ID: 1112105051

View in Genome Browser
Species Human (GRCh38)
Location 13:96231189-96231211
Sequence CAGGATCAACAGGCACAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112105051_1112105061 26 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105061 13:96231238-96231260 TGATTCATTAGGTCTGGGGTGGG 0: 20
1: 96
2: 542
3: 1251
4: 2319
1112105051_1112105056 15 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105056 13:96231227-96231249 CATGCAGATTTTGATTCATTAGG 0: 1
1: 0
2: 39
3: 263
4: 939
1112105051_1112105059 22 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105059 13:96231234-96231256 ATTTTGATTCATTAGGTCTGGGG 0: 1
1: 25
2: 171
3: 661
4: 1809
1112105051_1112105060 25 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105060 13:96231237-96231259 TTGATTCATTAGGTCTGGGGTGG 0: 3
1: 27
2: 172
3: 736
4: 1801
1112105051_1112105057 20 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105057 13:96231232-96231254 AGATTTTGATTCATTAGGTCTGG 0: 1
1: 19
2: 211
3: 944
4: 2304
1112105051_1112105058 21 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105058 13:96231233-96231255 GATTTTGATTCATTAGGTCTGGG 0: 1
1: 18
2: 232
3: 908
4: 2287
1112105051_1112105062 27 Left 1112105051 13:96231189-96231211 CCTTACTGTGCCTGTTGATCCTG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1112105062 13:96231239-96231261 GATTCATTAGGTCTGGGGTGGGG 0: 4
1: 70
2: 409
3: 1038
4: 1968

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112105051 Original CRISPR CAGGATCAACAGGCACAGTA AGG (reversed) Intronic
900318044 1:2069193-2069215 CAGTTTCAACAAGCACAGCACGG - Intronic
900419857 1:2551417-2551439 CAGCAGCAACAGGCCCAGAAGGG - Intergenic
900424572 1:2570224-2570246 CAGTAGCAACAGGCCCAGAAGGG + Intergenic
900887187 1:5423402-5423424 CAGCCTCCACAGGCACAGCAGGG - Intergenic
906296969 1:44654871-44654893 CAGCAGCAACAGGCGCAGCATGG + Exonic
908416403 1:63917139-63917161 CAGGAGCCACAGGGAAAGTATGG - Intronic
909278921 1:73723797-73723819 CAGAATCAACATGCAGAGAAGGG + Intergenic
909459653 1:75895167-75895189 CTGAATCAACAGGCAAAGAAGGG + Intronic
912432112 1:109633615-109633637 CAGGATCAGCCTGCACAGCATGG - Intergenic
913194974 1:116448829-116448851 CAGGCACAAGAGGGACAGTAAGG - Intergenic
915275245 1:154783934-154783956 GAGGAGCAACAGGAACAGGAAGG + Intronic
915307177 1:154987227-154987249 CGAGACCAACCGGCACAGTATGG - Intronic
916017108 1:160759945-160759967 CTGAATCAACAGGCAAAGAAGGG - Intergenic
921147903 1:212377165-212377187 AAGGATCAACATGCACACTTGGG + Intronic
921702757 1:218286022-218286044 GAGGAGCAACAGACACAGCATGG - Intronic
921760301 1:218905990-218906012 CAGGATAAAGAGGCAGAGAATGG - Intergenic
1062938517 10:1405145-1405167 CAGGATCAACATGCATAATGGGG - Intronic
1066393809 10:34999818-34999840 CTGAATCAACAGGCAAAGAAGGG + Intergenic
1066721163 10:38341024-38341046 CAGGAGAAAGAGGCACAGCATGG - Intergenic
1068946609 10:62735832-62735854 CAGGATGAAGAGGCTCAGAAGGG + Intergenic
1070645099 10:78196302-78196324 CAGCAGCATCAGGCACTGTAGGG + Intergenic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1077942816 11:6861722-6861744 CAGGAACAACAGACACACTGGGG + Intergenic
1078640725 11:13093338-13093360 CAGGTTCAACAGGAACCGTGGGG - Intergenic
1078953880 11:16167608-16167630 AAGGAGCATCAGGGACAGTATGG - Intronic
1082870075 11:57936264-57936286 TAGGATTGACAGGCACAGGAAGG - Intergenic
1083763302 11:64830329-64830351 CAAGATAAACAGGCACAGCAGGG - Intronic
1085843575 11:80041118-80041140 CAGGAGCATCTGGCAGAGTAAGG - Intergenic
1086601894 11:88643231-88643253 CAGGAGCAAAAGACAGAGTAGGG + Intronic
1086819793 11:91421699-91421721 CAAGATCAGGAGGCACAGTGTGG + Intergenic
1087349378 11:97011805-97011827 GAGGATTGACAGACACAGTAAGG + Intergenic
1087969806 11:104465739-104465761 CAGGAGAAATAGGCACAGAAAGG + Intergenic
1091212637 11:133875196-133875218 CTGCATCAACAGGCAAAGGAGGG + Intergenic
1092072709 12:5645908-5645930 CAGGATAGAAAGCCACAGTAGGG + Intronic
1092189667 12:6509843-6509865 CAGGACTAACATGCACAGTTAGG - Intronic
1092272607 12:7035354-7035376 CTGAATCAACAGGCAAAGAAGGG + Intronic
1102366526 12:112341259-112341281 AAGGAGCAACAGACACAATAAGG + Intronic
1102522494 12:113487347-113487369 AAGGAACAACAGGCTCAGAAGGG - Intergenic
1104170745 12:126278011-126278033 CAGGATCACCATGCAAAGTGAGG - Intergenic
1104856602 12:131905134-131905156 CAGGATCCACAGACACTGCAGGG - Intronic
1106373807 13:29164045-29164067 CGGGAACCACAGGCACAGTAGGG - Intronic
1107181912 13:37471364-37471386 CAGGTTCAGCAGGCCCAGTAGGG - Intergenic
1107275542 13:38674373-38674395 TTGAATCAACAGGCAAAGTAGGG + Intergenic
1110286843 13:73759659-73759681 CTGGATGAACAGGCACAGAGAGG + Intronic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1112105051 13:96231189-96231211 CAGGATCAACAGGCACAGTAAGG - Intronic
1112433174 13:99370799-99370821 CAGGATTAACAGGTGGAGTATGG + Intronic
1114463822 14:22906065-22906087 CAGGATACTCAGGCACAGAAAGG - Intronic
1117486538 14:56203687-56203709 CAGGAGCACCTGGCACAGTAAGG - Intronic
1118083010 14:62383345-62383367 TAGGTTCAAATGGCACAGTAAGG + Intergenic
1119444049 14:74648808-74648830 CAGGATCCACAGGCACCTTGCGG + Intergenic
1122229716 14:100299716-100299738 CAGGAGAAACAGGCTCAGTGAGG + Intronic
1123772781 15:23545809-23545831 CAGGATCAATAGGCAAAGAAAGG - Intergenic
1129612135 15:77069779-77069801 GAGGAGGAAGAGGCACAGTATGG + Intronic
1129790061 15:78335176-78335198 CAGGATCAACAGGTTGAGTTTGG - Intergenic
1131573889 15:93567016-93567038 CTGGATTAACAAGCACTGTATGG - Intergenic
1131662694 15:94535498-94535520 CTGAATCAACAGGCAAAGCAGGG - Intergenic
1132300217 15:100770631-100770653 AAGGTTCCAGAGGCACAGTAGGG - Intergenic
1132664860 16:1076841-1076863 CAGGATCCACAGAGACAGCATGG - Intergenic
1132936046 16:2481794-2481816 CAGGCTCAGCAGCCACAGTTAGG + Intronic
1137365940 16:47859498-47859520 CAGGATCTGCAGGCACAGCTGGG + Intergenic
1140174972 16:72649452-72649474 CTGAATCAACAGGCAAAGAAAGG + Intergenic
1141838731 16:86560266-86560288 CAGGCTCAAAAGCCACAGTCTGG - Intergenic
1142202235 16:88766770-88766792 CAGGATCACCAGCCCCAGAACGG + Intronic
1143429776 17:6872582-6872604 CAGGATCAACAGACATATTGGGG - Intergenic
1145789285 17:27615253-27615275 CTCCATCAACAGGCACAGCATGG - Intronic
1146998503 17:37342592-37342614 CAGGAACATAAGGCACAGTTTGG - Intronic
1147966081 17:44194905-44194927 CAGGAGCCACAGGCACAGACAGG + Intronic
1151021019 17:70617578-70617600 CAGGATTATCAGGCACAGGGAGG - Intergenic
1151775323 17:76197261-76197283 CAGGAGAAACAGTTACAGTAAGG + Intronic
1156710213 18:39935111-39935133 CTGGATCAATAGGCAAAGAAGGG + Intergenic
1158878986 18:61758358-61758380 CAGAATCATAAAGCACAGTATGG - Intergenic
1161475697 19:4483605-4483627 CAGGAAGGACAGGCAGAGTAAGG - Intronic
1163669962 19:18621644-18621666 CAGGGACATCAGGCACAGGAAGG - Intergenic
927205806 2:20609595-20609617 CAGGGCCTACTGGCACAGTATGG - Intronic
927759462 2:25739649-25739671 CAAGATGAAGAGGCACAATATGG + Intronic
928916985 2:36482865-36482887 CAGTAACAACAGCCACAATAAGG - Intronic
930013600 2:46956074-46956096 CAGGATCCCAAGCCACAGTAGGG + Intronic
932718195 2:74118415-74118437 CAGTATCAGTAAGCACAGTACGG + Intergenic
932779848 2:74553375-74553397 CAGGGTCAAGAGGCCCAGGAGGG + Intronic
934183418 2:89649504-89649526 CAGGACCAGCAGGCACAGCCTGG + Intergenic
935516545 2:104047339-104047361 CAGGGTCAAGAGGCACAAGAAGG - Intergenic
935570737 2:104658485-104658507 CAGCAGCAACAGGCACAGTGGGG + Intergenic
938215614 2:129510660-129510682 CTGAATCAACAGGCAAAATATGG + Intergenic
941139993 2:161768286-161768308 CAGGCTCAGCAGCCAGAGTAGGG - Intronic
942895508 2:181048440-181048462 TAGGTTCACAAGGCACAGTATGG + Intronic
943207371 2:184918207-184918229 CTGAATCAACAGGCAAAGGAGGG - Intronic
943384516 2:187184888-187184910 CAGGATCAGCTGGCAGAGAAAGG - Intergenic
944462142 2:199961011-199961033 CAGAATCACCAGGCACAGTAAGG + Intronic
944752090 2:202719969-202719991 CTTGATCCACAGGCACAGAAAGG - Intronic
946213403 2:218165050-218165072 CAGGCTCAGCAGGAACACTAGGG + Exonic
946355641 2:219182644-219182666 AAGGAGCTGCAGGCACAGTAGGG + Exonic
947677032 2:231991666-231991688 CAGGAATTACAGGCACAGTTTGG - Intronic
1175371253 20:58494756-58494778 CAGGAATCACAGGCAAAGTACGG - Intronic
1175504517 20:59472192-59472214 CAGGAAAAACAGGAACAGTTTGG - Intergenic
1178252238 21:31014856-31014878 CAGGTCCAACAGTCACAGTAAGG - Intergenic
1178594959 21:33945012-33945034 CAGGATCAACAGGCAGAGCACGG + Intergenic
1184765648 22:46570638-46570660 CGGGAACAACAGCCACAGTGTGG + Intergenic
1185290995 22:50027670-50027692 CAGGGTCACCAGGCCCAGTCCGG - Intronic
949185574 3:1187788-1187810 CAGGAGGCACTGGCACAGTAGGG - Intronic
950477894 3:13225274-13225296 CAGGATCAAAAGGCACCATGGGG - Intergenic
953050777 3:39340971-39340993 CAGGAGCAACAGATACAGAAGGG + Intergenic
953727644 3:45414565-45414587 CATGATCAAAAAGCAAAGTAAGG + Intronic
954296309 3:49676282-49676304 CAGGTCTGACAGGCACAGTATGG - Intronic
956125005 3:66002877-66002899 CAGGTACAACAAGCATAGTAAGG + Intronic
956935571 3:74096946-74096968 CAGGATGAAAAGGAAGAGTAAGG + Intergenic
957953592 3:87155046-87155068 CAGGATTAACAGGTTCAATAAGG + Intergenic
959352136 3:105279160-105279182 CTGAATCAACAGGCAAAGAAGGG - Intergenic
961492613 3:127265791-127265813 CAGGAGGAGCAGGCACAGCAGGG + Intergenic
961786666 3:129351668-129351690 CAGGATCAAAAGGCACCATGGGG + Intergenic
962803708 3:138911947-138911969 CTGGAGAAACAGGCACATTAAGG - Intergenic
964012220 3:151904656-151904678 CAGGACCAAGAGGGAGAGTAGGG - Intergenic
965825813 3:172728416-172728438 CAGAATCAATAAGCACAGTGGGG - Intergenic
967791829 3:193558105-193558127 CAGGCTGATCAGGAACAGTAGGG - Intronic
976768061 4:88619105-88619127 CAGGATGACCAGCCACAGGAAGG - Intronic
977089275 4:92650558-92650580 CTGAATCAACAGGCAAAGAAGGG - Intronic
978485706 4:109251568-109251590 CTGAATCAACAGGCAAAGAAGGG - Intronic
979184349 4:117770301-117770323 CAGGTTCAGCTGGCAGAGTAGGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984558843 4:181244387-181244409 CAGGATCACCCCGCACAGTTGGG - Intergenic
986166301 5:5274345-5274367 GAGGATGAACAGGCAGAGCATGG - Intronic
986707548 5:10464040-10464062 CAGGCTCCACTGGCACAGGAAGG - Intronic
989605292 5:43238880-43238902 CAGGAACACAAGGCACAGGACGG - Intronic
990604675 5:57396577-57396599 CAGGGTCAAAAGGCATAGGATGG - Intergenic
991465701 5:66910092-66910114 GAGCATCAACACCCACAGTATGG + Intronic
991521877 5:67508626-67508648 CAGAAGCAACAGGGACAGTATGG - Intergenic
992368713 5:76119951-76119973 AAGAATCTACAAGCACAGTAAGG + Intronic
994493769 5:100483720-100483742 AGGGATGAACAGGCAGAGTATGG + Intergenic
996927150 5:128841237-128841259 CAGAATCAACATGCCCAGTATGG - Intronic
1001913753 5:175542315-175542337 CAAGATCAACAGGCCCTGAAAGG + Intergenic
1004298800 6:14438323-14438345 CTGAATCAACAGGCAAAGAAAGG + Intergenic
1007218648 6:40261309-40261331 CAGGATCAATAGTCACAATCTGG - Intergenic
1010451142 6:76004637-76004659 CAAGATCATCAGGCACACTTAGG - Intronic
1011709895 6:90042537-90042559 CAGGTGCACCAGGCACAGTGTGG + Intronic
1012477434 6:99629748-99629770 TAGGAGCACCAGGCAGAGTAGGG - Intergenic
1014965409 6:127742018-127742040 CAGAATCACCAGGCTGAGTATGG + Intronic
1015579322 6:134706261-134706283 CAGTAATCACAGGCACAGTATGG + Intergenic
1018786715 6:167114090-167114112 CAGGATCAAGATGCAAAGCAGGG + Intergenic
1021392492 7:20110523-20110545 CCAAATCAATAGGCACAGTAAGG - Intergenic
1027416979 7:77983910-77983932 TAGGATCAGTAGGCTCAGTAGGG - Intergenic
1032316861 7:130845840-130845862 CAGGATCAAAAGGCAAAGGCAGG + Intergenic
1032635340 7:133701356-133701378 CAAGATCAACAGGCTCAAAATGG + Intronic
1034203842 7:149298994-149299016 CTGGATCATCAGGGACAGGATGG - Intergenic
1035356325 7:158277922-158277944 CAGGACCACCAGGCACACAAGGG + Intronic
1038195147 8:25360404-25360426 CAGGCGCAAGAGGCCCAGTATGG + Intronic
1040395608 8:46997388-46997410 CAGGGTCAACATGCACTCTAGGG + Intergenic
1042386309 8:68179075-68179097 CACCATCATCATGCACAGTAGGG - Intronic
1042801931 8:72728367-72728389 CAGGATTAACAGGAATAGGATGG - Intronic
1044159847 8:88899465-88899487 CAAGATGAAGAGGCAGAGTAAGG - Intergenic
1047440495 8:124873220-124873242 TAGGATGAACAGGCAGAGAAAGG - Intergenic
1047590562 8:126322508-126322530 CAGGGACAACAGGCACATCAAGG - Intergenic
1050614531 9:7388241-7388263 CAGGATCAACTGGCAGAGGGTGG - Intergenic
1051077215 9:13253417-13253439 CAGGAGTATCAGGCACAGAAAGG - Intronic
1051110184 9:13627056-13627078 CAGGTTCAACAGTTACACTAGGG - Intergenic
1051586431 9:18731777-18731799 CAGGAGCAAGAGGGACAGTGAGG + Intronic
1051743322 9:20272371-20272393 CAGGATGAACTGCCACATTAAGG - Intergenic
1052251617 9:26405060-26405082 GAAGATCAGCAGGCTCAGTAAGG - Intergenic
1056680681 9:88714957-88714979 CAGGACGATAAGGCACAGTATGG + Intergenic
1056963358 9:91145779-91145801 CAGGATCACGAGGCAAAGCAAGG + Intergenic
1057508408 9:95656199-95656221 AAGGATGAACAGGCAGAGCATGG - Intergenic
1061276639 9:129572535-129572557 CAGGACCAACATGCAAAGAAAGG + Intergenic
1187492138 X:19761993-19762015 CAGTATCAAAAGGGACAGTCTGG + Intronic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1194424216 X:93716994-93717016 CTAAATCAACAGGCACAGAAGGG - Intergenic
1198546777 X:137700861-137700883 TAGGATCAACATGAACAGTATGG + Intergenic
1199609448 X:149600426-149600448 GAGGACCACCAGGCACAGAAAGG + Exonic
1199629669 X:149768928-149768950 GAGGACCACCAGGCACAGAAAGG - Intergenic