ID: 1112093174

View in Genome Browser
Species Human (GRCh38)
Location 13:96104666-96104688
Sequence CAGGCCCTGGGGCAGTTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 317}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112093174_1112093182 29 Left 1112093174 13:96104666-96104688 CCAGACAACTGCCCCAGGGCCTG 0: 1
1: 0
2: 4
3: 32
4: 317
Right 1112093182 13:96104718-96104740 ACCTGCTTACCCTGTCTCACTGG 0: 1
1: 0
2: 1
3: 19
4: 162
1112093174_1112093179 -4 Left 1112093174 13:96104666-96104688 CCAGACAACTGCCCCAGGGCCTG 0: 1
1: 0
2: 4
3: 32
4: 317
Right 1112093179 13:96104685-96104707 CCTGCTGAAATGATTCAAACTGG 0: 1
1: 0
2: 9
3: 24
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112093174 Original CRISPR CAGGCCCTGGGGCAGTTGTC TGG (reversed) Intronic
900172282 1:1274800-1274822 CAGGCCGTGGGGCAGAAGCCAGG + Intergenic
900415755 1:2533846-2533868 CAGGACCTGGGGGAGTTATTTGG + Intergenic
900468079 1:2835479-2835501 CAGGTCCTGGGACACTTGCCTGG + Intergenic
901140407 1:7025563-7025585 CAGGCACTGGGCCAGATGCCGGG + Intronic
901228963 1:7631346-7631368 AGAGCCCTGGGGCAGTGGTCTGG + Intronic
901239053 1:7682346-7682368 CTGGCCCTGGGGTAGGTGTCTGG + Intronic
902150442 1:14438546-14438568 AAGGCCCTGGGGCAGGAGTGTGG + Intergenic
902232625 1:15037288-15037310 CTGGCCCTGGGGCAGAAGACAGG + Intronic
902235038 1:15051732-15051754 CAGGCCCTGGCACAGTTCTTTGG - Intronic
902235650 1:15055765-15055787 CAGGCCCTGGCACAGTTCTTTGG + Intronic
904398685 1:30241277-30241299 CACTCCCTGGGGCTGTTGCCTGG + Intergenic
904448633 1:30596753-30596775 AAGGCCCTGGGGCAGTAATGGGG + Intergenic
905262480 1:36729584-36729606 TAGGACCTGGGGCACTTGCCAGG + Intergenic
905931321 1:41789812-41789834 CAGGGCATGGGGCAACTGTCTGG - Intronic
905982340 1:42241209-42241231 CAGACCCTGGTGGAGCTGTCAGG - Intronic
906411851 1:45584736-45584758 CCGGCCCTGGGGCAGGGGGCGGG + Intronic
906743493 1:48205639-48205661 CAGGCCCTGGGCCACGTGCCAGG + Intergenic
907249375 1:53127953-53127975 CAGTCCCTGGGCCAGCAGTCTGG - Intronic
907996765 1:59640863-59640885 CAGGCCCTGTTACAGTTGTTGGG + Intronic
908051759 1:60240453-60240475 CACACACTGGGGCAGTTGTGGGG - Intergenic
912079295 1:105914541-105914563 CAGGCCCTGTGGCAGTGTCCAGG - Intergenic
912570293 1:110616329-110616351 CAGGGGCCGTGGCAGTTGTCAGG + Intronic
915108788 1:153549972-153549994 CAGACCCTGGGTCAGGAGTCAGG + Intronic
916371981 1:164108547-164108569 CTGGCCCTGGCTTAGTTGTCTGG + Intergenic
917412214 1:174770865-174770887 CAGTCCCTGGGTTAGATGTCAGG + Intronic
917721750 1:177792494-177792516 CGGCCCTTGGGGCAGTTGGCTGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919577596 1:199331059-199331081 TAGGCCCTGGGGGAGGTGTTTGG - Intergenic
919826685 1:201507930-201507952 CTGCCCCTGGGGCAGTTTCCAGG + Intronic
920245445 1:204584423-204584445 CAGGCACTGGGCCAGGTGCCAGG + Intergenic
922798175 1:228351736-228351758 CAGGGCATGGGGCAGTGGTGTGG - Intronic
923133002 1:231093567-231093589 CAGGCCCTGGTTGAGTTGTGTGG - Intergenic
923474740 1:234321810-234321832 CAGTCCCTTGAGCAGATGTCGGG - Intronic
923730810 1:236547761-236547783 CAGGCCCTGGGGATGGTGTGAGG + Intronic
924726884 1:246679382-246679404 CAGACGCTGGGGCCGTTGTCAGG + Intergenic
924741173 1:246795006-246795028 CAGGCCCTGAGGCCGTAGTTAGG + Intergenic
1063093691 10:2890486-2890508 CAGGCCCTGGATCCGCTGTCAGG - Intergenic
1067016181 10:42757648-42757670 TAGGCCCTTGGGCATTTGTGTGG + Intergenic
1067066638 10:43107477-43107499 CATGCTCTGGGGGAGCTGTCTGG + Intronic
1067153154 10:43753051-43753073 CAGTCCCTGGGGTAGTTGAGTGG - Intergenic
1067166387 10:43869301-43869323 CAGGCCCTGGAGGGGCTGTCTGG + Intergenic
1067570546 10:47368249-47368271 GATGCCCTGGGGGAGCTGTCTGG - Exonic
1067877357 10:50018313-50018335 CAGGGCCTGGGGCCCCTGTCTGG + Intergenic
1069791194 10:71022211-71022233 CCTCCCCTGGGGCAGTTGCCAGG - Intergenic
1069894918 10:71674492-71674514 CCAGCTCTGGGGCAGTGGTCTGG + Intronic
1071267419 10:83976465-83976487 CCTCCCCTGGGGCAGTTGTCAGG - Intergenic
1071444235 10:85731064-85731086 CAGACCCTGCTGCAGATGTCAGG - Intronic
1072034507 10:91552019-91552041 CAGGCTCTTGGGCAGTAGTGTGG + Intergenic
1072250618 10:93579377-93579399 AAGGCCCTGGGGCAGCAGTATGG - Intronic
1073464472 10:103686296-103686318 AGGGCCCTGGGGCTGTTGTCAGG - Intronic
1074533125 10:114310585-114310607 CAGGCCTTGGGGCTGGGGTCGGG - Intronic
1075857946 10:125646855-125646877 CTGGACCTGGGGCTGTTTTCGGG - Intronic
1075975000 10:126687154-126687176 CAGCCCCTCTGGCAGCTGTCTGG + Intergenic
1076300830 10:129425045-129425067 CCGGCCCTGGGGAAGCTCTCTGG + Intergenic
1076404737 10:130204077-130204099 CAGGCCCAGGGGAAGTCCTCGGG - Intergenic
1076630391 10:131848818-131848840 CGGCCCCTGGGGGAGTTGTGCGG + Intergenic
1076884836 10:133257562-133257584 CAGGCCCTGGGGCAGAGGAGGGG - Intergenic
1077121126 11:909081-909103 ATCTCCCTGGGGCAGTTGTCTGG - Intronic
1077174173 11:1181195-1181217 CAGCCCCTGGGGCTGGGGTCCGG + Intronic
1077650763 11:3969966-3969988 CAGGCCCTGGGACAGTGATCAGG - Intronic
1078635179 11:13043026-13043048 TAGGCTCTAGAGCAGTTGTCAGG + Intergenic
1081786932 11:45754273-45754295 CAGGCCCTGGGAGGGGTGTCTGG + Intergenic
1081809083 11:45905300-45905322 CAGGCCCTGGGGCTGCTTCCTGG + Intronic
1082011517 11:47452890-47452912 CAGGCTCTGGGACAGGTGGCTGG + Intergenic
1082880005 11:58028055-58028077 CAGGCCCTGGGGCAGATGGTGGG + Intronic
1083169224 11:60912929-60912951 CAGGCCCCGGGGCAGTGTCCAGG + Intergenic
1083367675 11:62151314-62151336 CAGGCCCTGGTGCAGTGCTGAGG - Intronic
1083487161 11:62990489-62990511 CAGGCTCTGGGGCAGTTGAGGGG + Intronic
1085391044 11:76182377-76182399 CAGGCCCTGCAACAGATGTCAGG + Intergenic
1085753045 11:79178636-79178658 CAGGTCCTGGGGCCCTTGACAGG + Intronic
1086193053 11:84103312-84103334 CAGGCTCTGGGACAATTGTCAGG - Intronic
1089255596 11:117192381-117192403 CAGGGCCTGGGGGAGGGGTCTGG + Intronic
1090075106 11:123575695-123575717 CAGGCCGTGGGGCTGGTGGCAGG - Intronic
1091291709 11:134444021-134444043 GAGGGCCTGGGGCAGTGGCCAGG + Intergenic
1092929074 12:13298172-13298194 GAAGCCCAGGGGCACTTGTCAGG + Intergenic
1093764109 12:22942780-22942802 CAGGTCCTTGGGCAGTTTCCTGG + Intergenic
1098826602 12:75305586-75305608 CGGGGCCTGGGGCAGTGGTCGGG - Intronic
1102164433 12:110795157-110795179 CATTCTCTGGGGCAGTTGCCAGG + Intergenic
1102255136 12:111410683-111410705 CAGGCCACGGGGCAGCTGGCTGG - Intronic
1103974683 12:124694822-124694844 CAGGCCCTTGGGGAGTTTACTGG + Intergenic
1104285198 12:127418553-127418575 CAGGCCCTGGGGCAGCACCCAGG - Intergenic
1104948311 12:132427330-132427352 CAGGGCCTGGGGCGGGTGGCCGG + Intergenic
1106200904 13:27536583-27536605 CAGGCCCTGGAGGAGCTCTCAGG + Intergenic
1110412910 13:75223014-75223036 CAGGCTCTGGGGAAGAAGTCTGG - Intergenic
1112093174 13:96104666-96104688 CAGGCCCTGGGGCAGTTGTCTGG - Intronic
1112250259 13:97772705-97772727 CATCCCCTGAGGCAGTTGCCAGG - Intergenic
1113556832 13:111242728-111242750 GAGGACCTGGGGCCGCTGTCTGG + Intronic
1113604825 13:111597756-111597778 CTGGGCCTCGAGCAGTTGTCTGG + Intronic
1114069279 14:19095145-19095167 CAGGCCCTTGGGCATTTTTGTGG - Intergenic
1114092982 14:19304857-19304879 CAGGCCCTTGGGCATTTTTGTGG + Intergenic
1114139444 14:19894213-19894235 CAGACCCTGGGGAAATGGTCAGG + Intergenic
1114615435 14:24065548-24065570 CAGGCTGTGAGGGAGTTGTCAGG - Intronic
1117303377 14:54449900-54449922 CAGGCCCAGGGGCAGCTTTCAGG + Intergenic
1117960046 14:61153727-61153749 CAGCCCCCGAGGCTGTTGTCAGG - Intergenic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1120347696 14:83310850-83310872 CAGGCACTGGGTCAGATGTTGGG - Intergenic
1120444359 14:84575825-84575847 CAGGCTCTAGGGCAGCTGTCTGG + Intergenic
1121446279 14:93981184-93981206 CAGGACTTGGGGCCTTTGTCTGG - Intergenic
1121510601 14:94510059-94510081 CAGGGCCTGGGCCTGTGGTCTGG + Intronic
1121781728 14:96626329-96626351 CAGGCACTGTGCCAGGTGTCAGG + Intergenic
1122037043 14:98956466-98956488 CTGCCCCTGGGGCAGGAGTCGGG + Intergenic
1122037584 14:98960168-98960190 CAGGTCCTGGGGCAGGAGTGGGG - Intergenic
1122124165 14:99570302-99570324 CAGGCCCTGGGGCCCTGGACAGG + Intronic
1122805020 14:104252218-104252240 CAGGCCCCAGGGCAGCTGTTTGG - Intergenic
1122974712 14:105166354-105166376 CAGGCCCAGGTGCAGATGACAGG + Intronic
1123113820 14:105884947-105884969 CAGGCCCTGGTCCAGGCGTCTGG + Intergenic
1123116047 14:105894582-105894604 CAGGCCCTGGTCCAGGCGTCTGG + Intergenic
1123120289 14:105913296-105913318 CAGGCCCTGGTCCAGGCGTCTGG + Intergenic
1123986719 15:25652827-25652849 CAGAGCCTGGAGCAGCTGTCTGG + Intergenic
1124626470 15:31310325-31310347 TAGGCCATGGGGCTGTTCTCAGG - Intergenic
1124648436 15:31456991-31457013 GAGGCCCTGTGGCTGGTGTCTGG + Intergenic
1124685114 15:31776150-31776172 CCTGGCCTGGGGCAGCTGTCAGG - Intronic
1126080607 15:44957501-44957523 CAGGCCCTGGCGCAGGTATGAGG - Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1127328883 15:57919908-57919930 CAGGCCCTGAGCCAGATGTTGGG + Intergenic
1128451884 15:67810677-67810699 CAGGCCCTGGGCCAGGTGCTGGG - Intergenic
1128558029 15:68645029-68645051 CAGGCCCTGGGTCCCCTGTCAGG - Intronic
1128688667 15:69706675-69706697 CTGTCCCTAGGGCAGTTGGCTGG + Intergenic
1129065913 15:72903718-72903740 CAGGCCCTGAATCAGATGTCAGG - Intergenic
1129774923 15:78230278-78230300 CAGTGACTGGGGCAGGTGTCCGG - Intronic
1130062629 15:80580768-80580790 CATGCCCTGAGGCAGCTGGCAGG + Intronic
1131181231 15:90241429-90241451 CAGGCGCTGGGGGAGCTGGCGGG - Exonic
1131873036 15:96780051-96780073 CAGGACAGGGGCCAGTTGTCAGG + Intergenic
1132233536 15:100202029-100202051 CACGCCCTGGAGAAGTTGCCTGG + Intronic
1132292733 15:100714585-100714607 CTGACCCTGGGGCAGATGCCAGG - Intergenic
1132479384 16:159579-159601 CAGGCCCTGGGGCCTGAGTCCGG + Intronic
1132698095 16:1210790-1210812 GTGGCCCTGGGGCTGCTGTCCGG + Exonic
1133382835 16:5345507-5345529 CAAGCCCTGGGGCACTGGTGTGG + Intergenic
1134042126 16:11076771-11076793 CAGACTCTGGGGCAATTGGCAGG - Intronic
1134664598 16:16009715-16009737 CAGGCCCTGGGGGAGGTTCCAGG + Intronic
1135397398 16:22141729-22141751 CTGGCCCTGGGGGAGCTGTAAGG + Intronic
1138451003 16:57093243-57093265 CCGGCCCTCCGGCAGTTGCCTGG - Intronic
1139373296 16:66481390-66481412 CTGGCCCTGGGGTAGGGGTCAGG - Exonic
1139436269 16:66938271-66938293 CAGGCCCTGGGGCAGGGGTGGGG + Intronic
1141658625 16:85429683-85429705 AAGGCCCTGGGGCAGGTCTGAGG - Intergenic
1142195573 16:88737875-88737897 CAGGCCATGGGGCTGGTCTCAGG - Intronic
1143876152 17:9992175-9992197 CACTCCCTGGGGCTTTTGTCTGG - Intronic
1144756326 17:17682343-17682365 CAGGCCCCGGGGCCGCTGCCCGG - Intronic
1144769809 17:17753171-17753193 CAGCCCCTGGGGCTCCTGTCTGG - Intronic
1145081088 17:19894959-19894981 AAAGCACTGGTGCAGTTGTCTGG - Intergenic
1146006872 17:29166123-29166145 CTGGCCCTGGGGCTGGTGCCAGG - Exonic
1147169399 17:38609258-38609280 CGGTCCATGGGGCTGTTGTCTGG + Intergenic
1147322172 17:39653106-39653128 CAGGCCCAGAGGCTGTTGACAGG + Intronic
1147536033 17:41323878-41323900 CCAGCCTGGGGGCAGTTGTCCGG + Intergenic
1148022486 17:44562597-44562619 CTGGGCCTGGGGCAGGTCTCAGG + Intergenic
1148150936 17:45396172-45396194 CAGGCCCTGGGGCAGGGGTTGGG + Intronic
1148463257 17:47850151-47850173 CAGCCCCTGGGGCAGTTCCCAGG - Intronic
1149017820 17:51929395-51929417 CAGGTCCTGAGGCAGTGTTCGGG - Intronic
1150228947 17:63539385-63539407 CAGGCCCAGGGGAGGGTGTCAGG - Intronic
1150548971 17:66191855-66191877 CAGGCCCTGGGCCCGTTCTCCGG - Exonic
1151729044 17:75900203-75900225 CAGGCCAGGGGGCAGAGGTCAGG - Intronic
1151836821 17:76587237-76587259 CAGGGCCTGGGCCTGTGGTCAGG + Intergenic
1152378854 17:79931855-79931877 CAGCCCCTGGAGCAGTTTCCAGG - Intergenic
1152544919 17:80995595-80995617 CCGGCCCTGGGGCAGGGTTCAGG - Intronic
1152768461 17:82153434-82153456 CAGGCCCTGCGGCTGGTGCCAGG + Intronic
1153800273 18:8662518-8662540 GAGGCCCTGGGGCGGGTGCCTGG + Intergenic
1160010824 18:75106026-75106048 CAGCCCCTGTGGCAGGTGGCAGG - Intergenic
1161014746 19:1978128-1978150 CAGGCCATGGTGCAGTGCTCTGG + Intronic
1161153026 19:2719567-2719589 CAGGCTCTGGGGCAGCGGTGGGG + Intronic
1161234808 19:3192580-3192602 AAGGCCCTGCGGCAGTCGGCGGG + Exonic
1161378391 19:3951511-3951533 CAGGGCCTGGAGCAGGTGTTGGG - Intergenic
1161699523 19:5787243-5787265 CAGGGCCCGGGGGAGTTGTTTGG + Intronic
1161838409 19:6663873-6663895 CAGGCCCTGGGCCGGATGCCGGG + Intronic
1163538736 19:17893935-17893957 AAGGCCATGGGCCCGTTGTCTGG - Exonic
1163618493 19:18343526-18343548 CAGGGCCTGGGGCACTTCTGAGG - Intronic
1163786094 19:19275642-19275664 CTGGCCCTGGGGCAGATGTGGGG + Intergenic
1164097451 19:22024157-22024179 CCTCCCCTGAGGCAGTTGTCAGG - Intergenic
1164624981 19:29721340-29721362 CAGGGGCTGGGGGATTTGTCTGG - Intergenic
1164788698 19:30958152-30958174 CAGGTCCTGGGGCTGAAGTCTGG - Intergenic
1165063723 19:33217487-33217509 CAGGCCCTAGTGCAGATCTCTGG - Intronic
1165379419 19:35467786-35467808 CTGGCCCATGGGCTGTTGTCAGG - Intergenic
1165713117 19:38026149-38026171 CAGGGCCTGGTGAGGTTGTCAGG + Intronic
1167939836 19:52937691-52937713 CAGGGCCTGGGGCAAGTGTGAGG - Intronic
1168646064 19:58059887-58059909 CAGGCTCTGGCGCAGTTCCCCGG + Intronic
925318174 2:2940649-2940671 GAGGGCCTTGGGCACTTGTCAGG + Intergenic
925383112 2:3441945-3441967 CATGTCCATGGGCAGTTGTCAGG + Intronic
925723957 2:6855192-6855214 GAGGCCCTGTGGGAGTTGACTGG + Intronic
926306782 2:11643082-11643104 AGGGACCTGGGGCATTTGTCTGG + Intergenic
926694303 2:15760454-15760476 CAGGGCCATGGGCAGTTTTCAGG + Intergenic
926887261 2:17609685-17609707 AAAGCCCTGGGGAAGCTGTCAGG - Intronic
926910442 2:17847965-17847987 CAGGCTCTGGGTCAGTTGCCTGG - Intergenic
927198028 2:20561318-20561340 CAGGCCCTGAGTCAGCTGTTGGG - Intronic
927210203 2:20634490-20634512 CAGGCCCATGCGCAGTGGTCGGG + Intronic
927215062 2:20663765-20663787 GAGGCCCAGAGGCAGATGTCAGG - Intergenic
927940518 2:27100370-27100392 CAGGCTCTGGGGCAGTCAGCGGG - Exonic
930387068 2:50710239-50710261 AAGGCCCTTTGGCAGTTATCAGG - Intronic
930865931 2:56121804-56121826 GAGGTGCTGGGGCATTTGTCAGG + Intergenic
933878760 2:86646712-86646734 CAAGTCCTGGGGCTGTTTTCAGG + Intronic
935658211 2:105443001-105443023 CAGGACTTGGGGCTGTGGTCAGG + Intergenic
936097636 2:109544813-109544835 CAGAGCCTAGAGCAGTTGTCTGG - Intronic
936155225 2:110042709-110042731 CAGGCCCTGGGGCAGCGCTGAGG - Intergenic
936189456 2:110328704-110328726 CAGGCCCTGGGGCAGCGCTGAGG + Intergenic
937098481 2:119250845-119250867 CAGGCCCTGGTGAGGTTGCCAGG + Intronic
938224596 2:129605065-129605087 CAGCTCCTGGGTCAGTTGTGAGG - Intergenic
938921335 2:135997853-135997875 GAGTCCTTGGGGCAGTTATCAGG - Intergenic
938945367 2:136207543-136207565 CAGGCTGTGGCGCAGATGTCTGG + Intergenic
939182332 2:138818107-138818129 CAGGCCCTGTGTCAGTTGCTGGG - Intergenic
941650889 2:168091465-168091487 CAGGACTTGGGGCAGCTTTCTGG - Intronic
941756164 2:169188473-169188495 CAGCCCCTGAGGAAGTTGTGTGG - Intronic
942881568 2:180868227-180868249 CAGGGCCTGTGGCAGCTGGCTGG + Intergenic
943783045 2:191846189-191846211 TAGGCCCCGGGTCATTTGTCAGG - Intronic
946938649 2:224748030-224748052 AAGGGCCTGGGCCAGCTGTCTGG + Intergenic
948709481 2:239817002-239817024 CAGGCCCTGGGAAAGTTGCCTGG - Intergenic
1168930130 20:1615262-1615284 AAGGCCCTGGGGAAAATGTCTGG - Intronic
1169791104 20:9411810-9411832 CAGGCCTTTGGGCAGTGGTCTGG - Intronic
1171100547 20:22379657-22379679 CAGGGCCATGGGCAGTTGCCTGG - Intergenic
1171970686 20:31563172-31563194 CAGGCCTTGGGGCAGGGTTCAGG - Intronic
1173617736 20:44413883-44413905 CAGGCCCTGGAGCAGCTGACGGG + Intronic
1173648040 20:44645920-44645942 CAGGCCCCTGAGCAGTTGTGGGG - Intronic
1175034681 20:55988787-55988809 CAGCCCATGGGGCCGTTGTGGGG - Intergenic
1175606459 20:60315703-60315725 GAGTACCTGGGGCAGGTGTCAGG - Intergenic
1175753715 20:61516147-61516169 CAGGCCCTTGGGCCGTGGGCCGG + Intronic
1176179594 20:63743063-63743085 CAGCCCCTGGGGCTGTCCTCGGG - Exonic
1178481607 21:32984117-32984139 GAGGCCCTGGGGGAGGTGTTTGG - Intergenic
1178850854 21:36210937-36210959 CAGGCCCTGTGGCAGTCGTGTGG - Intronic
1180140959 21:45893137-45893159 CAGGGCCTATGGCAGTTGTGGGG + Intronic
1180145261 21:45915169-45915191 CATGCCCTGGGGCTGCTGTAAGG - Intronic
1180184264 21:46131696-46131718 CAGGGCCTGGGGCCTGTGTCAGG + Intronic
1180232776 21:46437271-46437293 CATGTCCTGGGGCACTTGTGTGG + Intronic
1180487750 22:15817708-15817730 CAGGCCCTTGGGCATTTTTGTGG - Intergenic
1180947983 22:19707386-19707408 CAGACCCTGGGCCAGAGGTCGGG + Intergenic
1180949244 22:19713948-19713970 CAGGCTTTTGGGCAGTGGTCCGG - Intergenic
1180950113 22:19717103-19717125 CAGGCCCTGGTCCTGTTGTGGGG - Intronic
1181045596 22:20212890-20212912 CAGGCCCTGAGGCAGTTTTCAGG + Intergenic
1181087730 22:20450039-20450061 CAGGCCCTGGCGCGGCTGTGTGG + Intronic
1181409671 22:22710216-22710238 CTGGCCCTGGGCCAGCTTTCTGG - Intergenic
1181629464 22:24142999-24143021 CAGGCCCTGGGCCAGCTGTGTGG + Intronic
1181629652 22:24143889-24143911 CAGGCCCTGGGCCAGCTGTGTGG + Intronic
1183108225 22:35629792-35629814 CAGGCGCTGGGGCAGGTTCCAGG + Intronic
1183452501 22:37904799-37904821 CAGGCCCTGGGCCAGTATTCTGG + Intergenic
1183457994 22:37933136-37933158 CAGGCCCCAGGGCAGGTGCCAGG - Intronic
1184232380 22:43165511-43165533 CAGGTGCTGAGGCAGTTGCCGGG - Intergenic
1184652858 22:45927062-45927084 GAGGCCTGGGGGCTGTTGTCCGG - Intronic
1185069180 22:48646945-48646967 CAGTTCCTGGGGGAGTGGTCGGG + Intronic
1185347813 22:50318071-50318093 CAGGCCCTGGAGCTGGTGACCGG + Intronic
949895259 3:8763529-8763551 CTGACCCTGGGGCAGTTCTGAGG - Intronic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
953502779 3:43454165-43454187 AAGGCCCTGAGGCAGTAGCCTGG + Intronic
953589984 3:44242077-44242099 CAGGCCCTGAGGCCGTCGTGGGG - Exonic
953638585 3:44684836-44684858 CAGGCCCTGAGGCTTTTTTCAGG - Intergenic
953888704 3:46734769-46734791 CAAGCCCAGGAGGAGTTGTCTGG - Intronic
953928062 3:46992376-46992398 CAGGACCAGGGGCAGCTGCCAGG - Intronic
954230294 3:49211827-49211849 CAGGCTCTGGGTAAGTTTTCTGG + Exonic
955843167 3:63133225-63133247 CAGGGCATGGGGCTGTTGCCAGG - Intergenic
955936743 3:64109575-64109597 CAAGCCCTGGGGCAGGGGTGGGG + Intronic
956196131 3:66655132-66655154 CAGGCACTGGGGCAGGAGTTGGG + Intergenic
961056692 3:123794609-123794631 CAGGCCCTGGACCAGGAGTCAGG - Intronic
961708402 3:128807710-128807732 CAGGGACTGGGTCAGTGGTCAGG - Intronic
961796194 3:129410840-129410862 CAGGCCCTGTGCCAGGTGCCTGG + Intronic
965299907 3:166996399-166996421 CAGTCTCTGGGGCAGTTGACAGG + Intergenic
965622480 3:170655346-170655368 CTGGCCTTGGGGCAGGTCTCTGG - Intronic
968512275 4:1001001-1001023 CAGGCCCTGGGGCCCTGGCCGGG + Intronic
968683270 4:1936884-1936906 CAGGCCCTGCGCCATTTTTCTGG + Intronic
968921414 4:3524004-3524026 CAGGCCCAGGGGCAGCAGTTGGG + Intronic
969463907 4:7343591-7343613 CAGGCTCTGGGGCAGATGCCTGG + Intronic
971424464 4:26502499-26502521 CAGGCCCTGGGGGAGGTATTTGG + Intergenic
974247551 4:59340077-59340099 CAAACCCTTTGGCAGTTGTCGGG - Intergenic
974877402 4:67716125-67716147 CCAGCCCTGGGGCAGCAGTCGGG + Intergenic
978711906 4:111792867-111792889 CTGGCTCTTGGGCAGTTGTCTGG + Intergenic
983609999 4:169632221-169632243 AAGGCCTTGGGGCAGGAGTCAGG + Intronic
984389755 4:179113830-179113852 CAGGCCCTGGATCAACTGTCAGG + Intergenic
985654926 5:1125897-1125919 CAGGGCCTGGCACTGTTGTCAGG - Intergenic
985709861 5:1422172-1422194 CAGGCCCTGGCAGAGGTGTCAGG + Intronic
985773981 5:1831028-1831050 TCGGCCCTGGGGGGGTTGTCAGG - Intergenic
987148798 5:15018002-15018024 CAGGCCCTGGGCCAGCTTTAGGG - Intergenic
993672883 5:90783641-90783663 CATGACCTAGGGCAGTTGTAGGG - Intronic
996398675 5:123036681-123036703 CAGGCTCTGGGACAGCTGACGGG + Exonic
997613843 5:135232973-135232995 CAGGCCTTGGGGCCCTTGGCAGG + Intronic
1002599388 5:180345684-180345706 CAGGCCCTGGGCCAGGTGCTGGG - Intronic
1002778512 6:348885-348907 CAGGCGGTGGAGCAGTTTTCCGG + Exonic
1002932378 6:1643523-1643545 CAGGGCCTTAGGCAGTTGTGGGG + Intronic
1005039380 6:21587748-21587770 CAGGCCCTGGCGCAAGCGTCCGG - Intergenic
1005137607 6:22588347-22588369 GAGCCCCTGGGGTAGTGGTCAGG - Intergenic
1005423783 6:25679583-25679605 CACTGCCTGGAGCAGTTGTCAGG + Intronic
1005805266 6:29468507-29468529 CAGGCCCTGGGGCTCTTGTTGGG - Intergenic
1005898082 6:30195445-30195467 CAGGCCATGGGGTGGGTGTCAGG - Intronic
1006390664 6:33756386-33756408 AAGGCCCAGGGGCAGGAGTCAGG + Intergenic
1006409025 6:33861612-33861634 CATACCCTGGGGATGTTGTCAGG - Intergenic
1006790654 6:36698982-36699004 CAGGCCGTGGGGGTGCTGTCAGG + Intronic
1007492675 6:42236239-42236261 CAGGCCCTGGGCCAGCCCTCAGG - Exonic
1008215443 6:48782606-48782628 CAGGCACTGTGGCAGTTTCCAGG + Intergenic
1012375568 6:98557947-98557969 CAGGCCCCGGGGCACTGGCCAGG + Intergenic
1015467254 6:133560721-133560743 CCTCCCCTGAGGCAGTTGTCAGG - Intergenic
1015658029 6:135541621-135541643 AAGGCCCTGGGGCAGAAGTGTGG - Intergenic
1017962603 6:159234254-159234276 GAGGCCCTGGGGGAGCTGCCTGG - Exonic
1019017560 6:168890916-168890938 CAGGCCCTGAGGCCGTAGTTGGG - Intergenic
1019115692 6:169760159-169760181 CATGCCCTGGGGTTGTTGTGGGG + Intronic
1019615610 7:1958490-1958512 GACGCCCTGGAGCAGTTCTCAGG - Intronic
1020114788 7:5470386-5470408 CAGGAGCTGGGGCAGCTGCCCGG - Intronic
1020751580 7:12147722-12147744 CCTCCCCTGAGGCAGTTGTCGGG - Intergenic
1021202562 7:17742258-17742280 CAGGCCCTGGGGAAGTGGTCAGG - Intergenic
1022003729 7:26248531-26248553 CAAGCCCAGGGCCAGTTGCCCGG + Intergenic
1024226939 7:47332528-47332550 CTGGCCCTGGGGCAGCTCGCGGG - Intronic
1027414924 7:77964480-77964502 CAGGCGCAGGGGGAGTTGGCTGG - Intergenic
1033401722 7:141032489-141032511 CAGGGGCTGGGGCAGTTGCATGG + Intergenic
1034219490 7:149432833-149432855 CAATCCCTTGGGCAGCTGTCCGG - Exonic
1034348197 7:150399717-150399739 CAGCCCCTAGGGCTGGTGTCGGG - Intronic
1034412124 7:150947258-150947280 CAGGTCCTGGCGGTGTTGTCTGG - Intronic
1034692050 7:153021757-153021779 CAGGACCTGGGACAGAGGTCAGG + Intergenic
1035577789 8:719088-719110 CAGGCCCTGGGGCCACTGCCTGG + Intronic
1035718876 8:1775866-1775888 CAGGCCCTGTGCCAGGTGCCGGG + Intronic
1036667481 8:10756989-10757011 CAGGCCCTGGGGCAGGACTGAGG - Intronic
1037090897 8:14917136-14917158 CAGGCCCTGGGGAATTTACCTGG - Intronic
1037200751 8:16249669-16249691 CAGGCCCGGTGGCAGTTGTTTGG + Intronic
1037672733 8:21029168-21029190 CAGGCTCTGGGGCAGATAACCGG + Intergenic
1038173593 8:25161175-25161197 CAGGCCTGGGGCCAGTTGTTGGG - Intergenic
1038425666 8:27462407-27462429 CAGGAGCTGGGGCAGGGGTCAGG + Intronic
1039465948 8:37784880-37784902 CAGGGCCTGGGGCAGGGGTGGGG + Intronic
1042445861 8:68884561-68884583 CAGGCCCTGTGGCAGTGTCCTGG + Intergenic
1045322972 8:101095756-101095778 GAGGCCCTGAGGCAGGTCTCAGG - Intergenic
1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG + Intronic
1048899206 8:139021950-139021972 CTGGCCCTGGGGCTGTGGGCTGG - Intergenic
1049235235 8:141508821-141508843 CAGGCCTTGGGGCAGCAGCCAGG - Intergenic
1049255659 8:141612318-141612340 GATGCCCTGGGGCACTTGTCAGG + Intergenic
1049385877 8:142342742-142342764 CAGGTGCTGGGACAGTTGCCTGG - Intronic
1049385902 8:142342865-142342887 CAGGTGCTGGGACAGGTGTCCGG - Intronic
1049486331 8:142865597-142865619 CAGGCCCTGGGGGAGTGGTCAGG + Intronic
1049573001 8:143378332-143378354 GAGGCCCTGCGGCAGGTGTGTGG + Exonic
1049701000 8:144012496-144012518 CATGCCCTGGGGCAGTGGCAAGG - Exonic
1050019134 9:1265903-1265925 CAGGCCCCGGTGTAGTGGTCTGG + Intergenic
1050986651 9:12091539-12091561 CAGGCCCTGGGGAAGTGGTCAGG + Intergenic
1052855277 9:33402937-33402959 GAGGCCCTGGGTCAGTCCTCAGG + Intergenic
1053055669 9:34991837-34991859 CAGGCCCTGCTGCAGGTGGCTGG - Intronic
1053287880 9:36861653-36861675 AAGGCCCTGGGGCAGGAGTGTGG + Intronic
1053683287 9:40499280-40499302 GAGGCCCTGGGTCAGTCCTCAGG + Intergenic
1053933268 9:43127596-43127618 GAGGCCCTGGGTCAGTCCTCAGG + Intergenic
1054280427 9:63125648-63125670 GAGGCCCTGGGTCAGTCCTCAGG - Intergenic
1054296391 9:63334778-63334800 GAGGCCCTGGGTCAGTCCTCAGG + Intergenic
1054394408 9:64639283-64639305 GAGGCCCTGGGTCAGTCCTCAGG + Intergenic
1054429057 9:65144482-65144504 GAGGCCCTGGGTCAGTCCTCAGG + Intergenic
1054501326 9:65877053-65877075 GAGGCCCTGGGTCAGTCCTCAGG - Intergenic
1056455630 9:86756777-86756799 CAGGCCCTGGGGTGGCTCTCTGG + Intergenic
1056999351 9:91493182-91493204 CAGGCCCTGGGGTGGCTGTGGGG - Intergenic
1057423084 9:94927681-94927703 CAGGGCCTGGGGCAGCAGCCAGG - Intronic
1057800955 9:98191464-98191486 CTCACCCTGGGGCAGTGGTCAGG - Intronic
1057907313 9:98992852-98992874 CAGGCACTGGGGCAGATGTGGGG + Intronic
1060215525 9:121736388-121736410 CAGGCCCTGGAGCAGGGGTTCGG - Intronic
1060594460 9:124839993-124840015 CAGGGCCTGGGGGAGGTGTGGGG + Intergenic
1060629646 9:125143793-125143815 GAGAACCTGGGGCAGGTGTCTGG - Intergenic
1061015657 9:127979824-127979846 CTGGGCCTGAGGCAGTTGGCAGG - Intronic
1061599464 9:131657687-131657709 CAGCCCCTGGGGCTGGTGACTGG + Intronic
1062263367 9:135674799-135674821 CAGGCTCGGGGGCAGTGGTGCGG - Intergenic
1062578073 9:137217775-137217797 GTGGCCCTGGGGCAGGAGTCAGG - Intergenic
1062589040 9:137264882-137264904 CAGGCCCAGGGGCTGGGGTCTGG + Intronic
1187951571 X:24475813-24475835 CTGGCTCTGGGGCAGCTCTCAGG + Intronic
1189298850 X:39937704-39937726 CAGGCCCTGGTGGTGGTGTCGGG - Intergenic
1189354588 X:40301082-40301104 CAGGCCATGGGGGTGTTGGCTGG + Intergenic
1191226383 X:58048796-58048818 CACTGCCTGAGGCAGTTGTCAGG + Intergenic
1194209959 X:91059857-91059879 CATTGCCTGAGGCAGTTGTCAGG + Intergenic
1197097146 X:122610339-122610361 CTTCCCCTGAGGCAGTTGTCAGG + Intergenic
1198153051 X:133930214-133930236 CTGGGCCTGGGGCAGTTGGGGGG - Intronic
1199164012 X:144648438-144648460 CAGGCCCAGAGACAGTTGACTGG - Intergenic
1199565405 X:149210486-149210508 CAGGCCCTGAGCCAGGTGGCAGG - Intergenic
1201890349 Y:18936997-18937019 AAGGCCTTTGGGCTGTTGTCAGG - Intergenic