTGTCACCCAGGCTGGAGG - Intergenic
1054271830 9:63034042-63034064 GCTCTTTTCACCCAGGCTGGAGG + Intergenic
1054304246 9:63405279-63405301 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
1054402990 9:64729292-64729314 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
1054436613 9:65214782-65214804 GCTCTTTTCACCCAGGCTGGAGG - Intergenic
1054493785 9:65807212-65807234 GCTCTTTTCACCCAGGCTGGAGG + Intergenic
1054640408 9:67535605-67535627 CCTTCTGTCACCCAGGCTGGAGG + Intergenic
1055441197 9:76338247-76338269 GCACCTCTCACACCGGCCAGTGG - Exonic
1055533702 9:77214241-77214263 CCCCCTGTCACCCAGGCTGGAGG - Intronic
1056212748 9:84380339-84380361 GCTCCGGTCACCCAGGCTGGAGG - Intergenic
1056309105 9:85321557-85321579 CCTCATGTCACCCAGGCTGGGGG + Intergenic
1057034281 9:91800307-91800329 GCTCTTGTCACCCAGGCTAGAGG - Intronic
1058584134 9:106488363-106488385 GCTCCTCTCAAACAGGCTGCGGG + Intergenic
1058919185 9:109597048-109597070 TGTTCTGTCACACAGGCTGGAGG - Intergenic
1060361844 9:122966488-122966510 ACTCTTGTCACCCAGGCTGGGGG - Intronic
1060634432 9:125189245-125189267 GCTCCTGTCACCTCCGGTGGAGG + Intronic
1060983492 9:127807057-127807079 GCGCCTCTACCACCGGCTGGAGG + Exonic
1061931365 9:133834716-133834738 GCTCCTCGCACACCTCCTGGTGG + Intronic
1185473835 X:401361-401383 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1187155575 X:16717916-16717938 GCTCTTGTCATCCAGGCTGGAGG + Intergenic
1187890900 X:23933996-23934018 CATCCTGTCACCCAGGCTGGAGG - Intronic
1188688581 X:33100656-33100678 GCTCTTGTCACCCAGGCTAGAGG - Intronic
1188695045 X:33179872-33179894 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1189562881 X:42209037-42209059 GCTCCTGTCACTGTGGCTGGTGG - Intergenic
1190543328 X:51499701-51499723 GCTCCTGTTACCCAGGCTGGAGG - Intergenic
1192392274 X:70742693-70742715 GGTCTTGTCACCCAGGCTGGAGG - Intronic
1192994654 X:76500244-76500266 GCTCTTGTCACCCAGGCTGGAGG + Intergenic
1196412341 X:115433524-115433546 GCTCTTGTCCCCCAGGCTGGAGG + Intergenic
1196908705 X:120464782-120464804 GCTCTTGTCCCCCAGGCTGGAGG + Intronic
1198861379 X:141074325-141074347 GCTCCTGTTGCCCAGGCTGGAGG - Intergenic
1198901313 X:141513057-141513079 GCTCCTGTTGCCCAGGCTGGAGG + Intergenic
1200274893 X:154722909-154722931 GCTCTTGTCGCCCAGGCTGGAGG + Intronic
1200425626 Y:3017619-3017641 ACTCTTGTCACCCAGGCTGGAGG + Intergenic
1200754109 Y:6973665-6973687 GCTACTGTCACAAAGGCTGGTGG - Intronic
1201097334 Y:10631349-10631371 GACTCTGTCACACAGGCTGGAGG + Intergenic
1201098187 Y:10649781-10649803 GACTCTGTCACACAGGCTGGAGG + Intergenic