ID: 1112108754

View in Genome Browser
Species Human (GRCh38)
Location 13:96271152-96271174
Sequence GCAGCTTGAAATCACCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112108754_1112108756 6 Left 1112108754 13:96271152-96271174 CCAGCATGGTGATTTCAAGCTGC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1112108756 13:96271181-96271203 GATGATATTGAATGTCGAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 109
1112108754_1112108757 15 Left 1112108754 13:96271152-96271174 CCAGCATGGTGATTTCAAGCTGC 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1112108757 13:96271190-96271212 GAATGTCGAGTTGGAAAGAGAGG 0: 1
1: 0
2: 4
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112108754 Original CRISPR GCAGCTTGAAATCACCATGC TGG (reversed) Intronic
900392445 1:2439630-2439652 GCAGCCTGAGGTCACCATGGAGG - Intronic
900798664 1:4724593-4724615 GCCGGTGGAAAGCACCATGCAGG - Intronic
901438725 1:9264743-9264765 GAAGCGTGAGATCACCACGCTGG + Exonic
901774480 1:11550707-11550729 GCTGCTGGAAATCACAAGGCTGG - Intergenic
902127416 1:14227493-14227515 GCACCCTGAGATCACCAGGCTGG - Intergenic
902355971 1:15900706-15900728 GCAGCTTGAAATTAGCATGTTGG + Intronic
905284190 1:36868578-36868600 GTAGCTTGAAATCACTGTGACGG - Intronic
906216736 1:44045553-44045575 GGGGCTTGACATCACCATGATGG + Intergenic
906781890 1:48580043-48580065 GAAGTATGAAACCACCATGCAGG + Intronic
906875475 1:49533548-49533570 GAATCTTAAAATCTCCATGCAGG - Intronic
908644869 1:66266386-66266408 GCAGCTTGACCTCAGCTTGCTGG + Intronic
909469646 1:76012690-76012712 GCAGCTTGAAATTTCTGTGCTGG + Intergenic
912547626 1:110462317-110462339 GAACCTTGAAAACATCATGCTGG + Intergenic
916422465 1:164649744-164649766 GCAACTCAAAATGACCATGCTGG + Intronic
917644430 1:177016365-177016387 GAAGCCAGAATTCACCATGCAGG - Intronic
917666297 1:177229025-177229047 GCAGCTTGAGAGCACCACGAGGG - Intronic
917876742 1:179293385-179293407 GCAGTTTGAACTGACCATCCAGG - Intergenic
919458531 1:197848170-197848192 GTAGCTTGAAATTAGCATGATGG - Intergenic
920390995 1:205601334-205601356 GTAGCTTGAAATCAGCCTGGTGG + Exonic
920725297 1:208429250-208429272 GAGGCTTGAAATCACCAGTCCGG + Intergenic
920877227 1:209848180-209848202 GCACATTGAAATCACCTAGCTGG - Intronic
1063069514 10:2647000-2647022 GCAGTTAGAATTCACCTTGCAGG + Intergenic
1064571270 10:16695828-16695850 TCAGCTTGAAATCTTCATGCTGG - Intronic
1067712112 10:48657617-48657639 GCAGCTGGAACACACCATCCTGG - Intergenic
1070194288 10:74142038-74142060 ACAGCTTGTAAACATCATGCAGG - Intronic
1070556388 10:77531120-77531142 GCAGCCAGAAAGCACCACGCGGG + Intronic
1071613159 10:87049874-87049896 GCAGATAGACACCACCATGCTGG + Intergenic
1072527470 10:96286401-96286423 AGAGCTTGAAATCAGCATGACGG + Intergenic
1078654208 11:13223087-13223109 GCAGTTTGAAATGATCACGCTGG - Intergenic
1083610856 11:64003614-64003636 GCGGCTGTAAATCACCACGCAGG - Intronic
1084497829 11:69515318-69515340 GCTGCCTGAAGTCACCATGTGGG - Intergenic
1086806302 11:91247011-91247033 CAAGCATGAGATCACCATGCAGG - Intergenic
1088504423 11:110514363-110514385 CCAGCTTGCCATCACCATTCAGG - Intergenic
1088730461 11:112677194-112677216 GGAGCTAAAATTCACCATGCGGG + Intergenic
1092035680 12:5332670-5332692 GCAGCTTGAAATTTCCACGGTGG - Intergenic
1092055750 12:5506847-5506869 GCAGCTGGAAATCCAGATGCTGG + Intronic
1095505537 12:42893866-42893888 GCAGCTTGAAAGTATCATGCAGG + Intergenic
1096573145 12:52535728-52535750 GTAGCTTGAAATCACCTTTGTGG + Intergenic
1099296812 12:80838294-80838316 GCAGGCTGAAATCACCAGGTGGG + Intronic
1100883957 12:99048828-99048850 ACAGCTTGAAATCTGGATGCAGG + Intronic
1102586211 12:113924786-113924808 GCAGCTCTAAACCACTATGCAGG + Intronic
1103716039 12:122945920-122945942 CCAGCTTGACACCAACATGCAGG + Intronic
1104677012 12:130718003-130718025 GGACCTTGAGAGCACCATGCTGG + Intergenic
1112108754 13:96271152-96271174 GCAGCTTGAAATCACCATGCTGG - Intronic
1121680949 14:95792362-95792384 GCAGCTGGACATCAGCATGGTGG + Intergenic
1121813385 14:96911068-96911090 GCAGAGTGAAATCACCCTGCAGG - Intronic
1124889898 15:33723117-33723139 GCAGCTGGAAATCACAAAGTGGG + Intronic
1124908862 15:33898406-33898428 GAAGTCTGAAATCAACATGCTGG + Intronic
1125472327 15:40016307-40016329 ACAACTTGAAAGCACCTTGCAGG - Intronic
1125781327 15:42271391-42271413 ACAGATTAAAACCACCATGCAGG + Intronic
1129012990 15:72439880-72439902 GCACCTTGCAAACATCATGCGGG + Intergenic
1129367755 15:75067269-75067291 TCAGCATGAAGTCACCAGGCTGG - Intronic
1129407130 15:75327370-75327392 GCCTCTGGAAATCACCATTCTGG - Intergenic
1130701707 15:86189870-86189892 TCACCTTGACATTACCATGCTGG + Intronic
1131677800 15:94688885-94688907 GGAGCTTAAAATCAGCATACAGG + Intergenic
1132180156 15:99746481-99746503 GCATCTTGAAAAGACCAGGCTGG - Intergenic
1132829538 16:1920545-1920567 GGAGATGGAAATGACCATGCTGG - Intergenic
1134625672 16:15720919-15720941 GCGGCTGGAAGTCAACATGCAGG - Exonic
1137773547 16:51037331-51037353 GCCACTAGAATTCACCATGCAGG + Intergenic
1145836080 17:27955244-27955266 GCAGCCACAAACCACCATGCAGG + Intergenic
1154285026 18:13046413-13046435 GCAGATTCAAACCCCCATGCTGG - Intronic
1157147601 18:45180374-45180396 GTACCTAGAAATGACCATGCAGG + Intergenic
1158335526 18:56412057-56412079 GAAGCTTCAAACCCCCATGCTGG + Intergenic
1159741040 18:72170900-72170922 ACAGCTTAACATCATCATGCTGG + Intergenic
1163838360 19:19590353-19590375 GCACCTTGAAAACATGATGCTGG - Intronic
1165785681 19:38460396-38460418 GGAACTTGAATTCACCATGGCGG - Exonic
1167425968 19:49429707-49429729 GCATCATGAAACCACCATGGGGG + Exonic
1167660690 19:50794453-50794475 GCAGCATGACAGCACCCTGCTGG + Exonic
926777346 2:16435517-16435539 GCAGCATGAAAACACATTGCTGG + Intergenic
928113657 2:28529542-28529564 GCAGCCTGAAATCAGCTTGAGGG - Intronic
931439781 2:62280414-62280436 GTAGCTTGAGATCTCCCTGCTGG - Intergenic
932355331 2:71063817-71063839 GTAGCTTGAAATCACCGTGGTGG - Intergenic
932764205 2:74459967-74459989 GCAGCGTGAAATCAACTTGTTGG + Exonic
933909924 2:86930466-86930488 GCAGCGTGAAATCAACTTGTTGG - Intronic
934022801 2:87972922-87972944 GCAGCGTGAAATCAACTTGTTGG + Intergenic
941824807 2:169883313-169883335 CCAACTTGAGACCACCATGCTGG - Intronic
946672554 2:222121684-222121706 GCAGCTTGACATCAACTTGAAGG + Intergenic
947912255 2:233809163-233809185 GCAGCTATACATCACCATGAGGG - Exonic
1171447711 20:25216648-25216670 GCAGCTTGAAAACTCCAGGAGGG + Exonic
1175340080 20:58223037-58223059 GAAGCTTGAAAACACCTTGCTGG + Exonic
1177431422 21:20996922-20996944 TCAGCGTGAAATCCCCAGGCTGG + Intergenic
1178704043 21:34858283-34858305 CCACCTAGAAACCACCATGCAGG + Intronic
1179239508 21:39576936-39576958 GCAGAATGAATTCACCATGCAGG + Intronic
1180246429 21:46550954-46550976 GCAGGTGGAAACCACCATGCAGG - Intronic
1182433081 22:30312153-30312175 GCTGCTTGAAATTCCCTTGCTGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954817280 3:53292578-53292600 CCAGCCTGAAATCACCACCCCGG - Exonic
954945693 3:54422208-54422230 GCCGCTGGAAACCACCATGAGGG - Intronic
954977424 3:54709500-54709522 GCAGGTGTACATCACCATGCTGG + Intronic
955478637 3:59366375-59366397 CCAGCGTGATATCACCATGTGGG + Intergenic
959046835 3:101484356-101484378 ACAGCTTGAAATCATCATGGTGG + Intronic
961546238 3:127635731-127635753 CCAGCATGGAATCACCATGAGGG - Intronic
961945710 3:130685092-130685114 GCAGGTTCAAAACACCATGAGGG + Intronic
967408418 3:189142644-189142666 ACAGGTTGCAAGCACCATGCAGG - Intronic
968022178 3:195402328-195402350 GCAGATTGGAATCACAAGGCTGG - Intronic
970260739 4:14221645-14221667 CCAGCTTGAAAGAACTATGCTGG + Intergenic
970307732 4:14750631-14750653 GAAGCTTGAAATCAAGGTGCTGG + Intergenic
977110162 4:92943153-92943175 CCAGCTGGAAAACACCCTGCAGG - Intronic
978754615 4:112288587-112288609 GCAGCTGGAAATCACCTTTGAGG + Intronic
983341914 4:166471707-166471729 GCAGGTGAGAATCACCATGCTGG - Intergenic
984858769 4:184218640-184218662 AGAGCTAGAAATTACCATGCAGG + Intronic
987137463 5:14913167-14913189 ACAACTGGAAACCACCATGCAGG - Intergenic
991741244 5:69678320-69678342 GAAGCATGAAATCACCTTGAAGG - Intergenic
991756374 5:69876122-69876144 GAAGCATGAAATCACCTTGAAGG + Intergenic
991792818 5:70258057-70258079 GAAGCATGAAATCACCTTGAAGG - Intergenic
991820704 5:70554393-70554415 GAAGCATGAAATCACCTTGAAGG - Intergenic
991835776 5:70752035-70752057 GAAGCATGAAATCACCTTGAAGG + Intergenic
991885268 5:71258365-71258387 GAAGCATGAAATCACCTTGAAGG - Intergenic
992321376 5:75616354-75616376 GCATTTTGAAATCTTCATGCAGG + Intronic
997392720 5:133530345-133530367 GCAGGTTAAAAACACCTTGCTGG + Intronic
1002098675 5:176846713-176846735 GCAGCTTAGATTCACCAAGCAGG - Intronic
1010247550 6:73675733-73675755 GCAGCTGGTCATCATCATGCTGG - Intergenic
1011972714 6:93247597-93247619 GCAGATTGAAATCAGCGTGGGGG + Intronic
1013784629 6:113765678-113765700 CTACCTGGAAATCACCATGCTGG + Intergenic
1013915297 6:115329974-115329996 GCTGCTTGAAAAGACCATGTAGG - Intergenic
1017021777 6:150145475-150145497 GCAATTTGTAATCACTATGCTGG + Intronic
1018172502 6:161153439-161153461 GAAGCATGAGATCAGCATGCAGG - Exonic
1018898405 6:168037449-168037471 TCGGATTGACATCACCATGCAGG + Intronic
1022513864 7:30963358-30963380 GCAGCTTCAGCTCACCATCCAGG + Intronic
1025523586 7:61774525-61774547 GCAGTTTGAAAACACCATTTTGG - Intergenic
1028111103 7:86942453-86942475 ATAGCTTGCATTCACCATGCAGG + Intronic
1030430569 7:109442067-109442089 GCCTCTTGAAAGAACCATGCAGG - Intergenic
1031763000 7:125737661-125737683 GCGGCTTGAAGTCACCATCACGG - Intergenic
1037261866 8:17018726-17018748 GTAGCCTGAAATCACCACGGTGG + Intergenic
1038023422 8:23568985-23569007 ACAGTTTTAAACCACCATGCCGG - Intronic
1039860954 8:41456797-41456819 GAACCTTGAAAACATCATGCTGG - Intergenic
1043559635 8:81476937-81476959 GCAGCTTGCAGTCATCTTGCAGG - Intergenic
1044474523 8:92610645-92610667 GCAACTTGGACTCACCCTGCCGG - Intergenic
1050572845 9:6959224-6959246 TCTGTTTGAAATCCCCATGCTGG + Intronic
1051906702 9:22103449-22103471 GAAGCTTGATGTCAGCATGCAGG - Intergenic
1055721089 9:79175694-79175716 GAAGCTTGACATCAGCAGGCTGG - Intergenic
1056221245 9:84452506-84452528 GCTGCTTCAAGTCACCATTCAGG - Intergenic
1057119653 9:92559562-92559584 GGAGCTAGAATTCACAATGCAGG + Intronic
1057180265 9:93026016-93026038 GCTGCTTGAAATGACCCAGCAGG - Intronic
1060398302 9:123331907-123331929 GCAGCCTGACATAACCAGGCAGG + Intergenic
1188559164 X:31448202-31448224 TCAGCTAGAAATCATCATGAGGG + Intronic
1192842460 X:74871251-74871273 GCAGCTTGAGGTCACCATCATGG - Intronic
1193920925 X:87425272-87425294 CTAGCTTGAAATAACCATGCTGG - Intergenic
1195665612 X:107427566-107427588 GCAGCTGGAAACCATCATTCTGG + Intergenic