ID: 1112103726

View in Genome Browser
Species Human (GRCh38)
Location 13:96218177-96218199
Sequence CTGTGTCCCCAGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112103720_1112103726 30 Left 1112103720 13:96218124-96218146 CCAGGGATGATTCTGGGACTCAG 0: 1
1: 0
2: 1
3: 22
4: 237
Right 1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG 0: 1
1: 1
2: 3
3: 33
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112103726 Original CRISPR CTGTGTCCCCAGAGAGAAGT GGG Intronic
900393270 1:2443095-2443117 CTGTGCCCCCAGGGAGAACCAGG - Intronic
900640224 1:3684943-3684965 CCTTGTCCCCAGAGAGCAGCCGG - Intronic
900739208 1:4320437-4320459 CTGTGCTCCTAGAGAAAAGTTGG + Intergenic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
903293127 1:22327089-22327111 GTTTGTCCCCAGGGAGAGGTTGG - Intergenic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
905518605 1:38580366-38580388 CTGTGTTCCCAGTGGGACGTGGG - Intergenic
905668619 1:39777308-39777330 CTGCTTCCCCAGACAGAAGCTGG - Intronic
906277174 1:44525165-44525187 CTTTTTCCCCAGAGATAAATAGG - Intronic
906460355 1:46031482-46031504 TTGAGTCCCCAGAGAGCAGCCGG - Exonic
906647079 1:47482999-47483021 CTGTGGCCCCAGAGAGTGGGAGG + Intergenic
906926300 1:50120871-50120893 ATGTGTGGCCAGAGAGAAGATGG + Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
908139759 1:61172275-61172297 TGGTATCCCCAGAGAAAAGTGGG + Intronic
910747669 1:90591092-90591114 CTTTGTCCCAAGAGAGACTTTGG - Intergenic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
910882071 1:91930778-91930800 CTATGGACCAAGAGAGAAGTTGG + Intergenic
911688618 1:100805922-100805944 CTATGACACCAGAGAAAAGTGGG - Intergenic
914360043 1:146926787-146926809 CTCTGTTCCCACAGAGAAATAGG - Intergenic
914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG + Intergenic
915142860 1:153777747-153777769 CTGTGGCCCCTGCCAGAAGTGGG - Exonic
915477472 1:156161334-156161356 CTGTGCCCCCAGAATGACGTGGG + Exonic
915631301 1:157155504-157155526 CTGTGGCTCCAGAGAAGAGTGGG + Intergenic
916480917 1:165213583-165213605 CTGAGTGCACACAGAGAAGTGGG + Intronic
917963757 1:180165942-180165964 CTGGGTCCCCAGACAGAAACAGG - Intronic
918396745 1:184121203-184121225 CTGGTCCTCCAGAGAGAAGTAGG + Intergenic
922469761 1:225868826-225868848 CTGTGTCCCCAGAGATGGGGAGG + Intronic
924783485 1:247172866-247172888 CAGTGCCCAGAGAGAGAAGTGGG + Intergenic
1063125416 10:3132743-3132765 CTGTGTCCCAAGACTGCAGTGGG + Intronic
1063170836 10:3508606-3508628 CTAGGTCCCCAGAAAGAAGGTGG + Intergenic
1066632390 10:37469832-37469854 CTGTTTTCCCAGACAGAACTGGG - Intergenic
1067515584 10:46938783-46938805 CTGTGATCCCAGAGAGAAGGGGG - Intronic
1067646667 10:48113032-48113054 CTGTGATCCCAGAGAGAAGGGGG + Intergenic
1069820437 10:71224212-71224234 CTGTGTCTACATACAGAAGTGGG - Intronic
1070264263 10:74887053-74887075 CCCTGTCCCCAGAGAGACGGTGG - Intronic
1072532288 10:96330806-96330828 CTCTGTCCCCAGAGTGATGCAGG - Intronic
1075402938 10:122173848-122173870 CTGTGCCCCCAGAGAGGGGCTGG - Intronic
1075730563 10:124633075-124633097 CTGTGTCCACAGAGAGACAGAGG - Intronic
1075751287 10:124773570-124773592 CTGTGTCCCAAGAAAGAAGGAGG + Intronic
1076521668 10:131085111-131085133 CTGTGTCCCCACAGGGCAGAGGG - Intergenic
1079488607 11:20962513-20962535 CTGGGTCTCAATAGAGAAGTGGG - Intronic
1079686031 11:23360937-23360959 CCGTGTGGCCAGTGAGAAGTAGG - Intergenic
1081508139 11:43739540-43739562 CTGTGTCCTCACAGAGCAGAAGG + Intronic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082003445 11:47407323-47407345 CTGGGCCACCAGGGAGAAGTTGG + Intronic
1083150925 11:60791301-60791323 CTGAGTCCCAAGAGAGCACTTGG + Intronic
1083377717 11:62239436-62239458 CTGTGTCATCAGAGACAACTTGG - Intergenic
1083727369 11:64635595-64635617 CTGCCACCCCAGGGAGAAGTTGG + Intronic
1083894638 11:65613882-65613904 CTGGCTCCCCAGAGAGGCGTGGG - Exonic
1083896568 11:65622993-65623015 CTGTGTCCCCTCTGAGAAATGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086039779 11:82462338-82462360 CTGAGTCTTCAAAGAGAAGTAGG + Intergenic
1087193591 11:95282482-95282504 CTGTTTCTCCAGAGAAACGTAGG - Intergenic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090242988 11:125197124-125197146 CTCTGTCCCCTCAGAGAAGCAGG - Intronic
1090489691 11:127147853-127147875 CTTGCTCCACAGAGAGAAGTAGG - Intergenic
1091569294 12:1670447-1670469 CTGAGTGCCCAGGGAGAAGGAGG - Intergenic
1093908046 12:24715018-24715040 CTGTGTCACCATAGATTAGTTGG + Intergenic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1096795970 12:54077776-54077798 CTCTGTGCCCAGAGGGAATTAGG + Intergenic
1099844157 12:88007560-88007582 CTGTGTCCTCACACAGAAGAAGG + Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1103133232 12:118486488-118486510 CCGTGTCCCCAAAGGCAAGTTGG + Intergenic
1103379944 12:120486431-120486453 CTCTGTCCCCTGAGAGAACCAGG + Intronic
1104014453 12:124952760-124952782 CTTTGTCCCAAGGGAGAAGGAGG - Intronic
1105621650 13:22073319-22073341 CTGTATCCCCACAGATAAGTGGG - Intergenic
1106544768 13:30720924-30720946 ATTTGTGCCCACAGAGAAGTGGG - Intronic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1110531406 13:76602867-76602889 CTGTGTCCCCTGACAGATGTGGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112656066 13:101453731-101453753 CTTGGACCCCAGAGAGATGTGGG + Intronic
1112975190 13:105308973-105308995 CTGTTTCACCTGAGAGGAGTGGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116139229 14:40968434-40968456 CTTTGTCCCCAGATAGAGGCGGG + Intergenic
1118415826 14:65535630-65535652 CTGTGTTCCGAGAGAGTAGTTGG + Intronic
1119602481 14:75985908-75985930 CTGAGTCGCCTCAGAGAAGTCGG - Intronic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1122008241 14:98723839-98723861 CTGTGACCCCTGAAAGAAGAGGG + Intergenic
1122056889 14:99105133-99105155 CAGAGTCCCCGGAGAGAAGAGGG + Intergenic
1122133768 14:99620820-99620842 GGGTGTCCCCAGAGGGAAATGGG - Intergenic
1124137953 15:27051580-27051602 CTGTGTCCCCACACAGAGGAAGG - Intronic
1125610563 15:40966515-40966537 CTGTGTCCCCAGGGAGCAAATGG + Intergenic
1126115466 15:45203583-45203605 CAGTGTACCTAGAGATAAGTAGG - Intergenic
1126600736 15:50424619-50424641 CTCTGTCCGCGGAGAGGAGTGGG + Exonic
1126745892 15:51826256-51826278 CTGTGTCCCAAGAGGAGAGTAGG + Intergenic
1127294291 15:57596188-57596210 CAGTGCCCCCAGAGACAAATGGG - Intronic
1128712444 15:69882336-69882358 CCTTGTCCCCAGAGAAAATTAGG - Intergenic
1130014224 15:80174842-80174864 CTGTGTCCCTGGATAGCAGTAGG - Intronic
1130097630 15:80867756-80867778 CAGTATCCCTAGAGAGAAGAAGG - Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131693013 15:94846465-94846487 CTCTGTCCCCAAAGAGCATTTGG - Intergenic
1132602178 16:778275-778297 CTGTGTCCCCAGTGAGGACGAGG - Intronic
1132723921 16:1330656-1330678 TTGGGTCCTCAGAGGGAAGTTGG + Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133035291 16:3030864-3030886 CTGGGTCCCCAGCGGGGAGTAGG - Intronic
1133071353 16:3248780-3248802 CTCTGTCCCCTGAGAGGAGGTGG + Intronic
1133401683 16:5492193-5492215 CTGTATCTGCAGAGAGGAGTAGG - Intergenic
1133607869 16:7405885-7405907 CTGTGTCCCCAGGGTGCATTTGG + Intronic
1133895997 16:9929499-9929521 CTGTGGATTCAGAGAGAAGTGGG - Intronic
1134043402 16:11084599-11084621 CTCTTTCTCCACAGAGAAGTTGG + Intronic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135085907 16:19474308-19474330 CTATTTCCACAGAGAGAAGTGGG + Intronic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1136010949 16:27363193-27363215 CTGTGTCCCCAGAGAAATGTGGG + Exonic
1136487941 16:30585330-30585352 CGGTGTCCCCAGAGGCTAGTGGG - Intronic
1138519380 16:57562370-57562392 GTGTGTCCCCACAGAGACATGGG + Exonic
1140583937 16:76265433-76265455 TTATCTTCCCAGAGAGAAGTTGG - Intergenic
1140700817 16:77580110-77580132 TTGTGACCCCAGAGAGCAGGAGG + Intergenic
1141335183 16:83147772-83147794 CTGTGACCCCAGAGACCAGTGGG - Intronic
1141425206 16:83940379-83940401 CTGTGTCCCCAGAGCCCAGCAGG - Intronic
1142422164 16:89978284-89978306 CTGTGTCTCCACAGAGTAGAAGG + Intergenic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143142704 17:4750933-4750955 CTGTGTCCCCTGAGAAATGGGGG - Intergenic
1143573453 17:7775908-7775930 CTTTGTACCCAGAGAAAAGCGGG - Intronic
1144052008 17:11504896-11504918 CTGTGTCCCAAGAGGCAACTGGG + Intronic
1144372485 17:14605427-14605449 CTGAGTCCCCAAAGAGAAGTGGG - Intergenic
1144678352 17:17176144-17176166 CTTGGTCCCCAGAGACAAGCAGG + Intronic
1144877052 17:18403636-18403658 CTCTGTCCCCAGAGAGGTGATGG + Intergenic
1145155178 17:20540772-20540794 CTCTGTCCCCAGAGAGGTGATGG - Intergenic
1147132119 17:38415662-38415684 CAGGGCCCCGAGAGAGAAGTGGG - Intergenic
1147685964 17:42287136-42287158 CTGTGACCACACAGAGAAGGTGG + Intergenic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1148621280 17:49036274-49036296 TTGTGGCCCCAGAGCCAAGTGGG + Intronic
1148776389 17:50097790-50097812 CTGTGTTTCCAGAGAAAGGTGGG - Intronic
1154311019 18:13266220-13266242 CTGGGTCCACAGGAAGAAGTCGG - Intronic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1161374814 19:3933858-3933880 CGGTGTCCCCAGTGGGAAGGGGG + Intronic
1162025874 19:7893907-7893929 CTGATTCCCCAGACTGAAGTGGG + Intronic
1163263120 19:16203352-16203374 CGGAGTCCCCAGAGCGAAGCAGG + Intronic
1165040164 19:33063380-33063402 CTGTGTCACCTGGGAGAAGGAGG + Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165322985 19:35097634-35097656 CTGTTTCCCCTGTGAGAGGTGGG - Intergenic
1165901800 19:39172736-39172758 CTGTGTCCCCAGGGAGGGGAGGG + Intronic
1165952638 19:39482816-39482838 CTGGGTCCCGAGGGAGGAGTGGG - Intronic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1168122028 19:54256910-54256932 CCTTGTCCCCAGTGAGAAGAAGG + Intronic
1168134101 19:54338815-54338837 CCTTGTCCCCAGAGAGGAGGAGG + Intronic
1168144994 19:54415728-54415750 CTGGGTCCCGAGGGAGAAGGGGG + Intronic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
926734277 2:16060838-16060860 CTGGGTTCCAAAAGAGAAGTGGG + Intergenic
927219557 2:20694673-20694695 CTGTGCCTGCAGAGAGAAGCAGG - Intronic
927461400 2:23301523-23301545 CTGTGCCCCCATAGAGACTTGGG - Intergenic
928171818 2:29009301-29009323 CTGTGTGCCAACTGAGAAGTGGG + Intronic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
932425874 2:71634832-71634854 CTGTGTGCCCAGAAATCAGTGGG - Intronic
932584815 2:73021058-73021080 TTCTCTCCCCAGAGAGAAGTGGG - Intronic
932718819 2:74123539-74123561 CGGTAACCCCAGAGAGGAGTGGG + Intergenic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
934875592 2:97916505-97916527 CTGTGGCTGAAGAGAGAAGTGGG - Intronic
935333822 2:101997067-101997089 TTGTGTCCCCAGGGAGTGGTGGG + Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
938117690 2:128613009-128613031 CTGGGTCCCCAGGCAGAAGGGGG + Intergenic
938597283 2:132800942-132800964 CCGTGCCCCCAGAAAGAAGAGGG - Intronic
939101392 2:137898347-137898369 CTGTGTCCCAAGTGAGTGGTAGG - Intergenic
939477470 2:142704421-142704443 CTTTGTCCCCAGAGACAATGTGG - Intergenic
943374249 2:187055317-187055339 CTTTGTCCCCAGAGGGGATTTGG + Intergenic
943436158 2:187867894-187867916 CTGGATACCCAGAGAGGAGTTGG - Intergenic
944157461 2:196622316-196622338 CTGTGTCCCCAGAGTTAAATGGG - Intergenic
944524953 2:200609461-200609483 CTGCCTCCCCAGAGAGAAAAAGG - Intronic
944541427 2:200757360-200757382 CTCAGTCCTCAGTGAGAAGTGGG + Intergenic
946136298 2:217650360-217650382 CTGTGTGCCCAGGAAGATGTGGG - Intronic
946878949 2:224158618-224158640 CTCTGATCCCAGAGAGAATTTGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947795500 2:232891477-232891499 CTGTGTCCCCAGCCAGGAGAAGG - Exonic
948454762 2:238099846-238099868 CTGTGTCCCCAGAGATTCCTAGG + Intergenic
948817657 2:240521050-240521072 CTGTGCCTCCAGAGAAAACTTGG + Intronic
948823934 2:240565411-240565433 CTGCACCACCAGAGAGAAGTAGG + Intronic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1169728974 20:8766154-8766176 CTGTGTCCCCAGGGCACAGTAGG - Intronic
1171312378 20:24155034-24155056 GTGTGTCTCCAGGGAGAGGTTGG + Intergenic
1172299860 20:33841732-33841754 CTAAGTCCCCAGATAGAAGGGGG - Intronic
1173860039 20:46277372-46277394 CTGTGTCCACAGAGAGGACAAGG - Intronic
1174536000 20:51251851-51251873 CTGTGGCCCCAGAGAGACCCAGG - Intergenic
1175034086 20:55983363-55983385 CTTTGTGCCTAGAGATAAGTGGG + Intergenic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1175916760 20:62429595-62429617 CTGGGTCCCCAGGGAGAAGGTGG + Intergenic
1178305436 21:31486891-31486913 CTGTGGCCCCGGTGAGGAGTTGG - Intronic
1178482726 21:32993691-32993713 CTGTGTCCTCAGACAGTAGAAGG + Intergenic
1179607758 21:42528502-42528524 CTGTGTGTCCAGAGAGGGGTGGG - Intronic
1180057189 21:45365068-45365090 CTGGGACCCCAGAGAGTAGGAGG - Intergenic
1180187075 21:46145340-46145362 CTGGGGCCCCAGTGAGAAGCGGG - Intronic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183372853 22:37444778-37444800 CTGTGTTCCCAGCGCGTAGTAGG - Intergenic
1185274008 22:49942154-49942176 CTGTGTCCCAGGAAAGAAGAGGG + Intergenic
949474183 3:4427004-4427026 TTATGTCCCCAGGGAGAGGTGGG - Intronic
952342414 3:32457283-32457305 CTGTGGATCCAGTGAGAAGTAGG - Intronic
952662606 3:35869811-35869833 CTGTGGCCCCAGAGACATTTTGG - Intergenic
952752299 3:36834700-36834722 GGCTGCCCCCAGAGAGAAGTGGG + Intronic
954215534 3:49122362-49122384 CTGTGTCCCTATAGAGGAGGGGG - Exonic
954317045 3:49806841-49806863 CTTTGTCCACAGAGTGAAGCAGG - Intronic
954436990 3:50501508-50501530 CTCTGTCCCCAGCCAGAAGATGG - Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
957226840 3:77460088-77460110 CTGTGTACTCTGAGAGATGTTGG + Intronic
959812889 3:110639679-110639701 CTGTGTTCCCAGAGAGCAAGTGG - Intergenic
960180994 3:114577710-114577732 CTGTTTCCCCAGGCAGTAGTTGG - Intronic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
961043487 3:123693546-123693568 TGGTTGCCCCAGAGAGAAGTGGG + Intronic
961122458 3:124384592-124384614 CAGTGTCCCTGGAAAGAAGTGGG - Intronic
962751947 3:138440106-138440128 ATGTGTCACCAGAGAAAAGCAGG - Intronic
963716556 3:148810699-148810721 CTGTGTCCCCTCTGAGAAGAGGG + Intronic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
965527703 3:169739164-169739186 CTGTTTCTACAGAGAAAAGTTGG + Intergenic
968287380 3:197517001-197517023 CTTTGTCCTCAGAGAGATCTGGG - Intronic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
968915991 4:3497294-3497316 CTGTGTCCTCAGACAGCGGTGGG + Intronic
970579103 4:17458040-17458062 CTGTGTCCTCAGACAGCAGAGGG - Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
974345657 4:60677850-60677872 TTGTATCCCCAAAGAGAAGATGG + Intergenic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
976167643 4:82272290-82272312 CTCTGTCCCCAGGGAGATGGGGG - Intergenic
977285796 4:95105267-95105289 GTGTGTGCCAAGAGAGAAGTGGG + Intronic
980610157 4:135150338-135150360 CTGTGTTCCCAGAAAGATGATGG - Intergenic
980639644 4:135560572-135560594 GTGTGTACCCAGAGAGAAGGAGG - Intergenic
981515244 4:145600948-145600970 CTTTGTCCCCAGAAAATAGTTGG - Intergenic
981800506 4:148649736-148649758 ATGTGTCTGAAGAGAGAAGTTGG + Intergenic
984273306 4:177574775-177574797 CTGGGTCCCCAGATAAACGTGGG - Intergenic
985303565 4:188514764-188514786 CTGTTTCCCCAGAGAGGAACTGG - Intergenic
985585316 5:729371-729393 CTGTGTGCCCAGAGAGCACGGGG + Intronic
985598828 5:813698-813720 CTGTGTGCCCAGAGAGCACGGGG + Intronic
986233708 5:5888220-5888242 CTGTGTCTCCTGTGAGATGTTGG + Intergenic
986285853 5:6358536-6358558 CTGTGTCCCCATAGGAAAGCAGG + Intergenic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
987084671 5:14457517-14457539 CTGAGCCCACAGAGAGAAGCTGG + Intronic
988078802 5:26389032-26389054 CTGTGTGCCAAGAAAGAATTAGG - Intergenic
988237549 5:28564798-28564820 TGGTGGCCCGAGAGAGAAGTGGG - Intergenic
988673297 5:33405444-33405466 CTGTGTCCTCAGATAGTAGAAGG - Intergenic
991032942 5:62101427-62101449 CAGGGTCCTGAGAGAGAAGTGGG + Intergenic
995661790 5:114492433-114492455 CTTTTTCCCAAAAGAGAAGTAGG - Intronic
996390277 5:122952932-122952954 CTGGGACTCCAGAAAGAAGTAGG - Intronic
998386305 5:141758957-141758979 CTGTGACCCCGGAGAGGAGGAGG + Intergenic
999113002 5:149138179-149138201 CTTTTTCCCCTCAGAGAAGTTGG + Intergenic
1001517176 5:172364180-172364202 CAGAGACCCCAGAGAGAAGCGGG + Intronic
1002289336 5:178188925-178188947 CTGTGCCCCCAGAGCAATGTAGG + Intergenic
1003214327 6:4095221-4095243 CTGTGGCCACAGAGAAAAGAGGG - Intronic
1004602016 6:17159289-17159311 CTGTGTCCTCAGAGCCAAGGAGG + Intergenic
1006625030 6:35391886-35391908 CTTTGTCCCCAGACAAAAATGGG - Intronic
1007881275 6:45170045-45170067 CTGTGTTGAAAGAGAGAAGTGGG - Intronic
1010251664 6:73713658-73713680 TTCTCTCACCAGAGAGAAGTTGG - Intronic
1010863055 6:80937519-80937541 CTGTGTCACCCCAGGGAAGTGGG + Intergenic
1011558228 6:88590486-88590508 CTCTGTCCCCAGGGATAAGAAGG + Intergenic
1014352045 6:120357763-120357785 TTGCCTCCCCAGAGAGAAGGTGG - Intergenic
1015302232 6:131667077-131667099 TTCTCTCCCCAGAGAAAAGTTGG + Intronic
1018540323 6:164872876-164872898 CTGGGTCCACAGAGAAAAATGGG - Intergenic
1018830120 6:167435615-167435637 ATGTGTCCGCAGAGAGAATCCGG + Intergenic
1020092626 7:5350021-5350043 CTGAGACCCCACAGAGAAGCAGG - Intronic
1021882132 7:25105246-25105268 ATGGGTCCCCAGAGAGAATGTGG - Intergenic
1022647104 7:32241821-32241843 CTGTATCCACAGAGAGGAGATGG + Intronic
1024326707 7:48114692-48114714 CTGTGTCCTCAGTGAGAAGGAGG - Intergenic
1024557477 7:50615773-50615795 ATGTATCCCCAGTGAGAAGAAGG - Intronic
1029290263 7:99496980-99497002 ACGTGTCCCCACAGAGAAGAGGG - Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1030046379 7:105500657-105500679 CTGGGTTCCCTGAGAGAATTAGG + Intronic
1030087552 7:105829995-105830017 GTGTGTCCCCAGTGACAAGGAGG - Intronic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1032802780 7:135329741-135329763 CTGTGTCCCCACAAAGAAGAGGG - Intergenic
1033358595 7:140621647-140621669 CTCTGTTCCCTGAGAGAAGCAGG - Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033865414 7:145685716-145685738 TTGTGTCCCCAGTGGGAAGAAGG + Intergenic
1034162842 7:149005529-149005551 CTGTGGCCCCCGTGACAAGTGGG - Intronic
1034284955 7:149878544-149878566 CTGTGTTCCCAGGGTGAAGAAGG - Intronic
1035028993 7:155845074-155845096 CTGTGACCACAGATAGAAATCGG - Intergenic
1035415383 7:158679606-158679628 CTCTGACCCCAGAGAGCAGGGGG + Intronic
1035475716 7:159143119-159143141 TTGTGGCCCCACAGAGAAGAGGG + Intronic
1038253267 8:25926155-25926177 CTGTGTCCCCAGGTACCAGTGGG + Intronic
1038500880 8:28042542-28042564 CTGAGTCCCCAGGTAGAGGTGGG + Intronic
1041298958 8:56390953-56390975 CTTCCTCCTCAGAGAGAAGTAGG - Intergenic
1041940436 8:63381726-63381748 CTGAGGCCCCACAGAGCAGTGGG - Intergenic
1043519454 8:81028139-81028161 CTCTGTGCTCAGGGAGAAGTGGG + Intronic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1044882242 8:96735570-96735592 CTGTGTCCCCAAACAAAAGCTGG + Intronic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048577873 8:135707066-135707088 CTGTGTCCTCACAGAGCAGAAGG - Intergenic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1049612919 8:143563767-143563789 TTGTGTGCCCTGACAGAAGTGGG - Intergenic
1049647377 8:143741575-143741597 CTGTGTCCCTTGAGAGCAGCAGG + Intergenic
1050651105 9:7777864-7777886 CTGCTTCCCCAGAAAGAAGTGGG - Intergenic
1051890977 9:21942607-21942629 CTGTGTCCCCACATAGCAGAAGG - Intronic
1053785583 9:41650452-41650474 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054174302 9:61864418-61864440 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054449160 9:65393463-65393485 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054663236 9:67716373-67716395 CTCTGTACCCAGAGGGAATTAGG - Intergenic
1054995270 9:71380559-71380581 CTGTCTCCCTAAAAAGAAGTAGG - Intronic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1056280947 9:85040790-85040812 CTGTGTCCCAAGAGGGCAGCGGG - Intergenic
1058507596 9:105681973-105681995 CTGTCTCTCCAGAGAGACCTGGG - Intergenic
1058938476 9:109791414-109791436 CTGGGTCCACAGAGAAAAGCAGG + Intronic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1060245771 9:121945129-121945151 CTGTACCCACAGAGAGGAGTCGG + Intronic
1061419001 9:130463270-130463292 CTCTGTCCCCAGAGAGAAAATGG - Intronic
1062605805 9:137348474-137348496 GTGTGTGCCCAGAGAGGGGTGGG + Intronic
1062606209 9:137349981-137350003 GTGTGTGCCCAGAGAGGGGTGGG + Intronic
1186123218 X:6384925-6384947 CTGTGTTCATAAAGAGAAGTGGG + Intergenic
1186128230 X:6438873-6438895 CTTTGTCCCCATAGAGCAATGGG - Intergenic
1186381888 X:9069593-9069615 CTGAGGCCCCACAGAGAAGTTGG - Intronic
1186417289 X:9394743-9394765 GTGTGTTTCCAGAGAGAAGGGGG + Intergenic
1187301460 X:18054581-18054603 CTGTGTCCCCACAGTACAGTGGG - Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1191898108 X:66014922-66014944 CTGTATGCCAGGAGAGAAGTTGG + Intergenic
1192405799 X:70885110-70885132 TTCTCTCCCCAGAGAGAAGCTGG - Intronic
1192522620 X:71815342-71815364 CTCTGCCCCCAGAGAGGAGCTGG + Intergenic
1192604350 X:72499427-72499449 CTGTGTCCCAAGAGTGTATTTGG - Intronic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195328030 X:103773879-103773901 CTCTGTGCTCAGGGAGAAGTTGG + Intronic
1196904722 X:120420008-120420030 CTTTGGCACCAGAGAGAACTGGG + Intergenic
1197100732 X:122651289-122651311 CTTTGTCCTCAGACAGAACTAGG - Intergenic
1197339954 X:125255361-125255383 ATGTGTGCCTAGAGAGTAGTAGG - Intergenic
1197572615 X:128167589-128167611 TAGAGTCCCCAGAGACAAGTTGG + Intergenic
1197775770 X:130117867-130117889 ATGTGTCCTCAGAGTGAAGCTGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1201049917 Y:9922373-9922395 CTGTGTACCCAGTCTGAAGTAGG - Intergenic
1201338167 Y:12903083-12903105 CAGTGTTCCCAGAGTGAAGTTGG - Intergenic
1201610375 Y:15836226-15836248 CTTTGTGCCCATAGAGCAGTGGG - Intergenic
1201961107 Y:19681691-19681713 CTGTGTATCCATGGAGAAGTTGG + Intergenic