ID: 1112108447

View in Genome Browser
Species Human (GRCh38)
Location 13:96267791-96267813
Sequence ACAGGGAAGTAGGCAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1119
Summary {0: 1, 1: 0, 2: 6, 3: 106, 4: 1006}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112108447 Original CRISPR ACAGGGAAGTAGGCAGGGGA AGG Intronic
900394090 1:2446093-2446115 ACAGGGAAGCAGGACGGGGGTGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900559683 1:3297754-3297776 ACAGGGAGGGAGTCAGGGAAGGG + Intronic
900576329 1:3384262-3384284 ACAGGGCAGGAGGGAGGGCAGGG - Intronic
900699007 1:4032410-4032432 ACACGGAAGCAGGAAAGGGATGG - Intergenic
900715219 1:4139812-4139834 ACAGGGAAGTGGGGATGGGGCGG + Intergenic
900725530 1:4214131-4214153 GGAGGGAAGTAGGTAAGGGAGGG - Intergenic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900790080 1:4674172-4674194 GCAGGGCAGTGGGCAGGAGAGGG + Intronic
900905230 1:5552420-5552442 ACAGGGAGGCAGGGATGGGATGG + Intergenic
901222934 1:7594184-7594206 ACAAGAAAGGAGGGAGGGGAAGG + Intronic
901447997 1:9319753-9319775 ACAGGGAAGTCGGCCTGGGGTGG + Intronic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901758187 1:11454084-11454106 ACGGGGAAGTGGGGAGGAGAGGG - Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902121191 1:14167430-14167452 ACAAGGATGGAGGCAGGGCATGG + Intergenic
902137916 1:14326668-14326690 ACAGGGAAGGATGCAGGGAGTGG - Intergenic
902359756 1:15935973-15935995 ACAGGGACGGGGGCAGGGGTGGG - Exonic
902364116 1:15959606-15959628 AGAGGGAAGGAGGGAGGAGAGGG + Intronic
903170832 1:21552135-21552157 AAAAGGAAGGAGGGAGGGGAGGG - Intronic
903283051 1:22261258-22261280 ACAGAGCTGTAAGCAGGGGAGGG + Intergenic
903346153 1:22685564-22685586 ACAGGGAAGGAGGAATGGGCTGG - Intergenic
903672472 1:25044969-25044991 AGAAGGAAGAAGGGAGGGGAAGG + Intergenic
903807807 1:26017806-26017828 ACAGGGATGAAGGTAGGAGAAGG + Intergenic
903975269 1:27145653-27145675 ACAGGGAAGGGGGCCTGGGAAGG + Intronic
904348513 1:29889862-29889884 AATGGGAAGGAGGCAGGAGATGG + Intergenic
904420516 1:30387986-30388008 CCAGGGAAGTAGGCAAGGCTGGG + Intergenic
904470481 1:30732646-30732668 ACAGGGAAGCAGGCACAGGAGGG + Exonic
904696423 1:32334316-32334338 ACAGGGAAGGAGGTAGGGCCAGG + Exonic
905245411 1:36609902-36609924 AGAGGGAAGGAGACAGGGCAAGG + Intergenic
905305297 1:37013731-37013753 CCAGGGAAGAATGCAGAGGAGGG + Intronic
905309132 1:37037420-37037442 GGAGGGAAGGAGGGAGGGGAGGG - Intergenic
906127412 1:43435733-43435755 ATAGGGAAAGAGCCAGGGGAGGG + Intronic
906832122 1:49044199-49044221 AGAGGGAAGTAGGAAGAGGCAGG + Intronic
907077717 1:51593472-51593494 ACAGGAAAGTGTGAAGGGGAGGG - Intronic
907173617 1:52497122-52497144 GCAGCCAAGTGGGCAGGGGAAGG + Exonic
907257290 1:53189543-53189565 ACAGGCAAAAAGGCAGGGGAAGG + Intergenic
907336910 1:53705725-53705747 AAAGGGAAGAAGGGAGGTGAGGG + Intronic
908131102 1:61076436-61076458 TTAGGGGAGTAGGAAGGGGAGGG + Intronic
908262450 1:62349520-62349542 AGGGGGAAGTGGGGAGGGGAAGG + Intergenic
908295345 1:62707225-62707247 ATAGGGAAGGGGGCTGGGGAGGG + Intergenic
908387221 1:63654041-63654063 ACAGGGAAGTGGGGAGAGGAGGG + Intronic
908524341 1:64973322-64973344 GGAGGGAAGGAGGGAGGGGAGGG + Intergenic
909422850 1:75485599-75485621 ACTGGGAAGCAGGCAGAGGTTGG - Intronic
909971708 1:81998447-81998469 GCAGGAAGGTAGGCAGGGGCTGG - Intergenic
910089161 1:83441877-83441899 ACAAGGAAGGAGGCTGGGCATGG + Intergenic
912222681 1:107696431-107696453 AAAGGGGAGTAGGCAGAGGTTGG - Intronic
912511383 1:110192461-110192483 CCAGGTAAGAAGGCAGGGGTGGG - Intronic
912745599 1:112243207-112243229 GCTGGGGAGTGGGCAGGGGAGGG - Intergenic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
913085210 1:115430505-115430527 ACTGGGGAATAGGCAGGGAAGGG - Intergenic
913529237 1:119721797-119721819 GCAGGGAAGTGGGGAGGGCAAGG - Intronic
914045173 1:144085515-144085537 ACAGGCAAATCAGCAGGGGATGG - Intergenic
914132937 1:144875171-144875193 ACAGGCAAATCAGCAGGGGATGG + Intergenic
914675363 1:149904001-149904023 ACAGGGAGGGGAGCAGGGGAGGG - Exonic
914788493 1:150854891-150854913 AGAGGGAAGGAGGGAGGGAAAGG + Intronic
914931200 1:151935324-151935346 ACAGGGGAGCTGGGAGGGGAAGG + Intergenic
915127535 1:153676598-153676620 GCAGGGAAGAGGGCAGTGGAGGG - Intergenic
915311696 1:155008543-155008565 AGAAGGAAGAAGGGAGGGGAGGG - Intronic
915507759 1:156368278-156368300 ACAGGGAAGCAGGCTGGGCAGGG - Intergenic
915616852 1:157045830-157045852 GCAGGGAAGGAGGGAGGGAAGGG - Intergenic
915691565 1:157695931-157695953 ACGGGGAGGGAGGGAGGGGAGGG - Intronic
915910001 1:159909001-159909023 ACAGGGAAGAGAGGAGGGGAAGG - Intergenic
916143835 1:161722959-161722981 ACAGGAAAGAAGGAAGAGGAAGG - Intronic
916242922 1:162657828-162657850 ACTGGGGAGTGGGGAGGGGAAGG - Intronic
916416683 1:164598853-164598875 ACCCGGAGGTAGGAAGGGGAGGG + Intronic
916564199 1:165958872-165958894 AGAGGGAAGATGGCAGGGAAGGG + Intergenic
917554348 1:176068209-176068231 AGAAGGAAGAAGGAAGGGGAAGG - Intronic
917838647 1:178960105-178960127 TAAGGGAAGAAGGCAGGGCATGG - Intergenic
917842155 1:178989593-178989615 CCAGGCAATTAGGCAGGAGAAGG - Intergenic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918393254 1:184088279-184088301 TGAGGGGAGTAGGAAGGGGAAGG + Intergenic
919393133 1:197012772-197012794 ACAGGGAAGTAGTAAGGTAAAGG - Intergenic
919689423 1:200515760-200515782 AGAGGGAAGGAAGCAGGGAAGGG + Intergenic
919753930 1:201054782-201054804 ACAAGGAAATAAGAAGGGGAGGG + Intronic
919805503 1:201378993-201379015 ACAGGGAACTATGGAGGGGATGG - Intronic
919931969 1:202226856-202226878 ACAGGGTAAGAGGCAGTGGAGGG + Intronic
920085081 1:203409410-203409432 ACAAGGAAACAGGCAGGGGCAGG + Intergenic
920398193 1:205661304-205661326 AAAGGGAAGGAGGCAAAGGAGGG + Intronic
920499470 1:206477219-206477241 ACAGGGAAGTAGCAAGTGGCTGG + Intronic
920717034 1:208349826-208349848 AAAGGGAGGCAGGCAGAGGAGGG + Intergenic
920724753 1:208423670-208423692 ACAGGGAAAGAGGAAGGGGCGGG + Intergenic
920912552 1:210232561-210232583 GCAGGGAAGGAGGCAGGGGGCGG + Intergenic
920967049 1:210709630-210709652 ACAGGGAAGTAGAAATGGGTGGG + Intronic
920967107 1:210710377-210710399 ACAGGGAAGTAGAAATGGGTGGG + Intronic
921308822 1:213823017-213823039 CCTGGGAAATAGGCAGGGTAAGG - Intergenic
921763564 1:218944218-218944240 ACAGGAAGGTAGGTAGGTGAGGG - Intergenic
921983372 1:221283182-221283204 CCAGGCAAGGAGGAAGGGGAAGG - Intergenic
922097789 1:222457344-222457366 ACTGGGAAATAGGCAGAGGTTGG + Intergenic
922746188 1:228045473-228045495 GCAGGGCAGATGGCAGGGGAAGG + Intronic
922936912 1:229430347-229430369 CCTGGGAAGGAGGCAAGGGAGGG - Intergenic
923714018 1:236409852-236409874 ACAGGCAAGTAGGCCAGGTACGG - Intronic
923890379 1:238208860-238208882 CCAGGCAATTAGGCAGGAGAAGG - Intergenic
924436531 1:244048506-244048528 GGAGGGAGGGAGGCAGGGGAAGG + Intergenic
924453882 1:244202331-244202353 ATAGGGAAGAAGGGAAGGGAAGG + Intergenic
1062777279 10:162946-162968 ACACAGAAGAAGGCAGGGAACGG - Intronic
1062823842 10:554611-554633 ACAGGGCAGTGGGGAGGAGAAGG - Intronic
1062984289 10:1753169-1753191 CCACAGAAGTAGGCAGGGTAGGG + Intergenic
1063057052 10:2517056-2517078 ATAAGGAAGGAGGCAGGGGCAGG - Intergenic
1063365192 10:5486346-5486368 AAAGGGAAGGAGGGAGAGGAGGG + Intergenic
1063464805 10:6236189-6236211 ACATGGAAGAAGCCAGGAGATGG - Intergenic
1063698595 10:8362351-8362373 ACAGGCAAATAGGAAGGGAATGG - Intergenic
1063805342 10:9632849-9632871 ACAGCAGAGTAGGCAGCGGAGGG + Intergenic
1063884382 10:10562796-10562818 GCAGGGAGGTAGGCTGTGGAGGG - Intergenic
1063968990 10:11368154-11368176 CCAGGGAGGAAGGCTGGGGAGGG + Intergenic
1063972197 10:11389036-11389058 ACAGGGAATGAGGCAGAGGTGGG - Intergenic
1064000060 10:11656276-11656298 AAAGGTAGGTATGCAGGGGAGGG - Intergenic
1064361241 10:14666745-14666767 ACAGGGAACTTGGGAGGAGATGG + Intronic
1064403519 10:15040581-15040603 AAAGGGAAGTGGGGAAGGGAAGG - Intronic
1064460333 10:15529002-15529024 ACAGGGAGGAAGGAAGGGGAAGG - Intronic
1064609246 10:17079960-17079982 AGAGGGAAGGATGCAGGGGAAGG + Intronic
1065527562 10:26638330-26638352 ACAGGGAAAGAGGAAGGGGTGGG - Intergenic
1065749658 10:28874162-28874184 ACATGGCAGCAGGCAGGAGAGGG + Intronic
1066411501 10:35174847-35174869 TCAGGGAAGTAGTGAGGAGATGG + Intronic
1066957289 10:42185208-42185230 ACAGGCAAATCAGCAGGGGATGG - Intergenic
1067147901 10:43706703-43706725 CCAGCGAAGTAGGCGGGGAAGGG + Intergenic
1067163023 10:43842971-43842993 AGAAGGAAGGAGGAAGGGGAAGG + Intergenic
1067436679 10:46283522-46283544 ACAGGGTAGTCTGCAGGGCAGGG + Intergenic
1067557932 10:47285372-47285394 AGAGGAAAGAAGGCAGTGGAGGG + Intergenic
1067720471 10:48724090-48724112 GCCCGGAAGTGGGCAGGGGAAGG - Intronic
1067986205 10:51148972-51148994 TCACTGAGGTAGGCAGGGGATGG - Intronic
1068154377 10:53178150-53178172 AAAGGGTAGAAGGCAGGTGAGGG - Intergenic
1068261742 10:54592298-54592320 GAAGGGAAGGAGGGAGGGGAGGG - Intronic
1068756526 10:60660758-60660780 ACAGAGAAGTAGGGATAGGATGG + Intronic
1068781905 10:60928636-60928658 AAAGGGGAGTAGAAAGGGGATGG + Intronic
1068846424 10:61680867-61680889 ACAGGGAAGAAAGAAGGGGAAGG + Intronic
1069344739 10:67455472-67455494 ACAGGAGAGTAGGAAGGGGAAGG + Intronic
1069613693 10:69792635-69792657 ACAGGGCAGTGGGCTGGGGTGGG - Intergenic
1070311424 10:75276402-75276424 ACCGGGAAGGAGGGAGAGGAGGG - Intergenic
1070510000 10:77152439-77152461 ACAGGAAAGTGGGGAGGAGATGG + Intronic
1070804917 10:79265272-79265294 ACAGGGAAGCAGGTAGGGCAGGG + Intronic
1071088971 10:81897280-81897302 ACAGGGACCTAGGTAGGGGAAGG + Intronic
1071523882 10:86347124-86347146 ACAGGAGAGTAAGGAGGGGAAGG - Intronic
1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG + Intergenic
1072490721 10:95903727-95903749 ACAGGGAATAAGTCTGGGGAGGG + Intronic
1073119686 10:101113924-101113946 AAAGGGAGGGAGGGAGGGGAGGG + Intronic
1073990718 10:109259555-109259577 GCAGGGGAGGAGGAAGGGGAGGG - Intergenic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1074533951 10:114315479-114315501 ACAGGGAAGGAGGGACAGGATGG - Intronic
1074724131 10:116289926-116289948 ACAGGGAAGCAGGAAGGGAGAGG - Intergenic
1074866577 10:117547461-117547483 ACAGGTGAGCAGGAAGGGGATGG - Intronic
1074987085 10:118668292-118668314 TCAGGGAGGTAGGGAGGGGTGGG + Intergenic
1075599976 10:123760659-123760681 AGAGGGGAGTCCGCAGGGGATGG + Intronic
1075851905 10:125595794-125595816 GCAGAGAAGTAAACAGGGGAAGG - Intronic
1076365571 10:129919382-129919404 ACAGGGAATAAGGCTGGGGAAGG + Intronic
1076500394 10:130931856-130931878 GCAGGGATGTGGGCAGTGGAGGG + Intergenic
1077111518 11:864167-864189 CCAGGGATGGGGGCAGGGGAGGG + Intronic
1077600206 11:3569428-3569450 ACAGGGAAGTGTGCAAGGGTGGG - Intergenic
1077817847 11:5705053-5705075 GCAGGGAATGAGGCAGGGTAGGG - Intronic
1078059318 11:8033130-8033152 ACAGGGAAGCGGGCAGGCGAGGG - Intronic
1078414337 11:11153073-11153095 ACAGGTCAGGAGGCAGGTGAGGG + Intergenic
1079241981 11:18727877-18727899 ACAGGAAGGAAGGCAGTGGAGGG + Intergenic
1079334542 11:19559753-19559775 ACAGGAAAGGAGCCTGGGGATGG + Intronic
1080415450 11:32065827-32065849 ACAGGGATGTAGTCAGGGTTTGG - Intronic
1081022126 11:37959629-37959651 ACTGGGTAATAGGCAGGGGTTGG - Intergenic
1081108394 11:39100993-39101015 ACTGGGAAACAGGCAGGGGTTGG - Intergenic
1081582300 11:44360613-44360635 ACACTGATGTAGGCAGGAGATGG - Intergenic
1081669207 11:44933842-44933864 ACCGGGAAGCAGGCAGGAGTGGG + Exonic
1081692296 11:45086741-45086763 CCAGGAAGGTAGGCAGGGGCTGG - Intergenic
1081702047 11:45158359-45158381 GCAGGGAGGGAGGCAGGGGCTGG - Intronic
1081837954 11:46173525-46173547 TCTGGGAGGTAGGCAGGGGGCGG + Intergenic
1081865505 11:46357562-46357584 ACAGGGAATTCCACAGGGGAGGG - Intronic
1082075816 11:47975440-47975462 AAAGGAAAGAAGGCAGGGCACGG - Intergenic
1082105076 11:48213064-48213086 ACATGGAAGAAGGCTGGGCATGG + Intergenic
1082134286 11:48529912-48529934 ACAGGCAATTAGGCAGGAGAAGG - Intergenic
1082869623 11:57932051-57932073 ACAGGTAAGTGGGCTGGGGGTGG - Intergenic
1083045297 11:59729140-59729162 ACAAGGAGGAAGGAAGGGGATGG - Intronic
1083800786 11:65045211-65045233 TCAGGAAAGCAGGCAGGAGAGGG + Exonic
1083804473 11:65065951-65065973 ACTGGGGTGTAGGCGGGGGAGGG - Intergenic
1083904350 11:65660403-65660425 ACAGGGAGGCTGGCAGGGGCAGG - Intronic
1083976421 11:66125195-66125217 AAAGGGCAGGAGGCAGGTGAGGG + Intronic
1083996364 11:66274978-66275000 ACAGGTTAGAAGGCAGGGGCTGG - Intronic
1084256118 11:67944042-67944064 ACAGGGAAGTGTGCAAGGGTGGG - Intergenic
1084433755 11:69126179-69126201 AAAGGGAGGCAGGCAGGGGAGGG + Intergenic
1084476493 11:69392311-69392333 ACAGGGGAGGAGGCAGAGGGGGG + Intergenic
1084599656 11:70137356-70137378 CCAGGGAGGCAGGCAGGGGCAGG - Intronic
1084857170 11:71996709-71996731 ACAGGGAAGAAGGGAGTGGGTGG - Exonic
1085040800 11:73325223-73325245 ACAGGGCAGGAGGCTGGGGGTGG - Intronic
1085637326 11:78168815-78168837 GCAGGGAAGTTGGCAGGAAACGG + Intergenic
1086030353 11:82347378-82347400 ACAGGTAGAAAGGCAGGGGAGGG - Intergenic
1086158364 11:83693536-83693558 AAAGGGAAGTGGACAGGGTACGG - Intronic
1086181813 11:83960973-83960995 ACAGGAAAGGAGGCAGGGGCAGG + Intronic
1086660206 11:89406914-89406936 ACAGAGAAGAAGGCAGCTGAAGG + Intronic
1087016808 11:93561909-93561931 AGAGGCAAGAAGGCAAGGGAGGG - Intergenic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1088124431 11:106406373-106406395 TCAGCCAAGAAGGCAGGGGATGG - Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088278828 11:108116732-108116754 ACAGGGGAGAAGACAGGGGTTGG + Intergenic
1088711159 11:112509958-112509980 AGAGGGAGGGAGGGAGGGGATGG - Intergenic
1088714389 11:112536046-112536068 ACAGAAATGTAGGCAGGGCACGG - Intergenic
1088920283 11:114255551-114255573 TCGGGGAAGTGGGCTGGGGAGGG - Intergenic
1089032804 11:115350392-115350414 GGAGGGAAGAAGGCAGGGAAGGG + Intronic
1089359074 11:117874556-117874578 CCAGGGAGGCAGGAAGGGGAGGG - Intronic
1089532686 11:119141280-119141302 ACAGGGAAGTAGGCTGCTAAAGG + Intergenic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090465726 11:126931377-126931399 ACAGGAAAGTAGGGTGGGGTAGG - Intronic
1090580396 11:128152862-128152884 GGAGGGAAGGAGGGAGGGGAGGG + Intergenic
1090580413 11:128152906-128152928 GGAGGGAAGGAGGGAGGGGAGGG + Intergenic
1090595781 11:128319569-128319591 ACAAGGAAGCAGGCAGGGCACGG - Intergenic
1090649914 11:128797510-128797532 GGAGGGAAGTAGGCAGTGCAGGG - Intronic
1090898283 11:131000660-131000682 ATATGGAAGGTGGCAGGGGATGG - Intergenic
1091018080 11:132072329-132072351 GTAGGGAAGTAGGGAGGGGTAGG + Intronic
1091030831 11:132186321-132186343 CAAGGGAAGCAGGCAGTGGATGG + Intronic
1091459451 12:632882-632904 ACAGTGAAGCAAGCCGGGGAGGG + Intronic
1091750509 12:3018955-3018977 CCAGGGGAGTCGGCAGGGGCGGG + Intronic
1091762619 12:3097209-3097231 AGACGGAAGCAGGCATGGGAGGG - Intronic
1091839688 12:3611945-3611967 ACAGGGAAGCAGGCAAGAGCCGG + Intronic
1092161114 12:6316034-6316056 ACAGGGAAGTAGGGAGGGCAAGG - Intronic
1092236597 12:6814516-6814538 AAAGGGAAGGAGGCAAGGGAAGG + Intronic
1092426351 12:8378788-8378810 ACAGGGAAGTGTGCAAGGGTGGG - Intergenic
1092540943 12:9419436-9419458 ACAGGAGAGTAGGCAGTGGGTGG - Intergenic
1092547648 12:9466072-9466094 ACAGAGAAGAAGGCAGTGCAGGG - Intergenic
1092615770 12:10214035-10214057 CCAGGCAAGTGGGCGGGGGAGGG - Intronic
1092816625 12:12318080-12318102 GCAGGGGAGTGGGCAGGGGTGGG + Intergenic
1092857186 12:12685204-12685226 ACAGGGAGGTAGGTATGGGATGG - Intronic
1092889591 12:12956286-12956308 AGAGGGAGGAAGGAAGGGGAAGG - Intergenic
1093006868 12:14060767-14060789 AGAGGGATGAAGGCAGGAGAAGG - Intergenic
1093168908 12:15837077-15837099 AGAGGAAAGTAGCAAGGGGATGG + Intronic
1093680179 12:21993554-21993576 AAAGGGAGGGAGGGAGGGGAGGG + Intergenic
1093755837 12:22850906-22850928 ACAGGATAGTGGGCAGGGGTGGG + Intergenic
1094115731 12:26910547-26910569 ACATGGCAGCAGCCAGGGGAAGG - Intronic
1094505335 12:31056290-31056312 ACAGAGAAGAAGGCAGTGCAGGG + Intergenic
1094512098 12:31103049-31103071 ACAGGAGAGTAGGCAGTGGGTGG + Intronic
1095169822 12:39020527-39020549 AGAGGGAAGGAGGGAAGGGAGGG + Intergenic
1095734788 12:45544958-45544980 GCAGGGCAGTAGGCAGGGTAGGG + Intergenic
1096521051 12:52184895-52184917 ACCAGGAAGCAGGAAGGGGATGG - Intronic
1096916514 12:55039220-55039242 ACAGGCAAAAAGGCAAGGGAAGG - Intergenic
1097035281 12:56119766-56119788 ATAGGGGAGTAGGAAGGGGGTGG + Intronic
1097178572 12:57157854-57157876 GCAGAGAAGGAGGCAGGGGTTGG + Intronic
1097226400 12:57479027-57479049 CCAGGGAGGTAGGAAGGTGATGG + Intronic
1097349497 12:58532960-58532982 ACAGGGAGGAAGGCAGGAGATGG - Intergenic
1097911357 12:64973291-64973313 ACACGGCAGCAGGCAGGAGAGGG + Intergenic
1098217323 12:68234287-68234309 ACAATGATGAAGGCAGGGGAGGG - Intergenic
1098483356 12:70991899-70991921 CCAGGGAAGGAGGCAGGGGAAGG - Intergenic
1098509272 12:71292559-71292581 ACTGGGTAATAGGCAGGGGTTGG - Intronic
1099520443 12:83653891-83653913 ACTGGGAAGGTGGCAGGGGGTGG + Intergenic
1100014714 12:89995160-89995182 AAAAGGAAGTAGGCATGGTAGGG + Intergenic
1100725681 12:97406118-97406140 CCAGGGAAGCAGGCGGGGGGCGG - Intergenic
1100738181 12:97561514-97561536 ACATGAAAGGAGGAAGGGGAGGG + Intergenic
1101282247 12:103270314-103270336 AGATGGAAGTAGGTGGGGGAAGG + Intronic
1101296103 12:103425065-103425087 ACTGGGAAGTAGGAACTGGACGG + Intronic
1101296234 12:103425863-103425885 ACTGGGAAGTAGGAACTGGACGG - Intronic
1101300717 12:103477382-103477404 ACAGTAAAGTAAGCAGGGGAAGG + Intronic
1101755816 12:107619945-107619967 CCAGGGAAGGTGGCAGGGGAGGG - Intronic
1101876640 12:108600371-108600393 ACTCGGAAGCTGGCAGGGGAAGG + Intergenic
1101885789 12:108660549-108660571 ATAGGGAAGAAGGCAGAGGAAGG - Intronic
1101907131 12:108835512-108835534 GCCGGGAAGCAGGAAGGGGAAGG + Intronic
1102235459 12:111291648-111291670 GCAGGGAACTGGGCAGGTGAAGG + Intronic
1102532958 12:113560188-113560210 CCAGGTAAGTGGCCAGGGGAGGG - Intergenic
1102848370 12:116213190-116213212 ACAGGGAGGGAGGGAGGGAATGG + Intronic
1102878977 12:116469740-116469762 AGAGGGAAGGAGGGAGGGAAAGG + Intergenic
1102902245 12:116647433-116647455 AGAGGGAAGAAGGAAGGGAAGGG - Intergenic
1103615470 12:122149005-122149027 ACAGCAAAGAAAGCAGGGGAGGG - Intergenic
1104029745 12:125056209-125056231 AAAGGAAACTAGGCAGGGAAAGG + Intergenic
1104544498 12:129698724-129698746 AGAGGGGAGAAGGGAGGGGAGGG + Intronic
1104800777 12:131554133-131554155 ACAGGGAAGGCGGCAGAGCATGG - Intergenic
1105417302 13:20224551-20224573 ACAGGGAAGGAGGCACTGGGTGG - Intronic
1105843111 13:24272523-24272545 AGAGGGCAGGGGGCAGGGGAGGG + Intronic
1105848951 13:24317828-24317850 ACAGGGGAGCAGCCAGTGGAGGG + Intronic
1106289449 13:28347176-28347198 GCAGAGATGAAGGCAGGGGAGGG + Intronic
1106408479 13:29494746-29494768 AAATGGAAGTAGGCTGGGCACGG + Intronic
1106605812 13:31227897-31227919 ACAGGAATGTCGGCAGAGGAAGG - Intronic
1107147922 13:37079415-37079437 ACAGAGAGGTAGGGAGGGTAAGG + Intergenic
1107403462 13:40091665-40091687 AGAGGGAGGTAGCCAGAGGAAGG - Intergenic
1107730314 13:43341887-43341909 ACATGGAAGTTGGCTGGGGATGG + Intronic
1108021205 13:46129430-46129452 AGAAGGAAGTAGACAGGTGAAGG - Intronic
1109260434 13:60138811-60138833 AGAGGGAAGAGGGGAGGGGAGGG + Intronic
1110484517 13:76022370-76022392 ACAGTGCAGGGGGCAGGGGAAGG - Intergenic
1111060309 13:83010064-83010086 GAAGGGTAGTAGGGAGGGGAGGG - Intergenic
1111918048 13:94382332-94382354 ACAAGGACGTACGCAGGCGAGGG - Intronic
1111958562 13:94784139-94784161 AGAGGGAAGAAGGCAGAGGTGGG + Intergenic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112761030 13:102693418-102693440 GCAGGGAAGCCGGCAGGGGCTGG - Intronic
1113139157 13:107127870-107127892 GCAGGGAAGAAGGCAGAGGAGGG + Intergenic
1113626314 13:111850610-111850632 ACAGGGCAGGAGGGTGGGGAAGG - Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114263983 14:21060416-21060438 ACTGGGAAGAAGCCAGGGGATGG - Intronic
1114269779 14:21093515-21093537 AGAGAGAGGTAGGCAGGAGAGGG + Intronic
1114484120 14:23053036-23053058 ACAGGGATGCTGGCCGGGGAGGG + Intronic
1114527380 14:23375370-23375392 ACCGTGAGGGAGGCAGGGGAGGG - Intronic
1114605827 14:23995375-23995397 CCAGGGAAGAAGCCTGGGGAGGG - Intronic
1114611330 14:24042932-24042954 GCCGGGAAGAAGGCTGGGGAGGG - Intergenic
1115366813 14:32567209-32567231 AAAGGTAAGTAGGCTGGGCACGG - Intronic
1116898447 14:50339525-50339547 AGAGGGAGGGAGGGAGGGGAGGG + Intronic
1117391628 14:55268150-55268172 ACAGTCAAGTAGGTAGGGAAAGG + Intergenic
1117528711 14:56637986-56638008 GCTGGGAAGTAGGCTGGTGAGGG + Intronic
1117749913 14:58910624-58910646 ACAGGGAAGTCAGCAAGAGAGGG - Intergenic
1117888265 14:60388547-60388569 AGAGGGCAGGAGGCAGTGGAGGG - Intergenic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1118020905 14:61713161-61713183 ACAGGGAACTAGGTAAGGGAGGG + Intronic
1118291129 14:64525280-64525302 AACGGGAAGTAGGCAGGGGACGG + Intronic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1118749575 14:68795996-68796018 ACCGCGAAGTTGGCGGGGGACGG - Intronic
1118775585 14:68971992-68972014 TTAGGGTTGTAGGCAGGGGAAGG - Intronic
1119264256 14:73254795-73254817 ACATGGAGAGAGGCAGGGGAAGG - Intronic
1119418927 14:74494387-74494409 ACAGGCAAGGAGGAAGGGGTGGG + Exonic
1119421418 14:74509915-74509937 ACTGGCAGGTAGGCAGGGGTGGG + Intronic
1120047707 14:79827231-79827253 ACAGGTAACAAGGCAGGGGTGGG + Intronic
1120280233 14:82429859-82429881 ACAGGGAAGTGGGGAGGGAGGGG - Intergenic
1120840157 14:89078499-89078521 ACAGGGAAGGAGGCAGCTGTCGG - Intergenic
1120928185 14:89819357-89819379 ACAGGGAGGTGGGAAGGGGTAGG + Intronic
1121047049 14:90795965-90795987 ACAGGGAACCAGGCAGGAGAGGG + Intronic
1121079572 14:91096672-91096694 CCAGGGGGGTGGGCAGGGGAAGG - Intronic
1121186673 14:91978410-91978432 AGAGGAAAGTAGGTAGGAGAAGG - Intronic
1121250075 14:92492877-92492899 ACAAGGAGGAAGGCAGTGGAAGG + Intronic
1121420639 14:93810985-93811007 TCAGAGAAGGAGGCAGAGGATGG + Intergenic
1121535698 14:94689478-94689500 CCAGGAAATTAAGCAGGGGAAGG + Intergenic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121593325 14:95137363-95137385 AAAGGGAAGGGGGAAGGGGAAGG + Intronic
1121685531 14:95832390-95832412 ACAGGGAAGATGGCAGAGGAAGG - Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121985008 14:98496951-98496973 ACAGGGAAGGAAGGAAGGGAAGG - Intergenic
1122195856 14:100085085-100085107 ACAGTGAAATAGGCAGGGTGCGG - Intronic
1122314609 14:100818305-100818327 ACAGGAAAGACGGCAGGGGCAGG + Intergenic
1122392546 14:101400026-101400048 AGAGGGAAGGAGGAAAGGGAGGG + Intergenic
1122558183 14:102592602-102592624 AGAGGGGAGGAGGCAGGGGCGGG - Intergenic
1122634900 14:103125231-103125253 AGGGGGAAGCAGGCAGGGGCTGG - Intronic
1122879588 14:104684216-104684238 ACCGAGAAGGAGGCTGGGGAGGG + Intergenic
1122930424 14:104930922-104930944 ACTGAGAAGTAGGCAGTGGTGGG - Exonic
1202906130 14_GL000194v1_random:73329-73351 ACAGGGAGGTCGGCCGGGGTCGG + Intergenic
1202935811 14_KI270725v1_random:86572-86594 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1202940870 14_KI270725v1_random:143870-143892 ACAGGGCAGAGGGCAGAGGAGGG + Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1124626137 15:31308499-31308521 GCAGGGGTGCAGGCAGGGGAGGG - Intergenic
1125281237 15:38044361-38044383 GGAGGGAAGAAGGGAGGGGAGGG + Intergenic
1125284546 15:38077752-38077774 ACAGGGACGATGGAAGGGGATGG + Intergenic
1125622739 15:41078848-41078870 ACAGTAAAGTAGGCTGGGCATGG + Intronic
1126181914 15:45793730-45793752 GGAGGGAAGGAGGGAGGGGAGGG - Intergenic
1126292589 15:47099375-47099397 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1126325431 15:47471992-47472014 AGAGGGAAGGGGGAAGGGGATGG + Intronic
1126692375 15:51297642-51297664 GCAGGGAGGGAGACAGGGGAGGG - Intronic
1126800246 15:52291620-52291642 ACAAGGATGAAGGCTGGGGATGG - Intronic
1127512226 15:59654222-59654244 ATAGGGAAGTAGGCACTGGGGGG - Intronic
1127586387 15:60382036-60382058 AAAGGAAAGAAGGGAGGGGAGGG + Intronic
1127625302 15:60774555-60774577 CCAGGGCAGTAAGCAGGGTAGGG - Intronic
1127660772 15:61098171-61098193 ACAGGGAGGGAGGCAGGGAAGGG - Intronic
1127686909 15:61354755-61354777 GCAGGGAAGGTGGCAGGGGCTGG + Intergenic
1127999239 15:64175456-64175478 ACAGGCAAGAGAGCAGGGGAAGG + Intronic
1128478753 15:68019467-68019489 AAGGGAAAGTAGGGAGGGGAGGG + Intergenic
1128618322 15:69127830-69127852 ACAGTGCAGGGGGCAGGGGAGGG - Intergenic
1128634325 15:69293554-69293576 ACTGGGATGCATGCAGGGGAGGG + Intergenic
1128639355 15:69324743-69324765 GCACGGAAGTACGCAGGGTATGG - Intronic
1128688553 15:69705850-69705872 ACAGAGAAGAAGGCCGGGCATGG + Intergenic
1128710669 15:69869115-69869137 AAAGAGAAGTGGGGAGGGGAAGG - Intergenic
1129341832 15:74891348-74891370 ACAGGAAACTTGGGAGGGGAAGG - Intronic
1129668414 15:77592650-77592672 GCAGGGAGGGAGGCAGAGGATGG + Intergenic
1130033358 15:80335467-80335489 GAAGGGAAAGAGGCAGGGGAGGG + Intergenic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130391812 15:83463066-83463088 TCAGGGAAGCATGAAGGGGAAGG + Intronic
1130831627 15:87607108-87607130 AGAGGGAAGCAGGCATGTGAGGG + Intergenic
1131463586 15:92637169-92637191 GCAGGGCAGTGGGCAGGGGAAGG + Intronic
1131988354 15:98067334-98067356 ACATAGAAATAGGCAGGGGTGGG + Intergenic
1132089161 15:98933789-98933811 ACAGGCAATTAGGCAGCGGACGG - Intronic
1132186444 15:99805974-99805996 ACAGGGAAGGTGGCAGGGTTGGG + Intergenic
1132295406 15:100730793-100730815 ACAGTCAAGTCGGCCGGGGAGGG - Intergenic
1132311765 15:100862458-100862480 ACTGGGCAGGAGGCAGGAGATGG + Intergenic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132373101 15:101311415-101311437 AGAGGGAAGGAGGCCGGGCACGG - Intronic
1132429234 15:101746736-101746758 ACAGGGAAGGTGGCAGGGTTGGG - Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132933756 16:2471209-2471231 GTCGGGAAGGAGGCAGGGGAGGG - Intergenic
1133087429 16:3375848-3375870 AAAGGGAAGGAGGGAGGGGGAGG - Intronic
1133517599 16:6524813-6524835 ACAGAGAAGGAGCCAGGTGATGG - Intronic
1133577064 16:7102115-7102137 ACAGAGAAGTAGGCACAGGCAGG - Intronic
1133578956 16:7124520-7124542 AGAGGGAAGGAAGGAGGGGAGGG - Intronic
1133594030 16:7273093-7273115 AGAGGGAAGGAGGAAAGGGAGGG - Intronic
1133594038 16:7273118-7273140 GCAGGGAAGGAGGAAAGGGAGGG - Intronic
1133781438 16:8942104-8942126 ACAGGGCAGTGGGAAGGGGAAGG + Intronic
1134449426 16:14354283-14354305 ACAGGGAAGGGGAAAGGGGAGGG + Intergenic
1134855027 16:17511337-17511359 ACAAGAAAGAAGGCAGGAGAGGG + Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135139373 16:19908443-19908465 ACAGGGATGGAGGATGGGGAAGG + Intergenic
1135421449 16:22308133-22308155 ACAGGGTACTGGGGAGGGGAAGG - Exonic
1135480701 16:22818614-22818636 AGAGGGAAGGAGGAAGGGAAGGG - Intronic
1136012299 16:27371794-27371816 CCAGGGAAGCAGGCAGGAGGTGG - Intergenic
1136469854 16:30472903-30472925 GCAAGGGAGGAGGCAGGGGAAGG + Intronic
1136574254 16:31113873-31113895 TAGGGGAAGTAGGAAGGGGAAGG + Intergenic
1137219765 16:46437143-46437165 GGAAGGAAGAAGGCAGGGGAAGG - Intergenic
1137830137 16:51536496-51536518 ACTGGGAAGTAGATAGGGCATGG + Intergenic
1137934323 16:52619616-52619638 GGAGTGAAGTAAGCAGGGGATGG + Intergenic
1138423693 16:56916414-56916436 ACAGGGGAGTAGGAAGTGGTGGG - Intergenic
1138423884 16:56917505-56917527 ACAGGGGAGTAGGAAGTGGTGGG - Intergenic
1138448594 16:57079536-57079558 ACAGGAAACCAGGCTGGGGATGG - Exonic
1138488736 16:57363779-57363801 GCAGGGAGGGAGGCAGAGGATGG - Exonic
1138498396 16:57423055-57423077 AAAGGGAGGGAGGGAGGGGAAGG + Intergenic
1138603046 16:58068883-58068905 GGAGGGAGGTAGGGAGGGGAGGG + Intergenic
1138752516 16:59440795-59440817 AAAGGGAGGGAGGGAGGGGAAGG - Intergenic
1138972048 16:62157287-62157309 GCAGGGAAGGAGGGAAGGGAGGG - Intergenic
1139101972 16:63778531-63778553 ACAGGGAATTAGGATTGGGAGGG - Intergenic
1139215848 16:65123368-65123390 ACGGGGAAGGAGGCTGCGGAGGG + Intronic
1139277088 16:65738011-65738033 ACAGGGAGGCAGGCAGGGGCTGG - Intergenic
1139320395 16:66109658-66109680 GAAGGGAAGAAGGAAGGGGAGGG + Intergenic
1139341053 16:66268022-66268044 ACAGGGAATGGGACAGGGGAAGG + Intergenic
1139448810 16:67014546-67014568 ACAGGCACGTAGGCAGGATACGG + Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1140441867 16:74994066-74994088 CCAGGCAAGGAGGCAGGGCAGGG - Intronic
1140914575 16:79482849-79482871 AGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1141118955 16:81335956-81335978 AAAGGGCATAAGGCAGGGGAAGG - Intronic
1141171666 16:81695641-81695663 AGAGGGAAGGAGGGAGAGGATGG - Intronic
1141179706 16:81744146-81744168 AAAGGGAAGTTGGCTGGGCACGG - Intronic
1141235257 16:82210080-82210102 AGAGGGAAGGGGGAAGGGGAAGG - Intergenic
1141638883 16:85329808-85329830 CCTGGGAAGAAGGCTGGGGACGG + Intergenic
1141667000 16:85470731-85470753 TAAGGGAAGTGGGCAGGGGGCGG - Intergenic
1141713982 16:85716517-85716539 ACAGGGGAGAAGGAAGAGGAGGG + Intronic
1141746172 16:85927902-85927924 AAAGGGAAGGAGGCAGAGAAAGG + Intergenic
1142197260 16:88744655-88744677 ACCGGGAAGGAGGCAGGGAAAGG - Intronic
1142543133 17:677446-677468 TGAGGAAAGTGGGCAGGGGAAGG + Intronic
1142558639 17:796625-796647 ACAGGGAACAAGGCTGGGGAGGG + Intergenic
1143373782 17:6455693-6455715 AGGGGGAAGAAGGGAGGGGAGGG + Intronic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143517062 17:7425144-7425166 ACAGGGAAATGGGCAGAGTAGGG + Intergenic
1143758692 17:9085338-9085360 AGAGGGAAAGAGGAAGGGGAGGG + Intronic
1144365749 17:14542211-14542233 AAAGGAAAGAAGGGAGGGGAAGG - Intergenic
1144461614 17:15463194-15463216 ATGGGGAAGTGGGTAGGGGAGGG + Intronic
1144579050 17:16447760-16447782 CCAGGGATGTAGGGAAGGGAAGG - Intronic
1144771472 17:17761917-17761939 GCAGGGAGGGAGGCATGGGAGGG + Intronic
1145722659 17:27088342-27088364 AGAGGGAGGTAGGCAGGAGTAGG - Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1145913260 17:28554832-28554854 TGAGGTAAGCAGGCAGGGGATGG - Exonic
1146059791 17:29598509-29598531 AAAGGGAGGGAGGCAGGGAAGGG - Intronic
1146287262 17:31582292-31582314 CCAAGGAAGCTGGCAGGGGAGGG - Intergenic
1146526266 17:33569493-33569515 ACAGGGAGTGAGGCAGTGGAGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1147187475 17:38720499-38720521 GCAGGGCAGCAGGCAGGGCAGGG - Exonic
1147609702 17:41794210-41794232 ACCTGGAAGTAGCCAGGGGGAGG + Intergenic
1147626586 17:41904306-41904328 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1147632269 17:41939749-41939771 TGAAGGAAGTGGGCAGGGGATGG + Intronic
1148046826 17:44749595-44749617 ACATGGCAGGAGGCAGGGGTAGG - Intronic
1148473008 17:47907168-47907190 GTAGGGAAGGAGGGAGGGGACGG + Intronic
1148479376 17:47950033-47950055 AAGGGGAAGTTGGGAGGGGAGGG - Intergenic
1148480898 17:47958804-47958826 AAGGGCAAGAAGGCAGGGGATGG + Intergenic
1148682463 17:49482635-49482657 ACATGGCAGCAGGGAGGGGAAGG - Intergenic
1148741049 17:49892885-49892907 ACAGGGAAGGGGGCAGGGCTGGG + Intergenic
1148809935 17:50283902-50283924 ACTGAGAGATAGGCAGGGGAAGG - Intergenic
1148845025 17:50524849-50524871 AAAGGGAAGGTGGCAGAGGATGG - Intronic
1148975364 17:51522998-51523020 ACATGGAAATGGGGAGGGGAAGG - Intergenic
1149261318 17:54882824-54882846 AAAGGAAAGAAGGAAGGGGAGGG + Intergenic
1149561565 17:57611349-57611371 ACAGGGCAGAGGGCAGGGCACGG - Intronic
1149608270 17:57940191-57940213 CCAGGGAAGGAGGCATGGGATGG - Intronic
1149776895 17:59365397-59365419 AAAGGGAAGGAGGCAGGGACAGG - Intronic
1150293108 17:63993115-63993137 GGAGGGAAGGAGGGAGGGGAGGG + Intergenic
1150729556 17:67680259-67680281 AGCAGGGAGTAGGCAGGGGAAGG - Intronic
1150819952 17:68426999-68427021 ACAGTGAAGGGGGAAGGGGAGGG + Intronic
1150819969 17:68427043-68427065 ACAGTGAAGGGGGAAGGGGAGGG + Intronic
1150983697 17:70171250-70171272 AGGGGGAAGTGGGGAGGGGAGGG - Intronic
1151447463 17:74176585-74176607 ACAGGTAAGTGGGGAGGGGCCGG - Intergenic
1151606776 17:75142586-75142608 AGAGGGAGGGAGGGAGGGGAAGG + Intronic
1151656424 17:75498383-75498405 GCAGGGAGGTAGGCTGGGGTGGG - Intronic
1151718708 17:75844085-75844107 AGGGTGGAGTAGGCAGGGGAGGG + Intronic
1151814651 17:76465766-76465788 ACAGGAGAGGAGACAGGGGAGGG - Intronic
1151964781 17:77425637-77425659 ACAGAGAAAGAGGCAGTGGAGGG - Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152305930 17:79520159-79520181 ACAGGGGAGGAGGCGGGGCAAGG - Intergenic
1152342887 17:79734944-79734966 ACAGAGAAGTAGGCACGTGGGGG + Intronic
1152609187 17:81307369-81307391 AAAGGGAAGGAGGAGGGGGAGGG - Intergenic
1152650485 17:81490289-81490311 ACAGGGAAGGAGCTAGGGGCAGG - Intergenic
1153382416 18:4454716-4454738 ACGGGGACCCAGGCAGGGGAAGG - Intronic
1153553864 18:6290204-6290226 ACCTGGAAGTAGGCTGGGCACGG - Intronic
1154171316 18:12053653-12053675 CCAGGGAAGTATTCAGGGAATGG + Intergenic
1154207298 18:12348059-12348081 AGAGGGCAGGTGGCAGGGGACGG + Intronic
1155250815 18:23951609-23951631 GGAGGGAAGATGGCAGGGGAAGG + Intronic
1156368235 18:36448950-36448972 AAAGGAAAGTAGGGAGGGGGAGG - Intronic
1156446794 18:37242652-37242674 TTAGGGAAGGAGGCAGTGGAGGG - Intergenic
1156486267 18:37467561-37467583 ACAGGGGAGCAGGCAGAGGAGGG + Intronic
1157112603 18:44834994-44835016 ACAGGCGACTAGGCTGGGGAGGG + Intronic
1157447127 18:47754388-47754410 CCAGGGCAGGAGGCTGGGGACGG - Intergenic
1157563360 18:48663830-48663852 ACAGGGAAGGAGGGAGGAGGAGG - Intronic
1157593718 18:48851232-48851254 CCAGGGAAGAAGGCATGGGAAGG + Intronic
1157739625 18:50080852-50080874 GCAGGGAAGAAGGCATAGGAGGG + Intronic
1157907605 18:51583601-51583623 GCAGGGAAGGAGTCAGGGCATGG + Intergenic
1158616061 18:58988097-58988119 ATATGGAAGTAGGCCGGGAATGG + Intergenic
1158851020 18:61495986-61496008 AGAGGGAAGAAGGCGGGGAAAGG - Intronic
1158992211 18:62880910-62880932 AGAGGGAGGTACGCAGTGGAAGG - Intronic
1159247701 18:65830630-65830652 ACAGGAAAGAAGGAAGGGAAGGG - Intronic
1159487732 18:69086659-69086681 AAAGGGAGGAAGGCAGGGGAGGG + Intergenic
1159543792 18:69814478-69814500 ACTGTGAACTATGCAGGGGAGGG - Intronic
1160447157 18:78936718-78936740 CCAGGGAGGTGGGCAGGGCAGGG + Intergenic
1160684588 19:427624-427646 ACAGGTAAGGGGACAGGGGACGG + Intronic
1160684628 19:427774-427796 ACAGGTAAGGGGACAGGGGACGG + Intronic
1160872169 19:1282466-1282488 GGAGGGAAGTAGGGAGGGGGAGG + Intergenic
1160975347 19:1790102-1790124 AGAGGGAAGTGGGGAGGAGAAGG - Intronic
1161038793 19:2099194-2099216 CCAGGGAGGGAGGCAGGGGGTGG + Intronic
1161258891 19:3324710-3324732 AGAGGGAAGAAGGGAGGGCAGGG - Intergenic
1161329059 19:3677864-3677886 AGAGGGAGGGAGGGAGGGGAGGG + Intronic
1161495425 19:4583647-4583669 ACAGCCAAGAAGGCAGGGGAGGG - Intergenic
1161501003 19:4615704-4615726 AGAGGGCTGTAGGCAGGAGAAGG - Intergenic
1161560741 19:4971283-4971305 ACAGGGCAGGAGGCTGAGGAAGG - Intronic
1161649350 19:5474780-5474802 ACACGGAGGGAGGGAGGGGAGGG + Intergenic
1162080451 19:8214831-8214853 AGAGGGAAGTAGCCAGGGAAGGG + Intronic
1162410040 19:10500097-10500119 ACAGGGCAGAGGGCAGGGGTTGG + Intronic
1162450814 19:10753404-10753426 AAAGGGAAGTGGGGGGGGGAAGG - Intronic
1162526677 19:11210407-11210429 ACAGGCAAGGAGACAGGTGAAGG - Intronic
1162526683 19:11210435-11210457 ACAGGCAAGGAGACAGGTGAAGG - Intronic
1162806696 19:13140896-13140918 GAAGGGGAGTTGGCAGGGGAGGG - Exonic
1162873697 19:13604784-13604806 GAAGGGAAGGAGGAAGGGGAAGG + Intronic
1162921592 19:13906378-13906400 CCGGGGAAGGAGGCAGGGCAAGG + Exonic
1162952103 19:14077523-14077545 ACAGTGAAGTATGCTGAGGATGG - Intergenic
1163020385 19:14478227-14478249 ACTGGGAACCAGGGAGGGGATGG + Exonic
1163032701 19:14554670-14554692 ACAGGGAAGGAGGGAGGAGCAGG - Intronic
1163144963 19:15373824-15373846 CCAAGGAAGGAGGCAGGGGCGGG - Exonic
1163575595 19:18109503-18109525 ACAGGGAAGGTGGCAGGGAGTGG - Intronic
1164149702 19:22540765-22540787 GGAGGGAAGGAGGGAGGGGAGGG + Intergenic
1164443097 19:28294305-28294327 ACAGGGAACTGGCCAGGGAAGGG + Intergenic
1164677006 19:30107596-30107618 ACAGGGAAGGAGGCGGGGGGCGG - Intergenic
1165293079 19:34904923-34904945 ACAGGGAAGGTGCCTGGGGAGGG - Intergenic
1165325381 19:35111619-35111641 ACAGGGAAGCAGGAAAGGGCAGG - Intergenic
1165715694 19:38044423-38044445 TCAGCGAAGGAGGCTGGGGAGGG + Intronic
1165845118 19:38813072-38813094 CCAGGGAAGCTGGCAAGGGAAGG - Exonic
1166104257 19:40589698-40589720 AGAAGAAAGAAGGCAGGGGAAGG + Intronic
1166289305 19:41851559-41851581 ACAGGCAAGAAGGAAGGGGCAGG - Intronic
1166352034 19:42203802-42203824 CCAGGGCAGCAGGCAGGGGAAGG + Intronic
1166910246 19:46149313-46149335 ACAGGGAGATGGGGAGGGGAGGG - Intronic
1167685704 19:50954759-50954781 ACAGGGAAGGAGGAAGGGGTGGG - Intergenic
1167780819 19:51597813-51597835 ACAGAGAGGTTGGGAGGGGAGGG - Intergenic
1167987151 19:53328154-53328176 ATAGGGAATAAGGCAGGGGAGGG + Intergenic
1168016664 19:53579350-53579372 ACAGGGAGGAGGGCGGGGGATGG - Exonic
1168249679 19:55134682-55134704 AAAGGAAAGTGGGGAGGGGAGGG + Intronic
1168261503 19:55197603-55197625 CCAGGGCTGTAGCCAGGGGACGG - Intronic
1168294060 19:55370251-55370273 ACAGGGAGGCAGGGAGGAGAGGG - Intronic
1168348248 19:55661196-55661218 AGAGGGTAGGGGGCAGGGGAGGG - Intronic
1168433805 19:56302320-56302342 AAAGGGAAGGAGGAAGGGGAGGG - Intronic
1168507091 19:56945411-56945433 ACAGGGAAGGAGGCAGAAGAAGG + Intergenic
1202684731 1_KI270712v1_random:38919-38941 ACAGGCAAATCAGCAGGGGATGG - Intergenic
925186479 2:1850126-1850148 AAAGGGAAGGAGGGAGGGGCAGG - Intronic
925434694 2:3826917-3826939 GAAGGGAGGGAGGCAGGGGAGGG - Intronic
925434702 2:3826934-3826956 AGAGGGAGGGAGGCAGGGAAGGG - Intronic
925909321 2:8563001-8563023 ACAGGGAAACAGGGAGGGGTTGG + Intergenic
925996721 2:9299564-9299586 ACAGGAAAGCAAGCAGTGGAAGG + Intronic
926809869 2:16746573-16746595 AAAGGGAGGGAGGGAGGGGAGGG - Intergenic
927019643 2:19003240-19003262 CCTGGAAAGTAGGCAGGGGTTGG - Intergenic
927107706 2:19842055-19842077 GAAGGGAAGGAGGGAGGGGAGGG + Intergenic
927670895 2:25068036-25068058 ACAGGGAAGCAGGTAAGAGATGG - Intronic
927943964 2:27123664-27123686 GAGGGGAAGAAGGCAGGGGAGGG + Intergenic
928512445 2:32014033-32014055 ACAGAGAGGGAGGGAGGGGAGGG + Intronic
928713982 2:34039109-34039131 AGAGGGAAGAAGGAGGGGGAAGG - Intergenic
929050346 2:37831205-37831227 CCAGGGAAGAAGGCGGTGGAAGG - Intergenic
930007985 2:46913413-46913435 AAAGGAAAGAAGGCAGGCGAGGG + Intronic
930065489 2:47324504-47324526 CTAGGGCAGTAGGCAGGGCAAGG + Intergenic
930417659 2:51109227-51109249 ACAGGGAAGAAGTAAGGAGAAGG + Intergenic
930721398 2:54641674-54641696 ACAGGGAATGGGGCAGGGGGCGG - Intronic
931181149 2:59901962-59901984 CAAGGGAAGAAGGCAGGGCAGGG - Intergenic
931367188 2:61629157-61629179 ACAGGAAGGGAGGCAGGGGGTGG - Intergenic
931642370 2:64393159-64393181 AGAGGAAAGTAGGGAGGAGAAGG - Intergenic
931844991 2:66194148-66194170 GCAGGGAAGTAGGGAGTGGATGG + Intergenic
932220542 2:69995699-69995721 ACAGGGCAGAAGGGAGGGCAGGG + Intergenic
932447536 2:71790196-71790218 AGAGGGATGCAGGCAGGGGTGGG + Intergenic
933948732 2:87310090-87310112 ACTGGAAAGCAGGCAGGGAATGG - Intergenic
934246987 2:90315927-90315949 ACAGGCAAATCAGCAGGGGATGG + Intergenic
934262338 2:91486676-91486698 ACAGGCAAATCAGCAGGGGATGG - Intergenic
934305388 2:91817665-91817687 ACAGGCAAATCAGCAGGGGATGG - Intergenic
934327868 2:92035083-92035105 ACAGGCAAATCAGCAGGGGATGG + Intergenic
934466259 2:94265622-94265644 ACAGGCAAATCAGCAGGGGATGG + Intergenic
934777785 2:96950042-96950064 ACGGGGAAAGAGGCAGGGGAAGG + Intronic
934954048 2:98601903-98601925 ACGGGGAAGGGGGCAGGGGATGG - Intronic
934980705 2:98837295-98837317 ACAGGCAAGGAGGCTGGGGAGGG + Intronic
935293771 2:101630742-101630764 AGAGTGAAGTAGGCAGAGCATGG - Intergenic
936331466 2:111551506-111551528 ACTGGAAAGCAGGCAGGGAATGG + Intergenic
936560785 2:113537966-113537988 ACAAGGAATGGGGCAGGGGAGGG + Intergenic
936780892 2:116030784-116030806 GGAGGGAGGTAGGGAGGGGAGGG - Intergenic
937074410 2:119090597-119090619 ACAGGGAAGAAGGGAGGTGAAGG - Intergenic
937142121 2:119610988-119611010 TCAGGGAAGCAGGCAGGTGAAGG + Intronic
937446115 2:121959643-121959665 CCTGGGAGGTAGACAGGGGAAGG + Intergenic
937688524 2:124725465-124725487 AGGGGGAAGGAGGAAGGGGAAGG - Intronic
938394266 2:130930863-130930885 AAAAGGAACTAGGCAGAGGAAGG + Intronic
939198078 2:138998266-138998288 ACAGGGAAGGAAGCAGGCAATGG + Intergenic
939326503 2:140696800-140696822 TCATGGACGAAGGCAGGGGATGG - Intronic
940265613 2:151832180-151832202 CCAGGAAAGTAGGCCGGGCATGG - Intergenic
941316174 2:163995247-163995269 ACTGATAAGTATGCAGGGGAAGG + Intergenic
941381854 2:164802846-164802868 AGAGGGAGGAAGGAAGGGGAGGG + Intronic
941930924 2:170937652-170937674 AGAGGGAAGGAGGGAGGGAAGGG + Intronic
942086776 2:172451180-172451202 ATAGGGAAGGAGGCCGGGCACGG + Intronic
944412086 2:199456089-199456111 ACAGGGACCTAGGGAGGGGGTGG + Exonic
944479895 2:200145665-200145687 AGCAGGAAGGAGGCAGGGGATGG + Intergenic
945792356 2:214320629-214320651 ACAGTGCAGTAGGAAGGAGAAGG + Intronic
945957267 2:216098067-216098089 ACAGGAAGGTAGGCAGAGGCTGG + Intronic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946142890 2:217706593-217706615 AAAGGGGAGGAGGAAGGGGAAGG + Intronic
946157695 2:217817956-217817978 ACAGGGAAGGAGGGCGTGGAAGG + Exonic
946280696 2:218663916-218663938 ACAGGGAATTGGGGATGGGAGGG - Exonic
947589438 2:231377047-231377069 CCAGGGAGGAAAGCAGGGGATGG + Intergenic
947645292 2:231734549-231734571 ACAGGTAAATAGGCCGGGCATGG + Intronic
947682958 2:232052523-232052545 ACAGGGAAGAGGGCAGGTCATGG - Intronic
947921473 2:233878701-233878723 ACAATTAAGTAGGCAGAGGATGG - Intergenic
948414163 2:237789638-237789660 CCAGGGAAATAGTCATGGGACGG + Intronic
948760013 2:240184512-240184534 CTAGGGAAGAAGGTAGGGGATGG - Intergenic
948984855 2:241514656-241514678 ACAGTGTGGTAGGCAGGAGAGGG + Intergenic
1168921287 20:1538178-1538200 ACTGGTAAGGAGGCAGGGGTGGG - Intronic
1168952253 20:1810473-1810495 GCAGGGAAGGAGACGGGGGAGGG - Intergenic
1169723076 20:8700235-8700257 ACAGGGCAGTGGCCTGGGGAGGG - Intronic
1169920617 20:10730955-10730977 AAAGGGAGGAAGGAAGGGGAGGG - Intergenic
1170137806 20:13094483-13094505 ACAGGGAAAAATGAAGGGGAAGG - Intronic
1170443155 20:16398822-16398844 ACAGGGACCTGGGCAAGGGAGGG + Intronic
1170803099 20:19606689-19606711 AGAGGGAAGAAGGCCAGGGAAGG + Intronic
1170830677 20:19837822-19837844 AAAGGAAAGGAGACAGGGGAGGG - Intergenic
1171030007 20:21668857-21668879 GGAGGGAAGGAGGCAGGAGAGGG + Intergenic
1171266082 20:23773240-23773262 AGAGGGAAGAAGCCAGGGCAGGG + Intergenic
1171416759 20:24986733-24986755 TGAGGGAAGTGGGCAGGGAAAGG + Intronic
1171462369 20:25305649-25305671 AGAGGGAAGTAGGCTGGGCGTGG - Intronic
1171536778 20:25899218-25899240 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1171804330 20:29661939-29661961 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1171839720 20:30194483-30194505 ACAGGGCAGAAGACAGAGGAGGG + Intergenic
1172528037 20:35612532-35612554 ACACGGAAGAAGGGAGAGGAAGG - Intergenic
1172557611 20:35856096-35856118 GAAGGGTAGTAGGCAGGGGTGGG - Intronic
1172594921 20:36144310-36144332 TCAAGGAACCAGGCAGGGGAGGG - Intronic
1172628522 20:36362789-36362811 ACAGGAAAGCAGGCAGGGACAGG + Intronic
1172720073 20:36993196-36993218 ACTGGGAAATAGGCAGAGGTTGG + Intergenic
1173002099 20:39111781-39111803 GAAGGGAAGGAGGGAGGGGAAGG + Intergenic
1173002789 20:39116920-39116942 AGAGGAGGGTAGGCAGGGGATGG - Intergenic
1173328186 20:42052481-42052503 ACAGGGAAGTATGCGGGGTGTGG - Intergenic
1173537689 20:43828563-43828585 AAAGGGAAGGAGGCTGGAGAAGG + Intergenic
1174040722 20:47697613-47697635 ACAGGGACGTGGGCAGAGGGCGG - Intronic
1174047500 20:47743977-47743999 AAAGGCAAGAAGGAAGGGGAGGG - Intronic
1174085410 20:48004552-48004574 CAAGGGAAGAAGGCAGGGGTTGG + Intergenic
1174130812 20:48342178-48342200 CGAGGGAAGAAGGCAGGGGTTGG - Intergenic
1174400448 20:50273204-50273226 ACAGGGAAGGAGTCTGGGGTAGG + Intergenic
1174481406 20:50833837-50833859 ACAGGGAAGCAGGCCGGGTGGGG + Intronic
1174544668 20:51316450-51316472 ACAGGGAGGTGGGCAGGCAAAGG + Intergenic
1174850151 20:53986202-53986224 AGAGGGAAGGAGGCGGAGGAAGG - Intronic
1175234682 20:57501786-57501808 AGAGGGAGGGAGGCAGGGGCTGG + Intronic
1175600163 20:60266618-60266640 TCAGGGAAGGACTCAGGGGAGGG - Intergenic
1176097761 20:63352152-63352174 TCAGGGAATGAGGCAGAGGAGGG - Intronic
1176195862 20:63836121-63836143 GCAGGGGAGAAGGCAGGGGCAGG + Intergenic
1176195931 20:63836311-63836333 GCAGGGGAGAAGGCAGGGGCAGG + Intergenic
1176546530 21:8204697-8204719 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1176554424 21:8248888-8248910 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1176565481 21:8387744-8387766 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1176573346 21:8431912-8431934 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1176582286 21:8543071-8543093 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1176625487 21:9088085-9088107 ACAGGGAGGTCGGCCGGGGTCGG + Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177393669 21:20507475-20507497 AAAGGGAAGGAGGCAGGTGTCGG + Intergenic
1178322277 21:31614735-31614757 GCAGGGGAATAGGGAGGGGAAGG + Intergenic
1179081959 21:38179571-38179593 ACAGGGAAGCTGACAAGGGAAGG + Intronic
1179151882 21:38816042-38816064 AGAGGGAGGGAGGGAGGGGAGGG + Intronic
1179158894 21:38875676-38875698 ACAGGGAAGAAGCCAAGTGAAGG + Intergenic
1179353542 21:40636397-40636419 AGAGGGAAGAAGGAAGGGGGTGG + Intronic
1179410594 21:41159966-41159988 ACAGTGAAGGAGGGAGGGAAGGG - Intergenic
1179625939 21:42649837-42649859 ACAGGGAAGGAGGCTGGAGATGG - Intergenic
1179889132 21:44326987-44327009 CCAGGGATAGAGGCAGGGGATGG - Exonic
1179952149 21:44714359-44714381 GGAGGGAGGGAGGCAGGGGAGGG + Intergenic
1179964087 21:44790855-44790877 ACTGGGTAGTAGGCAGAGGTTGG + Intronic
1179979076 21:44887144-44887166 ACAGAGAAGAAGGCAGGGCCAGG + Intronic
1180058851 21:45374552-45374574 GCAGGGGAGGAGGCAGGGGTGGG - Intergenic
1180265121 22:10520119-10520141 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1180280159 22:10686248-10686270 ACAGGGAAATCAGCAGGGGATGG + Intergenic
1180587381 22:16904780-16904802 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1180892080 22:19296742-19296764 AAAGGGAAGTCAGAAGGGGATGG + Intergenic
1180965590 22:19786568-19786590 ACAGGGACATAAACAGGGGAAGG + Exonic
1181032240 22:20154275-20154297 ACAGGGCAGAGGCCAGGGGAGGG - Intergenic
1181043504 22:20203966-20203988 AATGGGAAGTGGGGAGGGGAAGG + Intergenic
1181611314 22:24014764-24014786 ACAGGGCAGTAGGCATAAGAAGG - Intronic
1181976863 22:26736557-26736579 ACAGGGAAGAAATAAGGGGAAGG - Intergenic
1182082446 22:27538893-27538915 ACAGGGAAGGAGGAAGGGGGAGG - Intergenic
1182581589 22:31315847-31315869 AAAGGGAAGTGGGGAGGGGAAGG + Intergenic
1182659810 22:31917241-31917263 GCAGGGAAGGAGGCAGGGTGGGG + Intergenic
1182841764 22:33396498-33396520 ATAGGGAAGGAGGGAGGGGTGGG + Intronic
1182886386 22:33777623-33777645 ACAGAGAGGGAGGGAGGGGAAGG + Intronic
1183007635 22:34916600-34916622 GCAGGGAGGGAGGGAGGGGAAGG + Intergenic
1183130709 22:35832481-35832503 GCTGGGAAGGAGGCAGGGGATGG + Intronic
1183232440 22:36591381-36591403 AGAGGGAAGAAGGGAGGGGCTGG + Intronic
1183246986 22:36701534-36701556 GCAGGGAGGGAGGGAGGGGAGGG - Intronic
1183352673 22:37342815-37342837 AAAGGGAAGCGGGGAGGGGAGGG + Intergenic
1183460044 22:37944381-37944403 CCAGGAAAGTGGGGAGGGGAAGG - Intronic
1183618013 22:38956728-38956750 ACAGGGGAGCAGGCAGGACAGGG + Intronic
1183700471 22:39448318-39448340 ACAGGAAGGTGGGCAGGGGCTGG - Intergenic
1184329308 22:43816413-43816435 ACAGTGAAGCAGGCCGGGCACGG + Intergenic
1184790300 22:46695904-46695926 ACTGGGCAGGAGGCAGGAGAGGG + Intronic
1184818394 22:46889852-46889874 ACTGGGAAGTATACAGGGGCGGG + Intronic
1184981757 22:48100412-48100434 ACAGGGAAGGAGGGAGGAGGAGG - Intergenic
1184992707 22:48181678-48181700 ACAGGGAGGAGGGCAGGGGAGGG + Intergenic
1185080482 22:48707044-48707066 ACAGGGCAGGGGGCAGGGCAGGG - Intronic
1185093014 22:48786445-48786467 ACAGTGAGCCAGGCAGGGGATGG + Intronic
1185148012 22:49149773-49149795 GAAGGGAAGGAGGCTGGGGAGGG + Intergenic
1185355621 22:50367919-50367941 ACAGGCAAGGGGGCAGGGTAAGG + Intronic
1185414311 22:50701354-50701376 AAAGGGAAGGAGGGAGGGGAGGG - Intergenic
1203251393 22_KI270733v1_random:120959-120981 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1203259439 22_KI270733v1_random:166033-166055 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
949298813 3:2559390-2559412 AGAGGGAAGTAGGTAGGGAAAGG + Intronic
949597326 3:5561878-5561900 GGTGGGGAGTAGGCAGGGGAAGG + Intergenic
950085565 3:10255024-10255046 ACAGGAAAGGAGGGAGGGGGAGG - Intronic
950116178 3:10451439-10451461 ACTGGGAAGTAGTCAGGGGTAGG - Intronic
950313149 3:11976545-11976567 TCAGGAAAGGAGGCAGGGGCTGG - Intergenic
950542208 3:13619383-13619405 GCAGGGAAAAAAGCAGGGGAAGG - Intronic
950638105 3:14330338-14330360 AGAAGGAAGCAGCCAGGGGAGGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952041692 3:29268790-29268812 AGAGGGAAGAAGCCAGAGGAAGG + Intergenic
952316992 3:32239684-32239706 CCTGGGAAGGAGGCAGGGCATGG + Intronic
952423225 3:33149503-33149525 AGAGGGAAGTAGGGGGGGGCGGG + Intergenic
952423236 3:33149533-33149555 AGAGGGAAGTAGGGAGGGAGGGG + Intergenic
952756757 3:36875746-36875768 GGGGGGAAGTAGGTAGGGGATGG - Intronic
952760478 3:36909144-36909166 ACAGACAAGTAGGCAGGCAATGG - Intronic
952953291 3:38541646-38541668 ACAGGCAAATGGGCAAGGGATGG + Intronic
952983523 3:38757375-38757397 ACAGGGGAGTGGCCTGGGGAAGG + Intronic
953006622 3:38984979-38985001 GCAGAGATGTAGGCAGGGGCTGG + Intergenic
953025407 3:39142226-39142248 CCAGGGATGTAGGAGGGGGAAGG - Exonic
953105461 3:39874334-39874356 CCAGGCAATTAGGCAGGAGAAGG - Intronic
953273894 3:41475967-41475989 AGAGGGAGGGAGGCATGGGAGGG + Intronic
953273907 3:41476008-41476030 AAAGGGAGGGAGGCATGGGAGGG + Intronic
953388391 3:42520234-42520256 CCAGGGATGAAGGGAGGGGAGGG + Intronic
953980403 3:47410511-47410533 ACAGGGAAGCAGGGCGGGGGAGG - Exonic
953983031 3:47422157-47422179 AAAGGGAAGCAGGCAGGGAGGGG + Intronic
954479866 3:50788785-50788807 GCAGGGAGGGAGGCAGGGGAGGG + Intronic
954707052 3:52486781-52486803 GCAGGGAAGTGGGCTGGGGCAGG - Intronic
954948197 3:54445139-54445161 TCAGGGATATAGGCAGGGGATGG + Intronic
955095405 3:55792305-55792327 ACAGGCAAGAAGGCAGAGGGTGG + Intronic
955326856 3:58015177-58015199 ACAGGGAAGCAGGCACAGAAAGG - Intronic
955826184 3:62950660-62950682 ACTGGGTAGCAGGCAGGGGTTGG + Intergenic
956106479 3:65824173-65824195 ACAGGGACGTAGGCTAGGCATGG - Intronic
956838771 3:73117694-73117716 AGAGGGAAGGAGGGAGGGGAGGG - Intergenic
956850960 3:73227961-73227983 AGAGGGAGGGAGGGAGGGGAGGG - Intergenic
957177044 3:76824805-76824827 ACAGGGTAGGAGGCAGGGAGTGG - Intronic
957303189 3:78420371-78420393 ACCGGGGAGTAGGCAGGGCATGG - Intergenic
957887378 3:86305355-86305377 AAATGGAAGAAGGAAGGGGAGGG - Intergenic
958218509 3:90626324-90626346 CCAGGCAATTAGGCAGGAGAAGG + Intergenic
959381148 3:105642445-105642467 ACAGGGAAACAGGCAGAGGCTGG - Intergenic
959885912 3:111499259-111499281 TCAGAAAAGTAGGTAGGGGATGG + Intronic
960274938 3:115718058-115718080 AAAGGGAAGTAGACTGGGAAAGG - Intronic
960419687 3:117428427-117428449 ATGGGGAAGTAGGCTGGGCATGG - Intergenic
961283083 3:125778645-125778667 ACAGGGAAGTGTGCAAGGGTGGG + Intergenic
961914745 3:130361980-130362002 ACAGATTGGTAGGCAGGGGAAGG - Intronic
962281638 3:134056632-134056654 ACAGGGCAGTCAGCGGGGGAGGG + Intergenic
962312872 3:134338363-134338385 ACAGGGATGCAGGGAGGTGATGG - Intergenic
963511175 3:146251032-146251054 AAAGGAAAGGAGGCAGGGAAGGG + Exonic
963952479 3:151218231-151218253 ACTGAGAAGTGGGCAGGGAAGGG - Intronic
963972306 3:151443552-151443574 CCAGGGAAGTAGGCAGGCTGTGG - Exonic
964310530 3:155386959-155386981 AAAGGGAAGTGGGGAGGGGAGGG + Intronic
964792906 3:160469803-160469825 ACTGGGAAATAGGCAGAGGTTGG + Intronic
965244350 3:166248436-166248458 ACAGGGTAACAGGCAGAGGATGG + Intergenic
965458296 3:168930716-168930738 ACAGGGTAATAGGCAGTGGTTGG - Intergenic
965629268 3:170714308-170714330 ACAGAGAAGCAGTCAGCGGATGG - Intronic
966313908 3:178624840-178624862 GAAGGGGAGTTGGCAGGGGAGGG + Intronic
967252724 3:187559538-187559560 AAAGGGAAGAAGGCAGGGAGGGG - Intergenic
967413985 3:189196507-189196529 ACATGGCAGCAGGCAGGAGAGGG + Intronic
967415226 3:189209540-189209562 ACTGGGAGGCAGGCAGGAGAGGG + Intronic
967806238 3:193716791-193716813 ACTGGGAAGCAGGCAGTAGATGG - Intergenic
967876412 3:194271090-194271112 TCAGGGAAGAAGGCAGGGCAAGG - Intergenic
968082913 3:195859338-195859360 CCAGGGAAGCTGGGAGGGGAAGG - Intergenic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968620273 4:1600804-1600826 ACAGGGAAGTGGTCAGGGCTGGG - Intergenic
968857496 4:3138119-3138141 AGAGGGAAGTAGGGAAGGGAGGG - Intronic
968899846 4:3425980-3426002 ACAGGGTAGGGGGCAGGGGTTGG + Intronic
968937220 4:3617563-3617585 GGAGGGAAGAAGGGAGGGGAAGG - Intergenic
969014630 4:4095777-4095799 ACAGGGAAGTGTGCAAGGGTGGG - Intergenic
969195516 4:5560439-5560461 ACAGGGCAGTGGGAAGGAGAAGG + Intronic
969211051 4:5687521-5687543 GCAGGGAAGCAGGAAGGGGCAGG + Intronic
969551272 4:7869217-7869239 GGAGGGAAGGAGGAAGGGGAAGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969739310 4:9012664-9012686 ACAGGGAAGTGTGCAAGGGTGGG + Intergenic
969798491 4:9544177-9544199 ACAGGGAAGTGTGCAAGGGTGGG + Intergenic
970318671 4:14854378-14854400 AGAGGGAAGCACTCAGGGGAGGG - Intergenic
970444526 4:16112713-16112735 GGAGGGAAGAAGGGAGGGGAGGG + Intergenic
970444535 4:16112734-16112756 GGAGGGAAGAAGGGAGGGGAGGG + Intergenic
970444544 4:16112755-16112777 GGAGGGAAGAAGGGAGGGGAGGG + Intergenic
971757231 4:30720304-30720326 AAAGGGAGGGAGGGAGGGGAGGG + Intergenic
972294583 4:37724479-37724501 CAAGGGAAGTAGGGAGGGGTTGG + Intergenic
972472692 4:39422214-39422236 ACAGTGAACTAGGAAGGTGAAGG + Intronic
973113644 4:46427589-46427611 GGAGGGAAGAAGGCAGGGAAAGG - Intronic
973832851 4:54779289-54779311 ACAGGGAGGGAGGAGGGGGAGGG + Intergenic
973916658 4:55640592-55640614 TCAGTGAAGTAGGCAGGGTAGGG + Intergenic
974066505 4:57082417-57082439 ACAGGGAAGTGGTTAGGGAAAGG + Intronic
975013022 4:69378884-69378906 ACAGGGAATTACACAGGGAAAGG + Intronic
975383292 4:73727131-73727153 ACAGGGGGCTAGGAAGGGGAAGG + Intergenic
975701570 4:77072325-77072347 ACAGGACAGAAGGCAGGGCATGG + Intronic
976581834 4:86745962-86745984 ACAGGAAACAAGGCAGAGGATGG + Intronic
977313747 4:95418901-95418923 TCGGGGCAGGAGGCAGGGGAAGG - Intronic
978161628 4:105555378-105555400 ACAGGGAAGGCGACAAGGGAAGG + Intronic
978402071 4:108341583-108341605 AGTGGTAAGAAGGCAGGGGATGG + Intergenic
978883767 4:113741767-113741789 GTTGGGAGGTAGGCAGGGGATGG - Intronic
979700118 4:123657517-123657539 ACTGGGTAATAGGCAGAGGATGG - Intergenic
979864748 4:125739817-125739839 ATATGGAGGCAGGCAGGGGAAGG - Intergenic
979940923 4:126761922-126761944 ACACAGAAGTAGGAAGGGAAAGG + Intergenic
980563027 4:134502041-134502063 AGGGGGAGGAAGGCAGGGGAGGG - Intergenic
981090142 4:140723622-140723644 ACTGGGAAGTAGGCCGGGCATGG - Intronic
981422027 4:144562177-144562199 ACTGGGAGGTAGGCAGAGAATGG + Intergenic
981912224 4:149995225-149995247 AAAGGGAAGGAGGGAGGGGGAGG + Intergenic
982163768 4:152595915-152595937 GAAGGGAAGCAGCCAGGGGAAGG - Intergenic
982581358 4:157183131-157183153 ACATGTAAGGAGGCAGGAGAAGG + Intergenic
983124680 4:163936087-163936109 ACAGGGAGAGAGACAGGGGAAGG + Intronic
983798664 4:171899902-171899924 AGAGGGAAGTAGGGTGTGGAAGG - Intronic
983926308 4:173406627-173406649 TCAGGGTAGGAGGGAGGGGAGGG - Intergenic
984031751 4:174612851-174612873 ACGGGGTAATAGGCAGGGGTTGG - Intergenic
984644319 4:182203393-182203415 ACTGGGAACTGGCCAGGGGATGG - Intronic
984692741 4:182746504-182746526 ACAGGCAGAAAGGCAGGGGAGGG + Intronic
985086787 4:186322056-186322078 GCAGGGCCGTGGGCAGGGGAGGG - Intergenic
985624819 5:979823-979845 ACAGGGAGGTGGGCAGAGGCGGG + Intronic
985689655 5:1300063-1300085 CCAGGGAAGCAGGCAGGCAAGGG + Intergenic
985724288 5:1507604-1507626 TCAGGGAAGCTGGCAGGGGCCGG + Intronic
986082531 5:4409583-4409605 AGAGGGAGGCAGGCAGGCGAGGG - Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
986772587 5:10987648-10987670 AGAGGGGAGTGGGGAGGGGAGGG - Intronic
987027025 5:13937626-13937648 ACGGGGAAGTGGGTAGGGAAAGG + Intronic
987033557 5:13997675-13997697 ACAGGGAAATGGGCAGAGGCTGG - Intergenic
987039870 5:14052426-14052448 ACAAGGAAGTAGGGAGGAGGAGG + Intergenic
987273661 5:16339421-16339443 CCAGGCAATTAGGCAGGAGAAGG + Intergenic
987334831 5:16889444-16889466 AAAGGAAAGAAGGAAGGGGAAGG + Intronic
988119633 5:26943702-26943724 ACATGGAAGTGGGAAGGTGATGG + Intronic
990016008 5:51063683-51063705 ACAGGGAACTAGGCAGGCTTTGG - Intergenic
990584746 5:57200142-57200164 AAAGGGAAGGAAGCAGGGGAGGG - Intronic
990746243 5:58961934-58961956 ACAGGTAAATTGGCAGGGGTGGG + Intergenic
991024086 5:62011177-62011199 ACAGGGAAGCAGGCAGGAGCAGG + Intergenic
992021940 5:72633498-72633520 ACAGAGAGGGAGGCAGGGAAAGG + Intergenic
992492430 5:77258375-77258397 CCAGGGAGATAGGCAGGGGCAGG + Intronic
993698745 5:91093690-91093712 ACTGGGAAGTAGGCAGGGACTGG + Intronic
993841591 5:92886709-92886731 AGTGGGAAGTATGCAGGGAAGGG - Intergenic
993907219 5:93636480-93636502 ACAGGGAAGAAGGCGGGTGAAGG - Intronic
994966685 5:106681542-106681564 GCAGTGAAGTGGGCAGGGGCAGG - Intergenic
995033129 5:107502176-107502198 GAAGGGAAGGAGGCAGTGGATGG - Intronic
995395420 5:111681771-111681793 GCAGGGAAGAGTGCAGGGGATGG + Intronic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995900182 5:117056447-117056469 AGAGGGAAGTAGAGGGGGGAAGG + Intergenic
996582523 5:125047615-125047637 TCAGGGAAGGAGGCAGAGAATGG + Intergenic
996678832 5:126208030-126208052 AAAGGGCAGGAGGCAGGTGAAGG + Intergenic
996965597 5:129304412-129304434 ACAAGGAACAAGGTAGGGGAAGG + Intergenic
997249961 5:132380926-132380948 AGAGGGGAGTGGGGAGGGGAGGG + Intronic
997660624 5:135586749-135586771 GCAGGGATCTGGGCAGGGGAGGG + Intergenic
997712781 5:136020080-136020102 ACAGTGAAGGAGGCAAGGAAGGG - Intergenic
997739894 5:136244150-136244172 AGAGGGAAGGAGGGAGGGAAGGG - Intronic
997789721 5:136747313-136747335 AAAGGGTAGTAGGAAGGGGCGGG + Intergenic
997818268 5:137038519-137038541 AAAAGGAAGAAGGCAGGGAAGGG + Intronic
998130444 5:139648899-139648921 AGAGGGAGGTAGGCGGGGAAGGG - Intronic
998306282 5:141080277-141080299 CCAGAAAAGTAGGCAGGGGCTGG + Intergenic
998806412 5:145921431-145921453 AGAGGGAAGGAAGGAGGGGAGGG - Intergenic
999147947 5:149408070-149408092 ACATGGAAGTAGGTAAGGGATGG + Intergenic
999370117 5:151049834-151049856 ACAGGCAAGAAGGCAGTGGCTGG - Exonic
999448942 5:151664238-151664260 GCAGGGAAGGAGGCAGGGGAGGG + Intronic
999558760 5:152775447-152775469 ACAGGGAAATAGCCAGTGGTTGG - Intergenic
999719830 5:154391447-154391469 ACAGAGAAGGAGGGAGGGAAAGG - Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000185058 5:158851356-158851378 AAAGGGAAGAAGGAAAGGGAAGG + Intronic
1000185207 5:158851794-158851816 AAAGGGAAGGAGGGAAGGGAAGG + Intronic
1000198809 5:158987492-158987514 ACAAGGAGGTAGGCAGGGCAGGG + Intronic
1000229202 5:159299193-159299215 ACTGGGTAGTAGGCAGAGGTTGG - Intergenic
1000452617 5:161408722-161408744 AGAGGGAAGGAGGAAGGAGAAGG + Intronic
1000518701 5:162273307-162273329 CCAAGGAATTAGGCAGAGGATGG - Intergenic
1001149593 5:169215656-169215678 CCAGGGAGATGGGCAGGGGATGG - Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1002018059 5:176341575-176341597 ACAGTGGAGAAGGCAGTGGATGG + Intronic
1002088290 5:176789607-176789629 ACGGGGAGGTAGGGAAGGGAGGG + Intergenic
1002279539 5:178122342-178122364 CCAGGGAAGGAGGCTGGGGTGGG + Exonic
1002850905 6:995635-995657 AGAGGGAAGGAGGCAGGGGCTGG - Intergenic
1002851758 6:1003158-1003180 ACAGGGAAGGATGGCGGGGAGGG - Intergenic
1002856136 6:1039787-1039809 ACTGGGAAGTAATCAGGGAAGGG + Intergenic
1003234204 6:4281607-4281629 CCAGGCATGTGGGCAGGGGAGGG - Intergenic
1003443518 6:6164839-6164861 GGAGGGAAGGAGGGAGGGGAAGG - Intronic
1003491735 6:6628258-6628280 GGAGGGAAGGAGGAAGGGGAGGG - Intronic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1004329035 6:14704659-14704681 ACAAGGAAAGAGGCAGGGAATGG - Intergenic
1005464121 6:26095197-26095219 AAAGTGAAGTAGGCCGGGCACGG + Exonic
1005574599 6:27179692-27179714 GCGGAGAGGTAGGCAGGGGAAGG - Intergenic
1005843500 6:29759962-29759984 ACAGGAAAGAAGGCAGAGGTGGG - Intergenic
1005994534 6:30923297-30923319 GAAGGAAAGGAGGCAGGGGAGGG + Intronic
1006362996 6:33597870-33597892 TCAGAGAAGTAGGAAGGGAATGG + Intergenic
1006902773 6:37513684-37513706 ACAGTGCAGTAAGCAGGGGCTGG + Intergenic
1007433411 6:41789684-41789706 AAAGGAAACTAGGCAGGGAAGGG - Exonic
1007509490 6:42364328-42364350 ACAGGGAAGGAGGCTAGGAAGGG - Intronic
1007744368 6:44034466-44034488 CCAGGGAGAGAGGCAGGGGAAGG + Intergenic
1008796756 6:55312191-55312213 CCAGGCAATTAGGCAGGAGAAGG + Intergenic
1008912208 6:56746946-56746968 AAAGGGGAGAAGACAGGGGAGGG + Intronic
1009475348 6:64084225-64084247 ACAAGAAAGAAGGCAGGGTATGG - Intronic
1010858892 6:80879722-80879744 ACTTGGAGCTAGGCAGGGGATGG - Intergenic
1011137602 6:84116952-84116974 AAAGGGAAGAAGGGAAGGGAAGG - Intergenic
1011632327 6:89339526-89339548 GGAGGGAAGTGGGGAGGGGAGGG + Intronic
1012011029 6:93785707-93785729 AAAGGGAAGGAGAGAGGGGATGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1013455223 6:110323878-110323900 GTGAGGAAGTAGGCAGGGGAGGG + Intronic
1014228277 6:118873166-118873188 GAAGGGAAGAAGGGAGGGGAGGG + Intronic
1014800092 6:125769259-125769281 CCTGGGAAGTAGGCAGTAGATGG - Intergenic
1014827559 6:126063933-126063955 ACAGGGAAGTGGGCCGAGGAAGG + Intergenic
1015063523 6:128997389-128997411 AGAGGGAGGGAGGGAGGGGATGG + Intronic
1015483666 6:133743948-133743970 ACTTGGAACTATGCAGGGGATGG + Intergenic
1015639158 6:135312220-135312242 ACAGGGATGTGGGCTGGGCACGG + Intronic
1015935237 6:138402306-138402328 ACAGGGAAGGAGGCAGGGCCAGG + Intergenic
1016251216 6:142045250-142045272 GCAGGGAAGGGGGCAGTGGAGGG - Intergenic
1016269346 6:142270514-142270536 ACAGGGAAGAAGGGTGGAGAGGG + Intergenic
1016272212 6:142302059-142302081 GCAGGGAAGTTGGCAGGGTGAGG - Exonic
1016772809 6:147870790-147870812 AAAGGGAAGAGGGAAGGGGAGGG + Intergenic
1016869197 6:148799644-148799666 AAAGGGAAGGAGGGAGGGAACGG - Intronic
1016902519 6:149116387-149116409 ACAGGGGAGTTGGCAAGGCAGGG + Intergenic
1017189422 6:151636072-151636094 AAAGGGAGGGAGGGAGGGGAGGG - Intergenic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1018152969 6:160957080-160957102 CCAGGGAAGAAGGTAGGGGGTGG + Intergenic
1018326184 6:162671905-162671927 ACAGGGAGGAAGACAGGTGACGG + Intronic
1018430440 6:163717580-163717602 GCAGGGCTGAAGGCAGGGGATGG - Intergenic
1018478016 6:164162038-164162060 ACTTGGAGGTAGGGAGGGGAGGG + Intergenic
1018506294 6:164473438-164473460 CCAGGCAATTAGGCAGGAGAAGG + Intergenic
1018724727 6:166603192-166603214 ACAGGGAAGTAGCAGAGGGAAGG - Intronic
1018774445 6:166999740-166999762 CCACGGAATGAGGCAGGGGATGG - Intronic
1018930825 6:168239362-168239384 ACAGGGGAGAAGGCAGGGCCGGG + Intergenic
1018964971 6:168477975-168477997 AAAGGGAAGTTAGCAGGGTAAGG - Intronic
1019288853 7:237286-237308 TCAGAGGAGTAGGCAGGGGAAGG + Intronic
1019334968 7:478659-478681 GAAGGGAAGGAGGAAGGGGAGGG + Intergenic
1019479765 7:1261165-1261187 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479773 7:1261188-1261210 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479781 7:1261211-1261233 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479789 7:1261234-1261256 ACAGGGAGGATGGCAGGGGCAGG + Intergenic
1019479804 7:1261275-1261297 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479812 7:1261298-1261320 ACTGGGAGGATGGCAGGGGATGG + Intergenic
1019479834 7:1261363-1261385 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479842 7:1261386-1261408 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479867 7:1261455-1261477 ACTGGGAGGATGGCAGGGGATGG + Intergenic
1019479890 7:1261520-1261542 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479898 7:1261543-1261565 ACTGGGAGGATGGCAGGGGACGG + Intergenic
1019479906 7:1261566-1261588 ACTGGGAGGATGGCAGGGGATGG + Intergenic
1019479922 7:1261612-1261634 ACTGGGAGGATGGCAGGGGATGG + Intergenic
1019637205 7:2082261-2082283 CCAGGGAAGGAGGGAGGGAAGGG + Intronic
1019662512 7:2232662-2232684 ACAGGGGAGTGGGGAGAGGAGGG + Intronic
1020018772 7:4848846-4848868 ATAGGGAATTAGGCCGGGCATGG + Intronic
1020088323 7:5323431-5323453 GCAGGGAAGGAGGCGGGGCAGGG - Intronic
1020357471 7:7293008-7293030 ACAGAGAAGTATGCTGGGGCAGG - Intergenic
1021031656 7:15744709-15744731 CCAGGCTAGTAGGCAGGGAATGG + Intergenic
1021612591 7:22472770-22472792 ACAGGGAAGGAGGGGGAGGATGG - Intronic
1021797056 7:24266364-24266386 ACAAAGAAGAAGGCAGGGGCTGG + Intergenic
1021970513 7:25961133-25961155 GATGGGAAGAAGGCAGGGGAGGG - Intergenic
1022529294 7:31057198-31057220 AGAGGGAGGTAGGAAGGGAAAGG - Intronic
1023029471 7:36079823-36079845 ACAGGGGAGGAAGCAGGGGCTGG - Intronic
1023216518 7:37868733-37868755 ACCGGGAAGGTGGAAGGGGAAGG - Intronic
1023441146 7:40186226-40186248 AAAGGGGAGAAGGGAGGGGAGGG - Intronic
1023895695 7:44431203-44431225 ACATGGTAGGAGGCAGGGGAGGG + Intronic
1023901991 7:44488736-44488758 GCAGGGATGGAGGAAGGGGAGGG - Intronic
1024196660 7:47065722-47065744 ACAGGTAAGGAGGTAGGAGAAGG + Intergenic
1024943503 7:54785750-54785772 ACAGGGCACTAGGAAGGGGGTGG - Intergenic
1025080622 7:55979432-55979454 ACAGGGAAGTTGGAAGAGCAAGG - Intronic
1025093549 7:56081502-56081524 ACAGGGCAGCTGGGAGGGGAGGG + Intronic
1025205989 7:56993684-56993706 GCAGGGAAGGAGGCGGGGCAGGG + Intergenic
1025634952 7:63313937-63313959 ACAGGAAAGCAGGCAGGGACAGG + Intergenic
1025647743 7:63434233-63434255 ACAGGAAAGCAGGCAGGGACAGG - Intergenic
1025665951 7:63583255-63583277 GCAGGGAAGGAGGCGGGGCAGGG - Intergenic
1025736754 7:64155972-64155994 TAAGGCAAGTAGGCAGGAGAAGG - Intronic
1026040734 7:66865886-66865908 AAAGGGAGGGAGGGAGGGGAAGG - Intergenic
1026122526 7:67550336-67550358 AGAGGGAGGGAGGGAGGGGAGGG - Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026632371 7:72048660-72048682 ACAAGGAAGGAGGGAAGGGAGGG - Intronic
1027306015 7:76898315-76898337 ACAAGGAAGGAGGCTGGGCATGG + Intergenic
1028207144 7:88031277-88031299 ACTGGGTAGTGGGCAGAGGATGG + Intronic
1029713665 7:102314038-102314060 AGAGACAAGTAGGCAGGAGAAGG + Intronic
1031212555 7:118849018-118849040 AGAGGGTAGTAGGAAGAGGAAGG + Intergenic
1032071469 7:128810104-128810126 AGAAGGAAGGAGGCAAGGGATGG - Intronic
1032436790 7:131907345-131907367 AAAGGGAAGGAGGGAGGAGACGG + Intergenic
1032520332 7:132539026-132539048 ACAGGGAAACAGGCAGGGGCTGG - Intronic
1032582193 7:133113646-133113668 ACAGGGAAGAAGGCATGTGCAGG + Intergenic
1033596881 7:142865118-142865140 ACAGGGACGCAGGTAGAGGAAGG + Intronic
1033617280 7:143028889-143028911 ACAGTGACGTAGACAGGGAAGGG - Intergenic
1034094322 7:148392611-148392633 ACAGGGAAGTGGGTAGGAGATGG + Intronic
1034165208 7:149020249-149020271 ACATGGAAATAGGCCGGGCATGG - Intronic
1034165445 7:149021815-149021837 ACAAGGAAGTAGGGAGGAGGTGG - Intronic
1034442688 7:151094828-151094850 AGAGGGAAGGAGGGAAGGGAGGG - Intronic
1034964122 7:155381374-155381396 AGAGGGGGGTGGGCAGGGGAGGG - Intergenic
1035046728 7:155972747-155972769 ACAGGGAGGAAGGCACTGGAGGG + Intergenic
1035093702 7:156334779-156334801 ACAGGGAGGAAGACAGGAGATGG + Intergenic
1035225349 7:157429535-157429557 ACAGTGAATTAGACAGGGCAAGG + Intergenic
1035706814 8:1682057-1682079 GCATGGAAGCAGGCAGTGGAGGG - Intronic
1035819731 8:2578628-2578650 ACTGGGAAGCTGGCAGTGGATGG + Intergenic
1035911603 8:3572362-3572384 GCAGGGAGGTGGGCAGGAGAGGG + Intronic
1035957684 8:4100371-4100393 ACAGGGAAGGTGGAAGGAGATGG - Intronic
1036221997 8:6929053-6929075 ACTGGGAAGGAGGCAGGGACAGG - Intergenic
1036441918 8:8789251-8789273 ATAGGGAAGAAAGCAGAGGAAGG + Intronic
1036445995 8:8822384-8822406 ACAGAGATGGGGGCAGGGGATGG + Intronic
1036496610 8:9276015-9276037 GGAGGGAAGTAGGAAGGGAAGGG - Intergenic
1036724502 8:11207877-11207899 ACAGAGATGTAGGCAAGGGGAGG + Intergenic
1036726422 8:11224787-11224809 CCAGAGCAGTAGGCTGGGGATGG - Intergenic
1037439091 8:18895965-18895987 GCAGGGAAGTGTGGAGGGGAAGG - Intronic
1037540736 8:19868004-19868026 CCAGAGAGGTAGGCAGGGAAAGG + Intergenic
1037557861 8:20042975-20042997 ACAAGGGAGGAGGCAAGGGAGGG - Intergenic
1037661932 8:20935257-20935279 ACAGAGAGGAAGGCAGGGGTGGG - Intergenic
1038247352 8:25871165-25871187 CCAGGGAAGTAGGGAGGGGGAGG - Intronic
1038247545 8:25873042-25873064 ACAAGGAAATTGGAAGGGGAAGG - Intronic
1038513524 8:28162936-28162958 TCAGGGGAGAAGGAAGGGGAAGG + Intronic
1038535967 8:28352940-28352962 ACAGGAAAGAAGGCAGGGATTGG + Intronic
1038544507 8:28414770-28414792 GTGGGGAAGTGGGCAGGGGAGGG - Intronic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038785623 8:30612649-30612671 AGAGGGAGGGAGGCAGGAGAGGG - Intronic
1039426359 8:37489693-37489715 ACAGGGAAAAGGGAAGGGGATGG - Intergenic
1040373636 8:46801459-46801481 CCAGGGCAATAGGCAGGAGAAGG + Intergenic
1041748971 8:61238331-61238353 GGAGGGTAGTAAGCAGGGGAGGG - Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042059632 8:64802612-64802634 GCAGGGAGGGAGGGAGGGGAAGG + Intergenic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042145965 8:65730635-65730657 ACAGAGAACTAGGCTGGGCATGG + Intronic
1042576407 8:70225176-70225198 ACAGGAAAGTAGGGAGAGGGTGG + Intronic
1042852874 8:73234245-73234267 ACAGGAAAGAAGGAAGGAGAGGG - Intergenic
1043400864 8:79882937-79882959 AGAGGGAAGAGGGCAGGAGAGGG - Intergenic
1043515194 8:80989609-80989631 ATGAGGAAGAAGGCAGGGGATGG + Intronic
1043713500 8:83451154-83451176 CCAGGGAATTAGGCAGGAGAAGG + Intergenic
1043878362 8:85512229-85512251 ATATGGAAATAGGCAGGAGATGG - Intergenic
1043941939 8:86205636-86205658 AGAGGGGAGTGGGGAGGGGAGGG + Intergenic
1044073066 8:87785966-87785988 ACTGGGTAGTAGGCAGAGGTTGG - Intergenic
1044168450 8:89018636-89018658 GAAGGGAAGAAGGAAGGGGAAGG - Intergenic
1044701087 8:94965794-94965816 ACAGGGATGGAGACAGGTGATGG + Intronic
1045240118 8:100393012-100393034 ACAGGGATGGAGGCAGGGAGGGG - Intronic
1045763772 8:105643332-105643354 ACCTGGAAGTAAGCATGGGAGGG - Intronic
1046630378 8:116617486-116617508 AGAGGGAGGGAGGGAGGGGAAGG + Intergenic
1047294438 8:123558827-123558849 ACAGTGGAATAGGCAGGGCAAGG + Intergenic
1047511624 8:125520294-125520316 AGAGGGAGGGAGGGAGGGGAGGG + Intergenic
1047703581 8:127474353-127474375 ACAGGAAAGGATGCAGGAGAGGG - Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048382773 8:133882675-133882697 ACAGGGAAGAAGGCAGGAGACGG - Intergenic
1048972682 8:139654047-139654069 ACAAGGCCCTAGGCAGGGGATGG - Intronic
1049047663 8:140165585-140165607 AGGGGGAAGGAGGGAGGGGAAGG + Intronic
1049087414 8:140489283-140489305 ACAGGGAAGTGGGCTGGGTGCGG - Intergenic
1049089343 8:140502626-140502648 ACAGGGAAGTGGGCTGGGTGCGG + Intergenic
1049149194 8:141023454-141023476 ACAGGGAGACAGGGAGGGGACGG - Intergenic
1049186151 8:141255018-141255040 AAAGGGAAGTAAGGAGGTGAAGG + Intronic
1049301052 8:141870670-141870692 ACAGGGAAGTGTGCAGAGAAGGG - Intergenic
1049362641 8:142219643-142219665 ACAGGCAGGAAGGCAGGTGAGGG - Intronic
1049620188 8:143594637-143594659 TCAGGGAGGTGGGCAGGGGACGG + Intronic
1049622345 8:143604331-143604353 CCTGGGAACCAGGCAGGGGAGGG + Exonic
1049686951 8:143942826-143942848 CCAGGGAGGAAGGCAGGGCATGG + Intronic
1049720704 8:144114210-144114232 ACAGGGGAGAAGGTAGGGGCTGG + Intronic
1049805595 8:144537373-144537395 ACAGGGAAGTTTGCAGGTGGAGG - Intronic
1049891893 9:77358-77380 ACAAGGAATGGGGCAGGGGAGGG - Intergenic
1049971695 9:827095-827117 ACAGGGAACTGGGCAGGCCAGGG + Intergenic
1050148023 9:2591048-2591070 AGAGGGAATAAGGCAGGGGCAGG + Intergenic
1051386573 9:16515463-16515485 ACAGGGAAGAGGGCGGGTGAGGG - Intronic
1052840825 9:33289762-33289784 GAAGGGGAGTTGGCAGGGGAGGG - Intergenic
1052951905 9:34219924-34219946 AGAGGGGAGAAGGGAGGGGAGGG - Intronic
1053350719 9:37411762-37411784 AAGGGGATGGAGGCAGGGGATGG - Intergenic
1053474512 9:38372418-38372440 ACTGGGAAATTGGGAGGGGATGG + Intergenic
1053507870 9:38660305-38660327 ACATAGAAGTGGGCAGGGCACGG + Intergenic
1053512535 9:38700873-38700895 TCAGAGAAGGAGGCTGGGGATGG - Intergenic
1053696308 9:40642394-40642416 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1054307559 9:63441622-63441644 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1054439915 9:65251097-65251119 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1054490491 9:65770842-65770864 ACAGGCAAATCAGCAGGGGATGG - Intergenic
1054732721 9:68717088-68717110 ACAGGGAAGGAGGGAGGTAAGGG + Intronic
1055216630 9:73871715-73871737 GAAGGCAAGAAGGCAGGGGAGGG - Intergenic
1055330548 9:75178566-75178588 AAAGGGAAAAAGGCAGGGGGGGG + Intergenic
1055561555 9:77526555-77526577 ACAGGGAAGAAGCCAGGCGAAGG + Intronic
1055710546 9:79056303-79056325 GCAGGGAAGCAGGCAGCAGACGG + Intergenic
1055758818 9:79584314-79584336 AGAGGGTAGAAGGGAGGGGAGGG - Intronic
1055933370 9:81582131-81582153 ATAGGGAAGTAAGGCGGGGAGGG + Intergenic
1056040065 9:82656138-82656160 GAAGGGAAGAAGGAAGGGGAAGG + Intergenic
1056329148 9:85507582-85507604 AAAGGAAAGGAGGCAGGGGAGGG + Intergenic
1057049969 9:91916122-91916144 ACAAGGAAGAAGGGAGGGAAGGG + Intronic
1057177471 9:93010522-93010544 ACAGAGACAGAGGCAGGGGAGGG + Intronic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1057802538 9:98198876-98198898 TCAGGGAACCAGGCAGGGGCTGG + Intergenic
1057820377 9:98325686-98325708 ACAGGGTGCTAGGCATGGGAAGG - Intronic
1057857272 9:98611203-98611225 ACAGGGCAGGAGGCAGGGGGTGG - Intronic
1058146618 9:101419139-101419161 AGAGGGAAGAAGGAAGGGAATGG - Intergenic
1058152585 9:101478793-101478815 ACTGGGAGGTGGGCAGCGGAAGG - Intronic
1058625599 9:106929948-106929970 AAAGGGAAGGAGGGAGGAGAAGG - Intronic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059161238 9:112036890-112036912 ATAGGGAGTGAGGCAGGGGAAGG - Intergenic
1059214997 9:112553150-112553172 AGAGGGGAGAGGGCAGGGGAGGG - Intronic
1059328661 9:113520602-113520624 AGAGGGAGGCTGGCAGGGGAAGG - Intronic
1059360412 9:113737752-113737774 ACAGGGCAGTAGTCAGGGCTCGG + Intergenic
1060066446 9:120505379-120505401 AGAGGGAAGGAGACAGGGAATGG - Intronic
1060156975 9:121326759-121326781 ACAGGAACGGGGGCAGGGGATGG + Intronic
1060454100 9:123774008-123774030 ACAGTGAAAGAGGAAGGGGAAGG + Intronic
1060722210 9:125986734-125986756 ACAGGGAGGGAGGAATGGGATGG + Intergenic
1061084204 9:128389823-128389845 GCAGGGAAGAAGGCAGGCAAGGG - Exonic
1061389588 9:130310083-130310105 AAAGGGGAATGGGCAGGGGAGGG - Intronic
1062143996 9:134978902-134978924 GGAGGGAGGTAGGGAGGGGAAGG + Intergenic
1062326316 9:136014184-136014206 ACATGGAACTAAGCAGGGGGTGG + Intronic
1062519540 9:136951960-136951982 ACAGGGAGGAAGGCTGGGGCAGG + Intronic
1202778756 9_KI270717v1_random:16055-16077 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1203773596 EBV:61262-61284 GCAGGGAAGAAGGCAGTGGACGG - Intergenic
1203748652 Un_GL000218v1:58546-58568 ACAGGGAGGTCGGCCGGGGTCGG + Intergenic
1203467795 Un_GL000220v1:104110-104132 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1203475620 Un_GL000220v1:148086-148108 AAAGGGAAGGAGGGAGGGAAGGG - Intergenic
1203585833 Un_KI270747v1:2463-2485 ACAGGCAAATCAGCAGGGGATGG + Intergenic
1203612304 Un_KI270749v1:21085-21107 ACAGGGCAGAAGACAGAGGAGGG - Intergenic
1185468993 X:371420-371442 ACAGGGAAGTGGGCAGTGGCAGG + Intronic
1185479702 X:437323-437345 ACAGGGAAGGAAGGAAGGGAGGG + Intergenic
1185485269 X:477224-477246 ACAGGGAAGTAAACAGGTGCAGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185598692 X:1324480-1324502 GCAGGGAGGGAGGGAGGGGAGGG + Intergenic
1186156500 X:6731780-6731802 AAAGGGAAGGAGGGAAGGGACGG + Intergenic
1186265689 X:7831038-7831060 AGAGGGAAGAAGGCTGGGCATGG + Intergenic
1186356827 X:8799652-8799674 CCAGGGATGGGGGCAGGGGAGGG - Intronic
1186357154 X:8800767-8800789 CCAGGGATGGGGGCAGGGGAGGG - Intronic
1186512915 X:10143856-10143878 ACAGGCAGGGAGGCAGGGGGAGG - Exonic
1186965526 X:14782683-14782705 ACAGGGAAGAAGGCAGAGCCAGG + Intergenic
1187611968 X:20953115-20953137 CCAGGGAAGTAGGGAAGTGAGGG + Intergenic
1187940449 X:24375861-24375883 ACAGGGAAGTGGGGAGGGGGCGG + Intergenic
1187965387 X:24606397-24606419 AAAGGGAAGTAAGCAAGGGTTGG + Intronic
1188616420 X:32164238-32164260 ACTGGGTAATAGGCAGGGGTTGG + Intronic
1189204627 X:39227046-39227068 AAAGGGAGGTGGGGAGGGGATGG + Intergenic
1189256472 X:39643653-39643675 ACAGGCACGTAGGCTGAGGAAGG + Intergenic
1189383800 X:40520569-40520591 CAAGGGCAGAAGGCAGGGGATGG + Intergenic
1190203113 X:48381215-48381237 AAAGGGAAGAAGGAAGGGAAGGG - Intergenic
1190207425 X:48414194-48414216 AAAGGGAAGAAGGAAGGGAAGGG + Intergenic
1190758850 X:53423236-53423258 ACAGGGATACAGGCTGGGGAAGG + Intronic
1190873506 X:54444253-54444275 ACAGGGAAGTGATAAGGGGATGG + Intronic
1191896460 X:65998337-65998359 AAAGGAAAGTAGGATGGGGAGGG - Intergenic
1191904883 X:66077205-66077227 GAAGGGAAGGAGGGAGGGGAAGG - Intergenic
1192050117 X:67717272-67717294 TCAGGGAAGTAGGGAGGATAAGG + Intronic
1192167751 X:68836362-68836384 GAAAGGAAGTAGGCATGGGATGG - Intronic
1192429507 X:71102797-71102819 ACAGGGAAGTGGGGAGAGGTGGG + Exonic
1192805649 X:74506254-74506276 ACAGGGAAGTAGATACGGCATGG + Intronic
1193032903 X:76918752-76918774 ACAGGGAGGTGAGCAGGGAAAGG + Intergenic
1193832287 X:86304242-86304264 ACAGAGGAGTAGTCAGGGGAAGG - Intronic
1195021656 X:100834226-100834248 AGAGAGAAGTACGCAGAGGAAGG - Intronic
1195233316 X:102873173-102873195 CCAGGGCAATAGGCAGGAGAAGG - Intergenic
1195234934 X:102887859-102887881 AAAGGGAAAGAGGAAGGGGAAGG - Intergenic
1196157965 X:112451854-112451876 ACAGAGAAGTAGGGATGGGGAGG - Intergenic
1196354233 X:114771090-114771112 ACAGGGAAGTATGCCAGGCATGG - Intronic
1196654366 X:118201645-118201667 CCAGAGAATGAGGCAGGGGATGG - Intergenic
1196913235 X:120505550-120505572 AAAGGGAAGGAGGGAGGAGAAGG - Intergenic
1197437654 X:126452271-126452293 ACTGGGAAGTAGGCAGAGGTTGG + Intergenic
1197534151 X:127666424-127666446 ACTGGGTAATAGGCAGAGGATGG + Intergenic
1197634428 X:128898835-128898857 AAAAGGAATTAGGCAGAGGAAGG - Intergenic
1197665284 X:129216634-129216656 ACAGGGTAGCAGGAAGGAGAAGG + Intergenic
1198327188 X:135585433-135585455 AAAGGGAAGGAGGGAGAGGAAGG + Intergenic
1198330983 X:135622159-135622181 GCAGGGAAGCAGGCAGGGTAGGG + Intergenic
1198335942 X:135666836-135666858 GCAGGGAAGCAGGCAGGGTAGGG - Intergenic
1198761901 X:140040982-140041004 ACAGGGATGCTGCCAGGGGATGG + Intergenic
1199404769 X:147444072-147444094 AGACCGAAGTAGGCAGGTGAAGG - Intergenic
1199679068 X:150213126-150213148 GCAGGGATGGAGGCAGGGGGTGG + Intergenic
1199690644 X:150306623-150306645 CCAGGAAAGTAGGCAGGGCTTGG + Intergenic
1199864098 X:151827587-151827609 CCAGGGAAGGAGGCAAGGGGAGG - Intergenic
1199968744 X:152842926-152842948 TTAGGTGAGTAGGCAGGGGACGG + Intronic
1200379744 X:155822307-155822329 AGAGGGAGGGAGGGAGGGGATGG + Intergenic
1200397394 X:155999223-155999245 AGAGGGGAGTAGGCAAGGGTGGG - Intronic
1200786229 Y:7263264-7263286 ACAGGGAAGTAAACAGGTGCAGG - Intergenic
1201162008 Y:11173516-11173538 ACAGGGAGGTCGGCCGGGGTTGG + Intergenic
1201194054 Y:11474323-11474345 ACAGGCAAGTCAGCAGGGGATGG + Intergenic
1201480420 Y:14432717-14432739 GGAGGGAAGGAGGGAGGGGAAGG + Intergenic