ID: 1112100854

View in Genome Browser
Species Human (GRCh38)
Location 13:96187689-96187711
Sequence CTAAACATCCTGACATGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112100851_1112100854 17 Left 1112100851 13:96187649-96187671 CCAATTTTCAAGACTCTAAATGT 0: 1
1: 0
2: 2
3: 27
4: 282
Right 1112100854 13:96187689-96187711 CTAAACATCCTGACATGTCATGG 0: 1
1: 0
2: 0
3: 16
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112100854 Original CRISPR CTAAACATCCTGACATGTCA TGG Intronic
902155280 1:14480038-14480060 ATAAAAATCCTGACATGACTTGG + Intergenic
903965990 1:27089848-27089870 GGAAATATCCTGACATGCCATGG - Intergenic
905530172 1:38672008-38672030 CTGAACAAGCTGACATGTGAGGG - Intergenic
907640609 1:56185615-56185637 CTCAACAACCTGACTTGTAAAGG - Intergenic
908095815 1:60737216-60737238 CTTAAGATTCTGACATGTAAGGG + Intergenic
908729397 1:67210178-67210200 CTAACCATCCTTAAATGCCAAGG + Intronic
911199966 1:95034514-95034536 CTTAACCTCATGACATCTCAGGG + Intronic
911969681 1:104415963-104415985 CTCATAATCCTCACATGTCATGG - Intergenic
912775338 1:112503112-112503134 CTTCACATCCTTACATATCAGGG - Intronic
919793928 1:201309825-201309847 CTAAACATCCTGCCATGCTTGGG + Intronic
922565017 1:226596175-226596197 CTAGACACCCTGACCTGTAAGGG - Intronic
922743977 1:228032915-228032937 CTCAACATCCTTAGATATCAGGG - Intronic
924326575 1:242900843-242900865 CTAAAGGACCTGACATGTCATGG + Intergenic
924326732 1:242902222-242902244 CTAAAGGACCTTACATGTCATGG + Intergenic
924422751 1:243924675-243924697 CTAAACATCCTGAAATGCACGGG - Intergenic
1063786257 10:9387390-9387412 CTATTCACCCTGACATTTCATGG + Intergenic
1064220815 10:13439092-13439114 CTTAACAGCCTGACATCACAAGG + Exonic
1064634626 10:17351225-17351247 CTAATCATTTTGACATGTGATGG + Intronic
1065749683 10:28874303-28874325 CTCATCATCCCCACATGTCATGG - Intronic
1066101375 10:32121595-32121617 CTGCCCTTCCTGACATGTCAAGG + Intergenic
1068909009 10:62358446-62358468 GTAATAATCCTCACATGTCATGG - Intergenic
1069020912 10:63487468-63487490 CTAAACATCCTATAATGCCAAGG + Intergenic
1070412035 10:76150508-76150530 ATTAACATTCTGACATGTTAAGG - Intronic
1070829692 10:79410838-79410860 CTCAACCTCCTGCCATCTCAGGG - Intronic
1072796261 10:98357120-98357142 GTAATAATCCTCACATGTCAAGG - Intergenic
1075018148 10:118926339-118926361 CTAAACATCCTGCCATGCACAGG - Intergenic
1078042036 11:7875606-7875628 CTAAACATCATTAAATATCAAGG + Intergenic
1079211907 11:18469086-18469108 TTTCACATCCTGAAATGTCACGG + Intronic
1079827742 11:25219454-25219476 CTTATCATCCTGACTTGACAAGG + Intergenic
1080000839 11:27347114-27347136 CTAAACATCATCAGATCTCAGGG + Intronic
1081100036 11:38989890-38989912 TTAAACATCCTTAAATGTCATGG + Intergenic
1082080532 11:48009230-48009252 ATAAACATCCTGCCATATCATGG - Intronic
1082820662 11:57542705-57542727 CTCCACCTCCTGACATCTCAGGG - Exonic
1087685812 11:101263633-101263655 CTAAACATCCTTCAATGTGAGGG - Intergenic
1087754878 11:102044654-102044676 CTAAACATCCTGCAATGTACGGG - Intergenic
1088015644 11:105055870-105055892 CTAATCATCCAGATATGTCCTGG - Intronic
1091636424 12:2200465-2200487 CTAAACATCCTGCCATGCACAGG + Intronic
1091769164 12:3140223-3140245 CTAAACAACATAAAATGTCAGGG - Intronic
1093617532 12:21245287-21245309 TTAAACATCCTTACATCCCAGGG - Intergenic
1093758857 12:22882523-22882545 CTAAACATCCTGCCCTGTGGTGG - Intergenic
1098574004 12:72020204-72020226 CTAAACATCCTACCATGTACAGG + Intronic
1099783676 12:87233567-87233589 CTAAAAATCCTGAAATGTATAGG - Intergenic
1100343067 12:93700100-93700122 CAAGGCATCCTGAGATGTCAGGG - Intronic
1100495262 12:95118920-95118942 CAAAACATACTGACACTTCAAGG + Intronic
1100797321 12:98196332-98196354 CTAAACATAAGGTCATGTCATGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1102018895 12:109667817-109667839 GCAAACATCCTGAGATGGCAGGG + Intergenic
1104741935 12:131184088-131184110 CTGATAATCCTCACATGTCATGG - Intergenic
1109432705 13:62256230-62256252 CTGATCATCCTGACATCTGATGG - Intergenic
1109994016 13:70098591-70098613 CTAAATGTCCTGCCATTTCATGG - Intronic
1110721675 13:78768891-78768913 CTAAACATCCTGCAATGCCCAGG - Intergenic
1111280401 13:86015490-86015512 CTAAAGATCCTACCATGCCAAGG - Intergenic
1111732895 13:92099383-92099405 CTAAAGAGCGTGATATGTCAAGG - Intronic
1111815273 13:93145283-93145305 GTAATAATCCTCACATGTCATGG + Intergenic
1112100854 13:96187689-96187711 CTAAACATCCTGACATGTCATGG + Intronic
1112890123 13:104219307-104219329 ATAAACATCCCCACATGTCTAGG - Intergenic
1113440062 13:110321918-110321940 GTAATCATCCCCACATGTCAAGG - Intronic
1113473499 13:110562956-110562978 CTCAGCAACCTGACATGCCAGGG - Intergenic
1114895099 14:26979453-26979475 CTAAAGATCTAGACTTGTCAAGG + Intergenic
1117375881 14:55117850-55117872 CTGAGCATCATGACATGGCAAGG - Intergenic
1118048242 14:61996030-61996052 CTGAACATCCTGAGACGCCATGG - Exonic
1118819718 14:69337308-69337330 CTAAAAATCCTGACTTCACATGG + Intronic
1119677853 14:76569300-76569322 CTAAACATCCTGCCATGTAGGGG + Intergenic
1119987331 14:79152748-79152770 GTAATAATCCTTACATGTCAAGG - Intronic
1121066230 14:90968444-90968466 CTCAACATACTGACAGGTCCTGG + Intronic
1121979673 14:98443809-98443831 CTAAACATCCTGTAATGCCCAGG - Intergenic
1126528388 15:49684524-49684546 CTAAACATCTTGCCAACTCATGG + Intergenic
1128884502 15:71274212-71274234 CTGAAACTCATGACATGTCAGGG + Intronic
1129779029 15:78257061-78257083 CAAAACTTCCTGGCATGACATGG - Intergenic
1130448607 15:84028776-84028798 CTCAATATCCCCACATGTCAAGG + Intronic
1133382127 16:5339961-5339983 CTCAACATCTTGGAATGTCAAGG - Intergenic
1135786057 16:25350339-25350361 GTAAAAATCCCCACATGTCAAGG + Intergenic
1137847015 16:51700159-51700181 ACAAACACACTGACATGTCATGG - Intergenic
1138528539 16:57622491-57622513 CTACACATCCCTGCATGTCACGG - Intronic
1139145400 16:64318337-64318359 CTAAACGTCCTAAAATGTGATGG + Intergenic
1140217816 16:73022488-73022510 CTAAACATCCTGCGATGCCCAGG - Intronic
1140419916 16:74810633-74810655 CTAAAAATCATGACAAATCATGG - Intergenic
1146599046 17:34196980-34197002 CAAAACATCCTTACATTTCTAGG - Intergenic
1146841570 17:36159943-36159965 CTAAACATCCTGCCAGGTGCAGG - Intergenic
1146853881 17:36247904-36247926 CTAAACATCCTGCCAGGTGCAGG - Intronic
1146866210 17:36337139-36337161 CTAAACATCCTGCCAGGTGCAGG - Intronic
1146869788 17:36371796-36371818 CTAAACATCCTGCCAGGTGCAGG - Intronic
1146877143 17:36422876-36422898 CTAAACATCCTGCCAGGTGCAGG - Intronic
1147069080 17:37937751-37937773 CTAAACATCCTGCCAGGTGCAGG - Intergenic
1147072667 17:37972420-37972442 CTAAACATCCTGCCAGGTGCAGG - Intergenic
1147080606 17:38017288-38017310 CTAAACATCCTGCCAGGTGCAGG - Intronic
1147084189 17:38051958-38051980 CTAAACATCCTGCCAGGTGCAGG - Intronic
1147096551 17:38141248-38141270 CTAAACATCCTGCCAGGTGCAGG - Intergenic
1147100137 17:38175924-38175946 CTAAACATCCTGCCAGGTGCAGG - Intergenic
1149845262 17:60005721-60005743 CTAAACATCCTGCCAGGTGCAGG + Intergenic
1149857736 17:60097416-60097438 CTAAACATCCTGCCAGGTGCAGG + Intergenic
1150083082 17:62258960-62258982 CTAAACATCCTGCCAGGTGCAGG - Intergenic
1150532301 17:65996743-65996765 CTAAATATCCTAACATTTCAGGG - Intronic
1158188761 18:54801632-54801654 CTAATCATCCTGAAATGTACTGG - Intronic
1158318566 18:56238463-56238485 ATAAACATCATGAAATGTCTTGG - Intergenic
1159180836 18:64902259-64902281 CTCAACATCATTAAATGTCAGGG + Intergenic
1163741616 19:19017418-19017440 CTAAACAGCCTGCAATGTCCAGG + Intronic
1165562649 19:36693519-36693541 CAAAACTTCCTTACATTTCATGG + Intronic
925642812 2:6003262-6003284 ATAATAATCCTCACATGTCAAGG + Intergenic
927252136 2:21005872-21005894 CTAAGGATCCTGCAATGTCAAGG + Exonic
927757536 2:25721193-25721215 CTAAACATCCTGCAATGCCCAGG + Intergenic
928474594 2:31613964-31613986 GTAATCATCCCCACATGTCAAGG - Intergenic
930104845 2:47631701-47631723 TTAAACACCCAGACATGTCCAGG - Intergenic
930749196 2:54916359-54916381 CTAAACATCCTGACACGCACAGG + Intronic
930856579 2:56025560-56025582 CTCAACATCCTGCAATGTCTGGG - Intergenic
931763960 2:65438346-65438368 CAAAACATCCTGTTATGCCAGGG - Intergenic
933283760 2:80361599-80361621 TTAAAAATCATGACATGACACGG + Intronic
934013513 2:87852654-87852676 CTAAACATGCTCCCATCTCAAGG + Intergenic
934987577 2:98899082-98899104 ATAAACAAGCTGACATGTCTGGG + Intronic
935044127 2:99464164-99464186 CTAAACATCTTGACAGATCTAGG + Intronic
935940506 2:108233177-108233199 GTAACAATCCTCACATGTCAAGG + Intergenic
936877123 2:117203510-117203532 ATAATCATCCTGACATATTAAGG + Intergenic
937269473 2:120639004-120639026 TTAAACATTCTTTCATGTCAAGG - Intergenic
939013384 2:136873432-136873454 CTAAACATCATGTCATTGCAAGG + Intronic
939152243 2:138486801-138486823 CTAAACATCCTGAAAGGTAATGG - Intergenic
941276297 2:163494996-163495018 CTAATAATCCCCACATGTCAAGG + Intergenic
941747337 2:169100910-169100932 CCAAACAACCTGACTTGCCATGG + Intergenic
942168846 2:173269708-173269730 CTAAACATCCTGCTTTGTCTGGG - Intergenic
942253042 2:174063931-174063953 CTCAACATCCAGACATGCCCCGG + Intergenic
942571542 2:177320562-177320584 CTAAACATCCTGCAATGCCTAGG - Intronic
943066054 2:183087698-183087720 CTAAAAATGATGACATTTCAAGG - Intronic
948008419 2:234630871-234630893 CTTAACATGCTGAGAGGTCAGGG - Intergenic
948136293 2:235638871-235638893 CTGAACATCCTGACATGCACAGG - Intronic
1169776093 20:9254789-9254811 ATAAACATCCCCACATTTCAAGG - Intronic
1169985255 20:11436336-11436358 CTAAACCTCCTGGCCTGTGAAGG + Intergenic
1170782571 20:19438743-19438765 CTATACTACCTGCCATGTCAGGG - Intronic
1172857700 20:38019482-38019504 TTTAACATCTTGACATGTTATGG - Intronic
1173182796 20:40817288-40817310 CTAAACATCCTACCATGTACAGG + Intergenic
1173703874 20:45096005-45096027 CTAAACATCCTAAAATGTACAGG + Intronic
1173874483 20:46361610-46361632 CTAAACATCCTGCCATGTAGAGG - Intronic
1174706212 20:52658819-52658841 CTAACCATCCTGCAATGTCCAGG + Intergenic
1175634852 20:60572430-60572452 ATTAACCTCCTGAGATGTCAAGG + Intergenic
1177584756 21:23076232-23076254 CTAAACTTCCTGTCAACTCAAGG - Intergenic
1177908702 21:27002906-27002928 GTAATAATCCTCACATGTCAAGG - Intergenic
1177909028 21:27008035-27008057 GTAATAATCCTCACATGTCAAGG + Intergenic
1178817842 21:35947609-35947631 CCAAACATCTTGCCATGCCAAGG + Intronic
1183296619 22:37033606-37033628 CTCAACATCCTGACAGTTGAGGG - Intergenic
1184447309 22:44556448-44556470 CTAAGCATCATGAAATGTCACGG + Intergenic
952224409 3:31360171-31360193 CTAAACATCCTGAAATGCACAGG + Intergenic
952537999 3:34334251-34334273 CTATACATCATGACATATAATGG - Intergenic
952853275 3:37746633-37746655 AGAAACATCCTGGCATGTCTGGG - Intronic
952880610 3:37983915-37983937 CTAATGATGCTGACTTGTCATGG + Exonic
954427784 3:50452469-50452491 CTGACAATCCTGACATGTGATGG + Intronic
955728711 3:61960633-61960655 CTAATCATCCAGATATGACAAGG + Intronic
955900376 3:63747402-63747424 GTAATAATCCTCACATGTCAAGG - Intergenic
955962037 3:64350539-64350561 CTAAACATCCTGCAATGTACAGG + Intronic
956244755 3:67170228-67170250 TTAAACATGCTGAAATGTGAGGG - Intergenic
957175593 3:76803792-76803814 CTAGACATCCTAACATTTCCTGG - Intronic
957261299 3:77905403-77905425 CCCATAATCCTGACATGTCATGG + Intergenic
957879154 3:86187757-86187779 CCACACATCCTGGCCTGTCAGGG + Intergenic
963097945 3:141565463-141565485 GTAATCATCCCCACATGTCAAGG + Intronic
963126698 3:141823010-141823032 TTAAACATAATGAAATGTCAGGG + Intergenic
963878156 3:150500129-150500151 CCCATAATCCTGACATGTCATGG - Intergenic
964025979 3:152074823-152074845 GTAATAATCCTCACATGTCAGGG - Intergenic
964082343 3:152774513-152774535 GTAATAATCCTTACATGTCAAGG - Intergenic
964926520 3:161964429-161964451 CTCATGATCCTAACATGTCATGG + Intergenic
965105775 3:164350548-164350570 CTAAACATCCTGCAATGCAAAGG - Intergenic
965305430 3:167058544-167058566 GTAATAATCCTCACATGTCAAGG - Intergenic
966277417 3:178191248-178191270 CTGATCATCCAGAAATGTCAGGG + Intergenic
969675353 4:8611404-8611426 CCACACATCCAAACATGTCAAGG + Intronic
969957391 4:10905079-10905101 GTAATCATCCCCACATGTCAAGG + Intergenic
970061142 4:12035872-12035894 CTAAACATCCTAAAATGTACAGG + Intergenic
970570587 4:17377644-17377666 GTAATAATCCTCACATGTCAAGG - Intergenic
971021879 4:22545505-22545527 CCCATCATCCTCACATGTCAAGG - Intergenic
973657137 4:53059724-53059746 GTCAACCTCCTGACATATCAAGG - Intronic
975501811 4:75094916-75094938 CTAACCATCCTTGCATCTCAGGG + Intergenic
975684407 4:76905286-76905308 CTAGACATTCTGACATAGCAAGG + Intergenic
976815506 4:89144107-89144129 CTAATAATCCCCACATGTCAAGG + Intergenic
977438532 4:97032712-97032734 CCAAACATCAAGAAATGTCATGG + Intergenic
977496914 4:97787447-97787469 TTAAACAACCTCACATTTCAGGG + Intronic
977731060 4:100352628-100352650 CTAATAATCCTCATATGTCAAGG - Intergenic
978086080 4:104656974-104656996 GTAATCATCCCCACATGTCAAGG - Intergenic
978239760 4:106501682-106501704 GTAACCATCCTGACCTGTGAGGG - Intergenic
982827321 4:160017516-160017538 CTAAGCAACCTGGAATGTCAGGG + Intergenic
982842103 4:160202135-160202157 CTAAACCTTCTTAAATGTCAAGG - Intergenic
983236745 4:165188339-165188361 CTAAACCTCCAGACCTGTGATGG + Intronic
983851323 4:172584186-172584208 CTAAACAAGCTGAAATGTCTTGG - Intronic
984047253 4:174815785-174815807 CTAAACCTCCAGACCTGTGATGG + Intronic
985609920 5:881717-881739 CTGGACATCATGCCATGTCAGGG + Intronic
985839045 5:2291776-2291798 CTAAACACCCTAATATGTCAGGG - Intergenic
986303542 5:6498061-6498083 ATAATAATCCCGACATGTCAAGG + Intergenic
986930228 5:12809717-12809739 CTAAACATCCTAAAATGCCCAGG + Intergenic
986999574 5:13646520-13646542 GTAATAATCCTCACATGTCAAGG + Intergenic
988256720 5:28830325-28830347 GTAATAATCCTCACATGTCAAGG - Intergenic
988693647 5:33597370-33597392 CTAGACATCCTGAGAGCTCAGGG - Intronic
989393323 5:40924900-40924922 CCAAACCTCCTGACCTGTGATGG + Intronic
989726736 5:44596588-44596610 CCCATAATCCTGACATGTCATGG - Intergenic
990609679 5:57444720-57444742 CTAAACATCCTGCAATGCCCAGG - Intergenic
993357121 5:86928091-86928113 CTAAACATCCTGCAATGTGTGGG - Intergenic
994756154 5:103796096-103796118 CTTAAAATTCTGACATGTCTTGG + Intergenic
994831038 5:104784433-104784455 GTAATAATCCTCACATGTCAAGG - Intergenic
995026262 5:107426768-107426790 GTCAACATGCTGACATGTCCAGG + Intronic
996117127 5:119631361-119631383 CAAAACATTCTGAAATGTAAGGG - Intronic
997556549 5:134804213-134804235 ATAAACCTCCTGACATCTCAGGG - Intronic
999394506 5:151218606-151218628 CTATGCACCCTGAGATGTCAGGG + Intronic
999458202 5:151735803-151735825 CCAAACCTCCAGAGATGTCAGGG - Intergenic
1001113692 5:168920985-168921007 CTAAACCTCTTGACAGCTCAAGG - Intronic
1002555781 5:180038624-180038646 CTAAACAAACTAACATTTCAAGG + Intronic
1002717606 5:181237916-181237938 CTAAACATCCTGGAATGTACAGG + Intronic
1003824404 6:9937017-9937039 CTACACATCCCGGCATGGCATGG + Intronic
1004446379 6:15703221-15703243 CTAAAAATTCTGACTTTTCATGG + Intergenic
1004854519 6:19735643-19735665 CTAAACATCCTGCAATGTACAGG - Intergenic
1010860460 6:80903290-80903312 GTAATAATCCTGACATGTCAAGG - Intergenic
1010934487 6:81845340-81845362 ATACACATCCAGACATGTCAGGG - Intergenic
1012293325 6:97486770-97486792 TGAATCATCCTTACATGTCAGGG + Intergenic
1017270509 6:152498251-152498273 GTAAAATTCATGACATGTCATGG - Intronic
1018491592 6:164299319-164299341 GTAATAATCCTCACATGTCAAGG + Intergenic
1019385212 7:751518-751540 CTTTAAATCCTGACATATCATGG + Intronic
1019603397 7:1896289-1896311 CTCAACATCCTGCCATGGCTGGG + Intronic
1021245446 7:18256045-18256067 CTAGATATGCTGAGATGTCAAGG - Intronic
1021267424 7:18542010-18542032 CTAAACATCCTGCAATGGGAAGG - Intronic
1021965009 7:25908906-25908928 CTAAACATTCTGTAATGTCCAGG + Intergenic
1022816224 7:33917107-33917129 CTATACCTCCTGCCTTGTCAGGG - Intronic
1023639954 7:42247472-42247494 GTAAACATCCTGAGATCTCAGGG + Intergenic
1024706373 7:51964789-51964811 TGAAACACCCTGACATGTCATGG - Intergenic
1026395795 7:69953006-69953028 GTAAATATCCTCAAATGTCATGG - Intronic
1026473287 7:70712350-70712372 CTCCACATCTTGATATGTCAGGG + Intronic
1027349261 7:77293765-77293787 CTAAGAATACTGACAGGTCATGG - Intronic
1027972630 7:85104988-85105010 CTGAATATCCTGAGATGGCAGGG - Intronic
1028734933 7:94198046-94198068 GTAATAATCCTCACATGTCAGGG + Intergenic
1029246168 7:99203479-99203501 CTGAGAATCCTGACCTGTCAAGG - Intronic
1031272890 7:119675909-119675931 CTTAAAACCATGACATGTCAAGG - Intergenic
1031747796 7:125525312-125525334 GTAATAATTCTGACATGTCATGG - Intergenic
1034935201 7:155194798-155194820 CTAATCATCCTGACAACTCCGGG + Intergenic
1038364265 8:26915068-26915090 GTAATAATCCTCACATGTCAAGG - Intergenic
1040813255 8:51480644-51480666 GTAAAAATCCCTACATGTCAAGG + Intronic
1046233690 8:111392679-111392701 CAAATCATCTAGACATGTCACGG - Intergenic
1048065041 8:130958730-130958752 GTAATAATCCTCACATGTCAAGG - Intronic
1048522771 8:135171982-135172004 TTAGACATCCTGAAATGGCAAGG - Intergenic
1050579875 9:7042276-7042298 TTAAACATTGTGATATGTCATGG + Intronic
1050903213 9:10971511-10971533 CCAATAATCCTCACATGTCAAGG + Intergenic
1051117465 9:13713119-13713141 CTTATAATCCTCACATGTCAAGG + Intergenic
1052210218 9:25894387-25894409 CTAAACCTCCTGGCCTGTGATGG + Intergenic
1053326393 9:37155933-37155955 CTAGAGTTCCTGACCTGTCAAGG + Intronic
1053819736 9:41954305-41954327 TTAAAAATCCTGAGATGTGAAGG - Intronic
1056072885 9:83007195-83007217 CTAAACATCTTGGGAAGTCAGGG - Intronic
1058709141 9:107664335-107664357 CTAAACATCCTATAATGTCCAGG - Intergenic
1059344852 9:113621116-113621138 CCAAACATCCTGCCATGAAAGGG - Intergenic
1059963803 9:119593612-119593634 CAAGACATCCTAACATCTCATGG - Intergenic
1062620546 9:137419203-137419225 CTAAAAATTCTGACATGTCTTGG + Intronic
1186721022 X:12304369-12304391 CTAAACATCCTGCAATGTACAGG - Intronic
1187218352 X:17298891-17298913 CTAAACATCATTACCTTTCAGGG - Intergenic
1188133669 X:26468614-26468636 GGTAACTTCCTGACATGTCATGG + Intergenic
1189537108 X:41946755-41946777 CTAAAAATCGTGACATATAATGG - Intergenic
1193388154 X:80894985-80895007 CTACCCCTCCTGACATGTGATGG - Intergenic
1196075590 X:111572448-111572470 CTAAAAATTCTGATATGTCTTGG + Intergenic
1196843624 X:119881055-119881077 CTAAACATCCTAAGATGTACAGG + Intergenic
1197387754 X:125821774-125821796 CTAAACCTCCTGACCTGTGATGG + Intergenic
1197527073 X:127576577-127576599 CAAAACTTTCTGACATGTCCTGG + Intergenic
1198825791 X:140696592-140696614 CTCATAATCCTCACATGTCATGG - Intergenic
1199130960 X:144185815-144185837 CTAAACATGCTCCCATCTCAAGG - Intergenic
1199307755 X:146287546-146287568 ATATATATCCTGACATGTAAAGG - Intergenic
1201224004 Y:11799411-11799433 CTAAAGGACCTTACATGTCATGG + Intergenic
1201224162 Y:11800782-11800804 CTAAAGGACCTTACATGTCATGG + Intergenic
1201465235 Y:14273419-14273441 CTAAACATCCTCCAATGTCCAGG - Intergenic
1201728101 Y:17176108-17176130 CAAAACATTCAGACATTTCAGGG - Intergenic