ID: 1112103615

View in Genome Browser
Species Human (GRCh38)
Location 13:96217026-96217048
Sequence GACCCACACCCTGGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112103615_1112103624 25 Left 1112103615 13:96217026-96217048 CCTGCACCCCCAGGGTGTGGGTC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1112103624 13:96217074-96217096 ATCCAATGGCTTGTCCTCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
1112103615_1112103622 11 Left 1112103615 13:96217026-96217048 CCTGCACCCCCAGGGTGTGGGTC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1112103622 13:96217060-96217082 CATCTCCTTCTTCGATCCAATGG 0: 1
1: 0
2: 1
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112103615 Original CRISPR GACCCACACCCTGGGGGTGC AGG (reversed) Intronic
900232232 1:1565614-1565636 GAGCCACATCGTGGGGGTGTTGG - Intronic
900336530 1:2166742-2166764 GAAGCACAGCCTGGGGGTGGGGG - Intronic
900438530 1:2642433-2642455 GCCCCTCTCCCTGGGGCTGCTGG + Intronic
900628144 1:3618892-3618914 GACCTCCAACCTGGGGGAGCTGG + Intergenic
900731327 1:4262988-4263010 GACACACACCCTGGGAGTTGTGG + Intergenic
901006053 1:6171983-6172005 CACCCACCTCCTGGGGGTGGAGG + Intronic
901031889 1:6311892-6311914 GACCCAGACCCTGGGAGTCGGGG - Intronic
901321023 1:8339907-8339929 GACCCAGAGCCTGGGTGGGCTGG - Intronic
901927925 1:12578794-12578816 GAGCCTGACCCTGGGGCTGCTGG - Exonic
903387388 1:22936455-22936477 GACCCACTCTCTGGTGGTCCTGG - Intergenic
903942727 1:26942752-26942774 GACCCAGACCCTGTCGGAGCTGG + Exonic
904328089 1:29740326-29740348 GAACCACAGGCTGGGGGTGGAGG - Intergenic
904785476 1:32979404-32979426 CACACACACTCTGGGGGTGATGG + Intergenic
906131689 1:43462769-43462791 GACCCAAACCCTGGGGCTTTGGG + Intergenic
906207770 1:43996272-43996294 GACCAACAGCCTTGGGGTCCTGG - Exonic
907320469 1:53599067-53599089 CACCCACTGCCTGGGGCTGCTGG - Intronic
907437682 1:54459877-54459899 GTCCCAGCCCCTGGGGGTGGGGG + Intergenic
916172203 1:162009775-162009797 CACCTCCAACCTGGGGGTGCTGG + Intronic
917596316 1:176532645-176532667 GACCCACACCATGTGGGGACAGG - Intronic
920046659 1:203137173-203137195 GACCAAAACCCTGGAGGTGAGGG + Intronic
922516087 1:226209337-226209359 GCCTCAGACACTGGGGGTGCGGG + Intergenic
923731794 1:236558256-236558278 GACCTCCACCCTGGAGGCGCTGG - Exonic
1062783676 10:241463-241485 GACCCAGACGCTGGGTGTGGTGG - Intronic
1062911840 10:1216666-1216688 CAGCCACAGCCTGGGGTTGCCGG + Intronic
1062933683 10:1369370-1369392 AGGCCACACCCTGGGGGTGAGGG + Intronic
1063851311 10:10194900-10194922 GACCCAAGCACTGGGTGTGCTGG - Intergenic
1063860761 10:10305475-10305497 CACCCAAACCCTGGGGGACCAGG - Intergenic
1064347748 10:14548292-14548314 CACGGACACCCTGGGGGTCCAGG + Intronic
1064969443 10:21049322-21049344 GCCCCAGACCCTGGGTGTGGTGG - Intronic
1067684489 10:48458407-48458429 GAACCACACCTTGGGAGAGCAGG + Intronic
1067796142 10:49323579-49323601 CATCTATACCCTGGGGGTGCAGG + Exonic
1069796041 10:71052612-71052634 GACCCACAGCCTGTGGGAGTGGG - Intergenic
1070147564 10:73785852-73785874 GACCCGGCCCCGGGGGGTGCGGG + Exonic
1070773371 10:79095803-79095825 GATCCACATCTTGGGGCTGCTGG + Intronic
1072700950 10:97640961-97640983 GACCCAAACCGTGGCGGCGCAGG + Exonic
1072728414 10:97828858-97828880 GACCCACATCCTGGTGCAGCAGG - Intergenic
1073441688 10:103556129-103556151 GACCCACAGCCTGGAGCTGGAGG + Intronic
1075396880 10:122133966-122133988 GACCCTCTTCCTTGGGGTGCAGG + Intronic
1076163760 10:128266050-128266072 GACCCTCACTCTGTGGGGGCCGG + Intergenic
1076674494 10:132141118-132141140 GACCCAGACCCTGTGGCTGTGGG + Intronic
1076784614 10:132743505-132743527 GACCCTAACCCTGGGGCTGTGGG + Intronic
1077236860 11:1486071-1486093 GAACCACACCCTGTGGGTTGCGG + Intronic
1077440471 11:2566492-2566514 GACCCACATAATGGGGGTGGTGG - Intronic
1078827290 11:14941314-14941336 GACCCAGAGCCTAGAGGTGCTGG - Intronic
1080416024 11:32070611-32070633 AACCCACTCCCTCTGGGTGCTGG + Intronic
1081705804 11:45181297-45181319 GCCCCTCACCCTGGGACTGCCGG - Intronic
1084067554 11:66713942-66713964 GAACCAGAACATGGGGGTGCAGG - Intronic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084532087 11:69733310-69733332 GTCCCATCCCCTGCGGGTGCAGG + Intergenic
1084981606 11:72831935-72831957 CACACACACCCTGGGGGAGGGGG - Intronic
1086305921 11:85481935-85481957 GACCTGGACCCTGGGGCTGCAGG - Intronic
1089099789 11:115952710-115952732 GGTCCACAGCCTGGGGCTGCTGG + Intergenic
1089760863 11:120722153-120722175 GATCCACACCCTTTGTGTGCTGG - Intronic
1089871003 11:121672660-121672682 GAGCCACAGGGTGGGGGTGCCGG + Intergenic
1090393909 11:126406748-126406770 GGCCCTCACCCAGGGAGTGCAGG + Intronic
1090976065 11:131682041-131682063 GACCCAGCCCCTAGGGCTGCAGG + Intronic
1091226988 11:133963407-133963429 GACCCACACCTTTGGGCTGCTGG - Intergenic
1091587190 12:1822954-1822976 GGCCCACACCCTGGGCCTGCAGG - Intronic
1091754563 12:3043056-3043078 GAACCACGGGCTGGGGGTGCTGG - Intergenic
1094096509 12:26711234-26711256 GACCCATGCCGTGGGGGTGCAGG - Exonic
1094834189 12:34314582-34314604 CAGCCCCACCCAGGGGGTGCTGG + Intergenic
1096178852 12:49539713-49539735 GACCCACACCCAGGGACTTCTGG - Intronic
1098290293 12:68951662-68951684 GACCCACTCGCTGGTGGTGGGGG - Intronic
1098435939 12:70468300-70468322 GGCACACACCCTGGGGGCTCCGG + Intergenic
1102145374 12:110651186-110651208 CATCCACAGCCTGGGAGTGCAGG + Intronic
1103901031 12:124303694-124303716 GGCCCACATCCTGGGGCTGGGGG - Intronic
1103958573 12:124593368-124593390 GGCCCAGGCCCCGGGGGTGCAGG - Intergenic
1104946436 12:132416875-132416897 GCCCCACACCCCGGGGGTCAAGG + Intergenic
1107627177 13:42300757-42300779 GACCCACACTGTGGAGATGCAGG - Exonic
1112103615 13:96217026-96217048 GACCCACACCCTGGGGGTGCAGG - Intronic
1113396893 13:109956173-109956195 GAGCCACATCTTGGGGGTGGGGG + Intergenic
1113824042 13:113236385-113236407 GCCCCACAACCAGGGTGTGCAGG + Intronic
1118905948 14:70023221-70023243 CAGCCACACCCTGGAGGAGCGGG + Exonic
1120850360 14:89164046-89164068 GCCCCACACCCACGGGGAGCAGG - Intronic
1121347110 14:93144316-93144338 GACGCCCACCCTGGGGGTGTTGG + Intergenic
1121591318 14:95113795-95113817 GACCCACATCAGGAGGGTGCTGG + Intronic
1121775963 14:96591036-96591058 GTCCCACACCCAGGGCCTGCAGG - Intergenic
1122315880 14:100825886-100825908 GACCAACACCCTGTGGTCGCGGG - Intergenic
1122892389 14:104738810-104738832 GACCCACCAGCTGGGGGTGTGGG + Intronic
1122998785 14:105280772-105280794 GACCCTGAGCCTGGGTGTGCAGG + Intronic
1124493714 15:30173774-30173796 GACCCCCACCCCGGTGCTGCCGG - Intergenic
1124749853 15:32364875-32364897 GACCCCCACCCCGGTGCTGCCGG + Intergenic
1127613213 15:60657336-60657358 GCCCCACCCCCTGGGGAAGCAGG + Intronic
1128078690 15:64843435-64843457 GACCCACATCCTCTGGGAGCAGG - Intronic
1128146424 15:65334667-65334689 GTCCCACCCCCTGGGAGGGCCGG - Intronic
1128561721 15:68673018-68673040 GACCCTTTCCCTGGGGGTGTGGG - Intronic
1132670186 16:1099311-1099333 GAGCCTCACCCGGGGGCTGCAGG - Intergenic
1132711892 16:1272523-1272545 GACCCTCACCTTGGGGGTGGGGG + Intergenic
1132751046 16:1457884-1457906 GAGACCCAGCCTGGGGGTGCTGG - Intronic
1133402751 16:5500657-5500679 GACCCATACACTGAGGCTGCTGG - Intergenic
1135233002 16:20727385-20727407 GGCCCTCACCCCGGAGGTGCTGG + Intronic
1135971207 16:27073399-27073421 GACCTATTCCCTGGGTGTGCTGG - Intergenic
1136020900 16:27439094-27439116 GATTCACACTCTGGGGGTCCAGG + Intronic
1136418618 16:30118303-30118325 GCCCCAGACCCTGGGGGAGGAGG + Intronic
1136588303 16:31202000-31202022 AACCCACACCCTGCGGGGGAAGG - Intronic
1137735583 16:50720574-50720596 GAAGCCCACCCTGGGGCTGCAGG - Intronic
1141086216 16:81097077-81097099 GACCCACACCCTGGTTTTTCAGG + Intergenic
1141453348 16:84120342-84120364 GACCCAGAAGCTGGGGATGCAGG - Intergenic
1141975819 16:87515764-87515786 GCCCCCAACCCTGGGGTTGCTGG - Intergenic
1142774250 17:2123729-2123751 GATCCACACCCTGGCTCTGCCGG - Intronic
1143163760 17:4887256-4887278 GACTCTCAGCCTGGGGGTGGTGG + Intronic
1145978503 17:28997960-28997982 GTCCCAGAGCCTGGGGGTGGGGG - Intronic
1145981420 17:29014420-29014442 GACCCAGCCCATGGGGCTGCGGG - Intronic
1146492032 17:33290528-33290550 GACCCACAGCGTGGGGGAACCGG + Intronic
1148807746 17:50272752-50272774 GACCGAGAGACTGGGGGTGCAGG + Intronic
1148876387 17:50689854-50689876 GCCCCTCACCCTAGGGCTGCTGG - Intronic
1149313793 17:55421238-55421260 GACCCCCACCCTGGAGGTAAAGG + Intronic
1149640086 17:58197121-58197143 GACCAACTACCTGGGGCTGCTGG + Exonic
1149868267 17:60162369-60162391 GACCCCCACCCTGGGGATGGTGG + Intronic
1150622501 17:66818665-66818687 GTCCCACAACCTGGAGGCGCTGG - Intergenic
1152240076 17:79156426-79156448 GCCCCACACACTGCGGGGGCAGG + Intronic
1152365650 17:79854867-79854889 GACCCAGACCCTGGGGCCACAGG + Intergenic
1153595851 18:6724720-6724742 GCCCCACATCCTGGGGCAGCGGG + Intergenic
1153637847 18:7128503-7128525 GGCCCCCACCCTGGGGCTGTTGG + Intergenic
1154384112 18:13878301-13878323 GACCCACAGCATGGGGGTCAGGG - Intergenic
1154980315 18:21498301-21498323 GACCCTCAGCCTGGAGTTGCTGG + Intronic
1155231441 18:23778784-23778806 GGCCCACACCGTGGCGCTGCAGG - Intronic
1157287580 18:46387559-46387581 GAGCTACACCCAGGTGGTGCCGG - Intronic
1157526928 18:48390699-48390721 GAACCACACCTTGGCGATGCTGG - Intronic
1158584366 18:58718351-58718373 GGTCCACAGCCTGGGGGTGGGGG - Intronic
1160949075 19:1657147-1657169 GACCCACTCCCTGTGGGAGATGG - Intergenic
1160967967 19:1754873-1754895 GGGCCAGACCCTGGGGGCGCCGG + Intronic
1162402466 19:10454323-10454345 GACCCCAATCCTGGGGGTCCTGG - Intronic
1162659703 19:12159419-12159441 GGCCCCCACCCTGGGGATACTGG - Intergenic
1162726003 19:12689997-12690019 GGACCACACCCTGGTGGTGGTGG - Exonic
1164583578 19:29450525-29450547 GACTCACTGCCTGGGGGCGCTGG - Intergenic
1164732942 19:30519633-30519655 GCCCCACACCCTGGAAGGGCAGG + Intronic
1165110989 19:33502064-33502086 GACCAAGAGCCTGGGGGTGGTGG - Intronic
1165316581 19:35059958-35059980 GCCCCACACCCAGAGGCTGCTGG + Exonic
1165802515 19:38561752-38561774 CACCCACACCCTGGGAGCTCTGG + Intronic
1166809791 19:45508210-45508232 GACTCAGACCCTGGGTGTGCAGG + Intronic
1167467141 19:49656272-49656294 GACCCACATCCTGTGGGGCCAGG + Intronic
1167508391 19:49882960-49882982 GGCTCAGACCCTGGGGGTGCAGG - Exonic
1167787005 19:51645366-51645388 GACCCAGACCCAGGGGCTGAGGG + Intronic
1168296087 19:55377914-55377936 GACCCTCCCCCTGGGGGTGCAGG - Intronic
925686113 2:6475696-6475718 CTCCCACGCCCTGGTGGTGCAGG - Intergenic
925896978 2:8479913-8479935 GACCCATCGCCTGGGGCTGCTGG - Intergenic
925918223 2:8622516-8622538 GAACCACTCACTGGAGGTGCTGG - Intergenic
927883959 2:26707191-26707213 GCCCCAGCCCCTGGGGCTGCTGG + Intronic
928336936 2:30406275-30406297 GACTCACACCCTGCAGGTGCCGG - Intergenic
929540813 2:42819319-42819341 GTGCCCCACCCTGGGGGTACAGG + Intergenic
932135822 2:69227694-69227716 GAACCACACTCTTGGGGTGGTGG - Intronic
933777429 2:85779502-85779524 GGCCCTGGCCCTGGGGGTGCTGG + Intronic
939441823 2:142260253-142260275 GACCCAGACCCTGGGCAAGCTGG - Intergenic
946331942 2:219014421-219014443 ACCCCACTCCCTGGGGCTGCTGG - Intronic
948113088 2:235472563-235472585 GCTCCAGACCCTTGGGGTGCAGG + Intergenic
948444899 2:238025011-238025033 GTCCCAAACCCAGGGGGTGTGGG + Intronic
949060175 2:241952375-241952397 CACCCACACCCAGGGGGCGGAGG - Intergenic
949065591 2:241988344-241988366 GACACTCACCCTGGCTGTGCTGG - Intergenic
949073671 2:242041527-242041549 CATCCACACCCTGTGGGTGGAGG + Intergenic
1169213173 20:3778753-3778775 GACCCCCTCCCTGGGGGTCCGGG + Exonic
1170590116 20:17765300-17765322 GACCCATTCCCTGGAGGGGCAGG - Intergenic
1172481051 20:35271615-35271637 CCCCCACAGCCTGGGGGAGCTGG + Exonic
1174539060 20:51275095-51275117 GATCCAGAACCTGGGGGTGAGGG + Intergenic
1175428814 20:58889013-58889035 GCCGCGCACCCTGGGGGTGCAGG - Intronic
1175792053 20:61745987-61746009 GACCCACACCAGGCTGGTGCAGG + Intronic
1175971759 20:62689941-62689963 GACTCAGCCCCTGGGGGTGAGGG - Intergenic
1176050737 20:63118190-63118212 GACCCCCACCCTGGGTGAGTAGG + Intergenic
1176231452 20:64035236-64035258 GGCACACAGCCTGGGGGTGCAGG - Intronic
1176407665 21:6430259-6430281 GTCCTATACCCTTGGGGTGCAGG + Intergenic
1178293360 21:31387792-31387814 GACCCACACACTGCTGCTGCCGG - Intronic
1179574581 21:42299783-42299805 GTCCCAGGCCCTGGGGGTGAGGG + Intergenic
1179683155 21:43038590-43038612 GTCCTATACCCTTGGGGTGCAGG + Intergenic
1180149646 21:45941025-45941047 CACCCACTCACTGGGCGTGCAGG - Intronic
1180150641 21:45945491-45945513 GACCCCCTCCCTGGGGCTGTGGG + Intergenic
1180801412 22:18633838-18633860 GACCAAAGCCCTGGGGGTTCCGG - Intergenic
1180852646 22:19029378-19029400 GACCAAAGCCCTGGGGGTTCCGG - Intergenic
1181220309 22:21361423-21361445 GACCAAAGCCCTGGGGGTTCCGG + Intergenic
1181464039 22:23101326-23101348 GTCCCACATCCTGTGGGTGCTGG + Intronic
1181689374 22:24549935-24549957 GTCTCACACCCTGGTGGTCCTGG - Intronic
1183716652 22:39537137-39537159 GACCCCCACCCGGGGGTTACTGG - Intergenic
1184041460 22:41946566-41946588 GACCCACTCCCGGGGGGATCGGG + Intronic
1184467176 22:44675655-44675677 AACCCACATCCTAGGGGTTCTGG + Intronic
1185260199 22:49857299-49857321 TACCCATACCTTGGGGGTCCGGG - Intronic
949977703 3:9476002-9476024 TACCCACACCGTGGGAGTGGGGG + Exonic
950120231 3:10476879-10476901 ATGCCACACCCTGGGGGTGCTGG + Intronic
950536855 3:13583786-13583808 GGCCCAGAACCTGGGGGTGGAGG + Intronic
952336916 3:32411628-32411650 GTCCCATACCCTGGGGGTCAAGG + Intronic
953929508 3:46998946-46998968 CACCCACCGCCTGGGGATGCAGG - Exonic
956620938 3:71221057-71221079 GCCCCAGACCCTTGGGGAGCTGG - Intronic
957475861 3:80722870-80722892 GATCCACACCAAGGGGGTTCTGG - Intergenic
961741225 3:129034227-129034249 TGCCCATACCCTGGGGGAGCTGG + Exonic
961799950 3:129439868-129439890 GCCCCACACCCTGGGCGTTGCGG - Exonic
962801464 3:138894487-138894509 GACAAACAGCCTGGGGGTGGTGG - Intergenic
967992465 3:195141733-195141755 GACCCACACAGTGGAGATGCTGG - Intronic
968922909 4:3531953-3531975 GACACTGACCCTCGGGGTGCCGG + Intronic
969325710 4:6442676-6442698 ACCCCACACCCTAGGGGTGTTGG - Intronic
969712011 4:8849962-8849984 GTCCCAAACCCTGTGGGTGTTGG + Intronic
973750676 4:54017543-54017565 TGCTCACACCCTGGGGGTGAGGG + Intronic
984122434 4:175762776-175762798 GACACTCACCCTGGGGGTTGTGG - Intronic
985768600 5:1795185-1795207 GACCTGGACCCTGGGAGTGCCGG + Intergenic
985933904 5:3080103-3080125 GTGCCACAGCCTGGAGGTGCTGG - Intergenic
986338590 5:6772322-6772344 GCACCACAGACTGGGGGTGCTGG + Intergenic
986805716 5:11306990-11307012 TACCAACATCCTAGGGGTGCAGG + Intronic
991342335 5:65625022-65625044 GACCCACAGCCTACGGGGGCTGG - Exonic
995571604 5:113487880-113487902 GCCCCACAGCCTCGGGGTCCTGG - Intronic
997418860 5:133750465-133750487 GGGCCACACCCTGGGGGGCCTGG - Intergenic
997693516 5:135843899-135843921 GACCCAGGGCCTGGGTGTGCAGG - Intronic
998374237 5:141680783-141680805 GACCCAGACCCAGGGTGGGCAGG - Intronic
999202264 5:149824794-149824816 GACCCAGGCCCTGGGGATGGAGG - Intronic
1002184371 5:177447283-177447305 GGCCCACAGCCCGGGGGTGCAGG + Intronic
1003060799 6:2860558-2860580 GGACCCCACACTGGGGGTGCAGG - Intergenic
1004270851 6:14193718-14193740 GATCTGCACCCTGGGGGAGCAGG - Intergenic
1005758427 6:28946201-28946223 GAACCACACATAGGGGGTGCAGG + Intergenic
1006081769 6:31572104-31572126 GAACCACAGGCTGGGGGTTCAGG - Exonic
1007420193 6:41714682-41714704 GACCCCCATCCCGAGGGTGCGGG + Intronic
1007581126 6:42960788-42960810 GACCCGCTCCCTGGGGGTGGCGG + Exonic
1009825775 6:68864533-68864555 GAGCCACACCCTAGGGATGATGG + Intronic
1012400924 6:98842675-98842697 GACCCTTCCCCTGGGGGTCCGGG - Intergenic
1015228190 6:130882754-130882776 GACCCAGACCTTGGGGAGGCTGG + Intronic
1016554134 6:145316190-145316212 GCCCCACAGCATGGAGGTGCTGG + Intergenic
1018458798 6:163977791-163977813 CACCCTCACACTGGTGGTGCAGG + Intergenic
1019059582 6:169246695-169246717 GACACAGACCCTGGGCCTGCAGG + Intronic
1019188065 6:170232617-170232639 GACCCCCACCCTGGGTGGGGGGG + Intergenic
1019635846 7:2075173-2075195 GAGCCAAGCCCTGGAGGTGCAGG + Intronic
1019989832 7:4683172-4683194 GACCCACACCTTGCGGCTCCTGG + Intronic
1020072591 7:5237263-5237285 GCCCCCCACCCTGGGAGAGCTGG - Intergenic
1023714944 7:43034530-43034552 GAGCCACACCCTGGGTTTGGTGG + Intergenic
1025730277 7:64101950-64101972 GGGCCCCACCCTGGGCGTGCTGG + Intronic
1028622236 7:92836785-92836807 GACCCACCCCCCGGCGGGGCTGG + Intergenic
1031076812 7:117221042-117221064 GAGCCACCTGCTGGGGGTGCTGG - Intronic
1033529133 7:142245430-142245452 GAGCAACACCGTGAGGGTGCTGG - Intergenic
1033616706 7:143023377-143023399 GTCCCACATCCTGGGCATGCTGG - Intergenic
1034256919 7:149729775-149729797 GAGCCCCACCCTTGGGCTGCTGG + Intronic
1035472410 7:159118988-159119010 CACCCACACCCCAGGGGTTCTGG + Intronic
1036556136 8:9862121-9862143 GAGGCAAACCCTGGGGGTGCTGG - Intergenic
1038193506 8:25345575-25345597 GAGCAACATCCTGGAGGTGCTGG + Exonic
1039919320 8:41882278-41882300 GCCCCACGCCCTGGGGCTCCTGG + Intronic
1039992374 8:42499217-42499239 GAGTCACACACTGGGGGTCCAGG - Intronic
1040386176 8:46916398-46916420 GACCCACACCCTGGCCCCGCTGG - Intergenic
1041622706 8:59990727-59990749 GACCCAGAACCTGGGGCTGCAGG + Intergenic
1048455553 8:134575137-134575159 AACCCACAGCATGGGGTTGCAGG - Intronic
1048986112 8:139735956-139735978 GAGCCACACCCTGTCGGAGCAGG + Intronic
1049194305 8:141307424-141307446 GAGCCACAGTCTGGCGGTGCAGG + Intronic
1049214910 8:141403043-141403065 CACCCACACCCCAGGGCTGCTGG - Intronic
1052864030 9:33454148-33454170 GACCCATACCCTGGGGACTCTGG + Intergenic
1053462944 9:38284685-38284707 ATCCCACAGGCTGGGGGTGCGGG - Intergenic
1056831966 9:89924506-89924528 GCCCCTCACCCAGAGGGTGCAGG - Intergenic
1057499310 9:95584284-95584306 GTCCCACTCACAGGGGGTGCAGG + Intergenic
1057584422 9:96316521-96316543 GACCAACAGCCTGGGGTGGCTGG + Intergenic
1057758307 9:97853881-97853903 GATCCAGAGCCCGGGGGTGCGGG + Exonic
1058429250 9:104903690-104903712 GAGCCACACGCTGGGGGTGCTGG - Exonic
1059421022 9:114192516-114192538 GACCTTCAGCCTGGGGTTGCTGG + Intronic
1060055096 9:120406484-120406506 GCTCCACACCCTGGGTGGGCGGG + Intronic
1060142143 9:121219552-121219574 GACCCACACCCTGGTTTTTCAGG - Intronic
1061231777 9:129319727-129319749 GAGCCACCCTGTGGGGGTGCAGG + Intergenic
1061420836 9:130472186-130472208 GCCCCACACCCCGGGGAGGCTGG + Intronic
1061752144 9:132786469-132786491 GACCCCCTCTCTGGGGGTCCAGG - Intronic
1061796330 9:133087731-133087753 CACCCACATCCTCTGGGTGCAGG + Intergenic
1061937477 9:133866145-133866167 CACCCACCCCCTGGGGGGCCTGG - Intronic
1062334014 9:136057018-136057040 GAGGCCCACCCTGGGGGTGGGGG - Intronic
1062528008 9:136985971-136985993 GACCCCCAGACTGGGGGCGCCGG + Intronic
1190157324 X:48004535-48004557 GACACACACACCGGGGGTGAAGG + Intronic
1190173094 X:48127420-48127442 GACACACACACCGGGGGTGAAGG + Intergenic
1190339773 X:49286979-49287001 GACCCAGACTCTGGGGGTCCTGG + Exonic
1195216921 X:102712249-102712271 GAGCCCCAGCCTGGGCGTGCGGG - Exonic
1195616158 X:106913763-106913785 GACCCACACCCTGAAGGACCTGG - Intronic
1195627568 X:107019826-107019848 GTCCCACATCCTGGGCATGCTGG + Intergenic
1198438835 X:136641921-136641943 GCCCCACCCCCTGGGTGTGTAGG + Intergenic
1200234419 X:154461416-154461438 GGCCCAGGCCCTGGGCGTGCCGG + Exonic
1200249093 X:154542646-154542668 GACCCACAGCCTGGGCAAGCAGG - Intronic