ID: 1112111881

View in Genome Browser
Species Human (GRCh38)
Location 13:96310393-96310415
Sequence TTGGGTTTGCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 365}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112111874_1112111881 12 Left 1112111874 13:96310358-96310380 CCATGGCCAATAAATCTATCCTT 0: 1
1: 0
2: 0
3: 19
4: 184
Right 1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 40
4: 365
1112111875_1112111881 6 Left 1112111875 13:96310364-96310386 CCAATAAATCTATCCTTTGCTTA 0: 1
1: 0
2: 2
3: 27
4: 281
Right 1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 40
4: 365
1112111878_1112111881 -7 Left 1112111878 13:96310377-96310399 CCTTTGCTTAAGAGTCTTGGGTT 0: 1
1: 0
2: 2
3: 10
4: 200
Right 1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG 0: 1
1: 0
2: 2
3: 40
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112111881 Original CRISPR TTGGGTTTGCAGAAGGTGGA AGG Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900700494 1:4045674-4045696 TGGGGTTTGGAGAAGCTGAAAGG - Intergenic
900945069 1:5826441-5826463 TCGGGTGTGCAGTAGGTGGTTGG + Intergenic
902162538 1:14542944-14542966 TTGGGTATGGAAAAGATGGAAGG + Intergenic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903841200 1:26242151-26242173 TAGGGTATGGAGTAGGTGGATGG + Intronic
904495665 1:30885182-30885204 TGGGGTTTACAGAAGGAGGCTGG + Intronic
904681697 1:32233892-32233914 CTGGGTTTGCAGAAGTTAGGAGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
907236799 1:53056824-53056846 TTGGGGAGGCAGAAGGTGGGAGG - Intergenic
907473446 1:54689615-54689637 TTGGGTTTGAAGGAGGAGGAGGG + Intronic
908239776 1:62179028-62179050 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
911431942 1:97800797-97800819 TTGACTCTACAGAAGGTGGAAGG - Intronic
911521591 1:98936418-98936440 TTGGGTTTGGAGATGCTGGCTGG - Intronic
912518991 1:110232637-110232659 TTGGGTTGGCAGAGGGGTGAAGG + Exonic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918342634 1:183580178-183580200 TTGGGTTTGAAATAGGAGGATGG + Intronic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918653720 1:186998706-186998728 TGGGGGTTGCAGGAGGAGGATGG - Intergenic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918910308 1:190559310-190559332 TTGGTTTTGGAGAAGGAGGATGG - Intergenic
919253145 1:195085208-195085230 GTGGTTTGGCAGAGGGTGGATGG - Intergenic
919742541 1:200989603-200989625 TTGAGTCTGCTGGAGGTGGAGGG - Intronic
922476944 1:225912857-225912879 GTGGGATTGTAGAAGGGGGAGGG + Intronic
923709817 1:236378261-236378283 TTGTGTTTGTAGAAGAGGGAGGG - Intronic
924226331 1:241924857-241924879 TTGGATTTTCAGCAGGAGGAGGG + Intergenic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1064677936 10:17780556-17780578 TTGGGTTTGCAGGAGTTTGTAGG + Intronic
1065567699 10:27031518-27031540 CTAGGATTGGAGAAGGTGGAGGG + Intronic
1065644371 10:27819142-27819164 TTGGGTTTGCAGAAGGCTGGGGG - Intronic
1066244272 10:33567200-33567222 CTGAGTTTGCTGAAGGTGCATGG - Intergenic
1066750180 10:38647090-38647112 TTGGGTTCTCAGAAGGGGGTTGG + Intergenic
1067349766 10:45465349-45465371 GTGGGCCTGCAGAAGGTGGGTGG - Intronic
1068736148 10:60415456-60415478 CTCGGGTTGCAGCAGGTGGAGGG - Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1071711524 10:88054367-88054389 TTGGATTTGCAGGAGCGGGAAGG + Intergenic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1073835642 10:107438010-107438032 TTGGGTTTCCAGCAGAGGGAGGG - Intergenic
1075173562 10:120138448-120138470 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1075284688 10:121173098-121173120 TGGGGATTCCAAAAGGTGGAAGG + Intergenic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1076325265 10:129615973-129615995 TTTGGTTTGCAGATGGGGGTGGG + Intronic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077120466 11:905183-905205 TTGGGTTTGAAGGAGGAGGTGGG - Intronic
1078406132 11:11071428-11071450 TGGGGTGCACAGAAGGTGGATGG + Intergenic
1078753260 11:14185213-14185235 TTGGCTTTGCTGATGGTGGGGGG - Intronic
1078780951 11:14438960-14438982 TTGGTCTTGGAGAAGGTGGAAGG + Intergenic
1078831256 11:14979549-14979571 TTGGGTTTGAAGACAGAGGAAGG - Intronic
1079238241 11:18704653-18704675 TTGGGTTGGCAGAGTGTGAAGGG + Exonic
1079384143 11:19963995-19964017 TTGGGTTTGCAGTGGGTGAGGGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081715459 11:45246840-45246862 TGGGGGTGGCAGAAGGTGAAGGG - Intronic
1081775460 11:45673428-45673450 TTGGGTTTGAGGAAGGGAGATGG - Intergenic
1082693043 11:56328405-56328427 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1083745409 11:64733448-64733470 TGGGGCCTGCAGGAGGTGGAGGG + Intronic
1084177082 11:67428564-67428586 TTGGATTTGGAGACGGAGGAAGG + Exonic
1084508675 11:69587692-69587714 TTGGGTCTGCAGAATGAGGCAGG - Intergenic
1084754211 11:71224532-71224554 TTGGGTGGGAAGAGGGTGGATGG - Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085448460 11:76616518-76616540 TGGGGTTTGCAGAAACTGCACGG - Intergenic
1086662728 11:89441346-89441368 TTGGTTTTCCAGAAGGTAGAAGG - Intronic
1087738977 11:101866304-101866326 TTGCGCTTGCAGAAGTTGGAGGG + Intronic
1088114918 11:106302887-106302909 TTGGGTTGCCATGAGGTGGAGGG + Intergenic
1090072343 11:123554865-123554887 TTGGGTTTGGAGGAAGTGCAGGG - Intronic
1090334238 11:125951969-125951991 TTGGGCCTGCAGGAGGTGAACGG - Intergenic
1090770650 11:129916755-129916777 TGGGGTTTCTATAAGGTGGAGGG - Intronic
1090887935 11:130895764-130895786 TTGAGATTGTAGCAGGTGGATGG - Intronic
1093348768 12:18071223-18071245 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1094351250 12:29527928-29527950 TTGGGGTTACTGAAGGTGTAGGG - Intronic
1099036229 12:77590500-77590522 TGGGGTTATCAGAGGGTGGAGGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099899736 12:88693086-88693108 TCGTGTGTGCAGAAGGGGGAGGG + Intergenic
1101965395 12:109278963-109278985 ATGGGTTTGCAGAAGTGGGGTGG + Exonic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1107137979 13:36965163-36965185 TTAGGTTTTGACAAGGTGGAAGG + Intronic
1107284767 13:38778632-38778654 TGGGCATTTCAGAAGGTGGAGGG + Intronic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108606924 13:52048816-52048838 TGGGGTTGGGAGAAGGTGGAAGG + Intronic
1109606528 13:64704969-64704991 AGGGGTTTGCAGAAGGATGAAGG + Intergenic
1110877133 13:80523788-80523810 TTGGCTTTGCAGAATGAGTAAGG + Intergenic
1111048249 13:82845615-82845637 TTCATTTTGCAGAAGGTAGAAGG - Intergenic
1111323622 13:86663397-86663419 TTGATTTTACAGTAGGTGGAAGG - Intergenic
1111786759 13:92796633-92796655 TTTGTTTTGAATAAGGTGGATGG - Intronic
1111806398 13:93044116-93044138 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1112111881 13:96310393-96310415 TTGGGTTTGCAGAAGGTGGAAGG + Intronic
1112415586 13:99201024-99201046 TCGGGTTTGCCGGAGGTGGTGGG + Intronic
1114049963 14:18914386-18914408 TGGGCTTTGCAGAGGGCGGATGG - Intergenic
1114112594 14:19487544-19487566 TGGGCTTTGCAGAGGGCGGATGG + Intergenic
1114514505 14:23289328-23289350 TTGGAATTACAAAAGGTGGATGG + Intronic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116939517 14:50776953-50776975 TATGGTTTACAGAATGTGGATGG - Exonic
1118468537 14:66053800-66053822 TTGGCTTTGAAGACGGAGGAAGG - Intergenic
1119052571 14:71384393-71384415 TTGAGTTGGCAGAAGGGAGAGGG + Intronic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121705262 14:95988462-95988484 TGGGGTATGGAGAAGGTGGTGGG - Intergenic
1121885855 14:97542174-97542196 GTGTGTTAGCAGAAGCTGGAGGG - Intergenic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1122477856 14:102024083-102024105 TTGGATTTCCAGCCGGTGGAAGG + Intronic
1126739166 15:51760382-51760404 TTTGCTTTGAAGATGGTGGAAGG - Intronic
1127818370 15:62632790-62632812 GTGGTTGTGCAGAATGTGGAGGG + Intronic
1128505461 15:68267959-68267981 TTGCATTGGCAGAAGGTGAAAGG + Intergenic
1129823974 15:78622196-78622218 TTGGGGTTGCAGATGGTGGCGGG - Intergenic
1129929622 15:79399506-79399528 TTGGGTCTGGAGAAGTAGGATGG + Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130844793 15:87734629-87734651 TTGGGTTTGCAGAAGCCTGTAGG - Intergenic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1133517026 16:6519369-6519391 CTGGGTTTTCCCAAGGTGGAGGG - Intronic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134262443 16:12662889-12662911 ATGGGTTTGCAGAAGGATAATGG - Exonic
1135562530 16:23487692-23487714 TTAGGTTTGCAGAGGGTGGGAGG - Intronic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1137690245 16:50421347-50421369 TTTGGTTTGCTGCAGATGGAAGG - Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1140878983 16:79180284-79180306 TTAAGTGTGCACAAGGTGGAAGG + Intronic
1141617699 16:85219746-85219768 TGTGGCTTGCAGAAGGGGGAAGG - Intergenic
1142732839 17:1873396-1873418 TTGGATTTGTAGAATGTGGTTGG + Intronic
1143803991 17:9410106-9410128 TTGGGTGGGATGAAGGTGGAGGG - Intronic
1143822093 17:9573003-9573025 TTTAGGTTCCAGAAGGTGGAGGG + Intronic
1146536680 17:33658612-33658634 TTGTGTCTGCACACGGTGGAAGG + Intronic
1146568972 17:33936964-33936986 TTGGGCTTGGTGGAGGTGGAGGG - Intronic
1146603996 17:34242491-34242513 TTTGTTTTGCAGAAAATGGAAGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1146977426 17:37126632-37126654 TTGGGTTTTTAGGGGGTGGAGGG - Intronic
1149084171 17:52694379-52694401 CTGTGTTTTCACAAGGTGGAAGG - Intergenic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1151588852 17:75029923-75029945 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1152561417 17:81080712-81080734 TTGGGGCTGCAGAATGTGGCGGG + Intronic
1153092932 18:1369172-1369194 TTGGGTTTTCAGGTGATGGAAGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153482260 18:5558545-5558567 TTAGGTATGTAGAAGGTGCATGG + Intronic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1153930368 18:9873411-9873433 GTGGGTTTGCAGAAGGATGAGGG + Intergenic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1156579982 18:38363653-38363675 TTGTGTTTTCAAATGGTGGAAGG - Intergenic
1156581535 18:38382239-38382261 TTGTGTTTTCAAATGGTGGAAGG + Intergenic
1157570198 18:48707104-48707126 TGGGGAGTGCAGGAGGTGGAGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158173687 18:54628733-54628755 TGGGTTTTGAAGAAGATGGATGG + Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1159102955 18:63975401-63975423 TAGGGTCTGCAGATGTTGGAAGG - Intronic
1159613054 18:70547527-70547549 TTGGTTTTGCAAAAGCTGGCAGG + Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1159985238 18:74833804-74833826 TTAGGATGGCAGTAGGTGGATGG + Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160334676 18:78028139-78028161 TTGTGTTTGTTGGAGGTGGAGGG + Intergenic
1161747933 19:6072951-6072973 TAGGGTTTGCAGAAGGTTCAAGG + Intronic
1161956248 19:7497075-7497097 TGGGGTGTGTAGAAGGTAGAGGG + Intronic
1162989272 19:14291847-14291869 TTGGGTTTCCTGGAGGTGGGTGG + Intergenic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163762807 19:19146423-19146445 TTAGGTTTGCAGAAGGCTTAAGG - Intronic
1163962592 19:20711216-20711238 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1164322948 19:24167048-24167070 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1165057954 19:33190604-33190626 TGGGGCTTGGAGAAGGTGGCAGG + Intronic
1165076040 19:33280537-33280559 TTGGTTTTCCAGCAGGTGGCTGG - Intergenic
1166944869 19:46390486-46390508 TTAGGTTTGCAGAGGGGGTAGGG + Exonic
926211536 2:10874421-10874443 CAGGGTTTGTAGAAGGTGCAAGG - Intergenic
926361704 2:12094152-12094174 ATGGTTTAGCAGAAGGTGCAGGG + Intergenic
928363016 2:30680728-30680750 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928726493 2:34179784-34179806 TTAGATTTGCAGAATGTTGAAGG - Intergenic
929229087 2:39540693-39540715 TTGGGAGTGTAGAAGGTGGGGGG + Intergenic
930978646 2:57495003-57495025 TTGGCTTTGGAGATGGAGGAAGG + Intergenic
931785137 2:65611424-65611446 TGGGGGTGGCAGAAGGTGGGGGG + Intergenic
933353610 2:81188455-81188477 TTGAGTTTGGAGAAGCTGTAGGG - Intergenic
934313182 2:91889265-91889287 TTGGGTTCTCAGAAGGGGGTTGG + Intergenic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
935686596 2:105689130-105689152 ATGGGGTTGGAGGAGGTGGAAGG - Intergenic
936341812 2:111640299-111640321 TTGGCTTTGAAGATGGGGGAAGG + Intergenic
937160304 2:119754853-119754875 CTAGGTTTGAAGATGGTGGAAGG + Intergenic
937281163 2:120718141-120718163 TTGGCTTTGCAGATGTAGGAAGG - Intergenic
937301608 2:120846172-120846194 GTGGCTTTGAAGAAGGTGGAAGG - Intronic
938812466 2:134866382-134866404 TTGGGTTTGGCAAAGGTGCATGG - Intronic
939831456 2:147077169-147077191 CTGGGTTTGCACAAGGTTGAAGG + Intergenic
940037302 2:149324266-149324288 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
940763320 2:157762483-157762505 TTGGTTCTGCAAATGGTGGAGGG - Intronic
940838977 2:158557822-158557844 TTGGGTTTGAAGAAGGCAGCTGG + Intronic
941372864 2:164688793-164688815 TTGGTTCAACAGAAGGTGGAGGG - Intronic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
941770529 2:169340563-169340585 GTGGGATTGCAGAAGGAGAAAGG - Intronic
942789924 2:179749367-179749389 TGGAGTTTGGAGGAGGTGGAAGG - Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943794501 2:191975411-191975433 TTGAGTTTGGAGAAAGTTGAGGG - Intronic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
947425860 2:229982327-229982349 TTGGCTTTGCAGATAGAGGAAGG - Intronic
948229103 2:236336714-236336736 TTGGTGTTACAGATGGTGGAGGG - Intronic
948333656 2:237191429-237191451 TTGCGTTTCCTGAAGATGGAGGG - Intergenic
948668130 2:239548996-239549018 TTGGCTTTGAAGATGGGGGAGGG - Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1168902389 20:1376091-1376113 TGGGGGTGGCAGATGGTGGAGGG - Intronic
1170497725 20:16942823-16942845 TGCGGTTTGCTGAAAGTGGAAGG - Intergenic
1170570801 20:17631434-17631456 TTGGGGTTCCTGAAGGTGGGTGG - Intronic
1173428991 20:42968811-42968833 TTGTGATGACAGAAGGTGGATGG - Intronic
1174273114 20:49384006-49384028 GTGGGTTTGGAGTAGGAGGAAGG - Intronic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175306914 20:57982522-57982544 TTGGTTTTGCAGAAGCCAGAAGG + Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1178046957 21:28705828-28705850 TTGGCTTTGAAGATGGGGGAGGG - Intergenic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179471664 21:41614424-41614446 TTGGCTTTGAAGAGGGAGGAAGG + Intergenic
1180539915 22:16435136-16435158 TTGGGTTCTCAGAAGGGGGTTGG + Intergenic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1180922053 22:19526047-19526069 ATGGGTCTGCAGCAGGAGGAAGG - Intronic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1181812866 22:25414798-25414820 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1182491613 22:30676003-30676025 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183265214 22:36820697-36820719 TGGGGTTTGCTGAAGAAGGAAGG + Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183818343 22:40322935-40322957 TTGGGGTTGCTGCAGGTGTAGGG - Exonic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1185159291 22:49213206-49213228 ATGGGCTTCCAGAAGCTGGAGGG - Intergenic
949375762 3:3388730-3388752 TGGGGTTAGTTGAAGGTGGAGGG - Intergenic
949479117 3:4476718-4476740 TTGGTTTTGCACATGGAGGAAGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
953210856 3:40873787-40873809 CTGGGTTTGCAGAGGGAGCAAGG - Intergenic
953430498 3:42835882-42835904 TCGGGTGGGCAGAAGGAGGAAGG - Intronic
953450213 3:42999350-42999372 TGGGGTTTGCTGCATGTGGAAGG - Intronic
953576663 3:44118075-44118097 TACTGTTTGCAGAATGTGGAAGG + Intergenic
953686982 3:45085714-45085736 TTGGGATGGGAGAAGGTGTACGG + Exonic
954795582 3:53160010-53160032 TTGAGATTGCGGAAGATGGATGG - Intronic
957037154 3:75304357-75304379 TTTGGTTTGGAGATGGAGGAAGG + Intergenic
957966790 3:87332532-87332554 TTGATTTTGCAGAATGTGGATGG + Intergenic
960044182 3:113180219-113180241 TTGGGTCTTCAGAAAGTGAAAGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961037780 3:123654661-123654683 GGGGGTTAGGAGAAGGTGGAGGG - Intronic
961179773 3:124867407-124867429 TAGGGTTTGCAGAAGTTGGGAGG - Intronic
962950124 3:140210756-140210778 GTGGGTTTGAAGGAGGAGGAGGG + Intronic
963602935 3:147392973-147392995 TTGGGTTTGCAAATGCTGGCAGG - Intronic
963859794 3:150297374-150297396 TTGAGTTGGCTGGAGGTGGAAGG + Intergenic
964144357 3:153441373-153441395 TTGGGTTTGACAAAGCTGGAGGG - Intergenic
964690045 3:159440068-159440090 TTGGTTTTGCATATGGTGTAAGG + Intronic
964990005 3:162798912-162798934 TTGGGCTTGCAATAGGTGGTAGG - Intergenic
965056631 3:163725435-163725457 TTGGCTTTGAAGAAGATGGAAGG - Intergenic
966838111 3:184065350-184065372 TTGGATTTCCAGAAGATGGAAGG - Intergenic
966879550 3:184342234-184342256 CTCGCTTTGCAGCAGGTGGATGG + Exonic
968173850 3:196531643-196531665 TTGTGTTTGCAGAACAAGGACGG - Intergenic
970584741 4:17504296-17504318 TTGGGTTTGCACTAGGTGACAGG - Intronic
971695811 4:29901529-29901551 TTGGCTTTGAAGATGGTAGAGGG + Intergenic
973800700 4:54474933-54474955 TTGGCTATGCTGAGGGTGGATGG + Intergenic
975419836 4:74150062-74150084 TTGGCTTTGAAGATGGGGGAAGG + Intronic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976437319 4:85033082-85033104 CTGTGTTTTCACAAGGTGGAAGG + Intergenic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
976647731 4:87402749-87402771 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
978556275 4:109984122-109984144 TGGGGTTTGCAGAAGCTCTAGGG - Intronic
979381076 4:120007462-120007484 TAGGGATTGTAGAAGGTAGAAGG - Intergenic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
984386650 4:179068340-179068362 TGGGGCTTGGAGAAGGGGGATGG - Intergenic
984938383 4:184909721-184909743 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
985697970 5:1352549-1352571 GTGGGTTTGCTGCAGGTGGGAGG + Intergenic
986039720 5:3980846-3980868 TTTGGCTTGCAGATGGTGGTTGG + Intergenic
986694342 5:10338801-10338823 TTGGGTGTGCAGTCGGAGGATGG - Intergenic
987721337 5:21636674-21636696 CTGGTTTTGAAGAAGGCGGAAGG - Intergenic
987725280 5:21690522-21690544 TTGGGATTGGACTAGGTGGATGG - Intergenic
987876810 5:23690479-23690501 TCGGGGTTGCAGAAGGATGAGGG - Intergenic
987956494 5:24748216-24748238 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988144802 5:27291991-27292013 TTGAGTTGGCAGAGGGTGGGGGG + Intergenic
988456867 5:31394514-31394536 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
989094810 5:37771988-37772010 TTTGGATTTCAGAAGGGGGAAGG - Intergenic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991297055 5:65092862-65092884 TTGGGGTGGCAGATGGGGGAGGG - Intergenic
991703869 5:69339441-69339463 TTGGGGTTGGGGGAGGTGGAAGG + Intergenic
993156864 5:84236457-84236479 TTGGGTTTGGATAGGGAGGAAGG - Intronic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
996526178 5:124482234-124482256 TAGGGGTTGCTGAAGGTGGATGG + Intergenic
997389450 5:133502015-133502037 TGGGGCTTCCAGAAGCTGGAAGG + Intronic
997499970 5:134365875-134365897 TTGGCTTTGAAGGATGTGGAGGG - Intronic
998392280 5:141795110-141795132 TGAGGTCTGCGGAAGGTGGATGG - Intergenic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999589947 5:153133935-153133957 TTGGGTTTCCACATGATGGAAGG - Intergenic
999871299 5:155754038-155754060 TTGAGTTTGCAGACTGTGTATGG + Intergenic
1001244829 5:170098251-170098273 TGGGGGGTGCAGAGGGTGGATGG + Intergenic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1004412285 6:15391921-15391943 ATGCTTTTGCAGAATGTGGAGGG + Intronic
1005020894 6:21417807-21417829 TTGGATTTGCATAATGTTGACGG - Intergenic
1006020216 6:31113336-31113358 TTGGCTTTGGAGATGGAGGAAGG - Intergenic
1006874679 6:37285096-37285118 CAGGGGTTGCAGAAAGTGGAAGG + Intronic
1008711622 6:54234599-54234621 GTGAGTTTGCAGAAAGGGGATGG - Intronic
1009533536 6:64851785-64851807 GTGGCTTTTCAGAGGGTGGAGGG + Intronic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009795483 6:68461691-68461713 TGGGGTTGGGAGAAGGGGGAGGG - Intergenic
1010491001 6:76476570-76476592 TTGGGCTTTCAGAAGGGGTATGG - Intergenic
1010686264 6:78858065-78858087 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1013942219 6:115678689-115678711 TTGGATTTGCTGGATGTGGAAGG + Intergenic
1014125198 6:117769134-117769156 TTGGGTTTCCACAAGGTATATGG + Intergenic
1014813623 6:125911588-125911610 TAGGGGTTGCAGAAGGATGAAGG + Intronic
1015061782 6:128975355-128975377 TGGGGTTGGGAGTAGGTGGATGG + Intronic
1015568839 6:134601370-134601392 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1015575175 6:134663726-134663748 TTGGGTTTCTAGAAGATGGTGGG - Intergenic
1015612908 6:135045044-135045066 TTGGATTTGCAAAGGGTGGGTGG + Intronic
1015947457 6:138517328-138517350 TAGGGTTTGCAGAAACTGGATGG + Intronic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016709828 6:147156826-147156848 TTGGGTTTGGTGAACGTGGATGG - Intergenic
1018691194 6:166345460-166345482 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1020508297 7:9020414-9020436 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1021809466 7:24389441-24389463 TTGTGTTGGGAGAAGGGGGAAGG - Intergenic
1022454352 7:30545553-30545575 TAGGGGTTGCAGAAGGATGAAGG - Intronic
1023024051 7:36035293-36035315 TGGGTTTTGGAGAAGGTGGTGGG - Intergenic
1023569808 7:41560295-41560317 TTGTGTTTCTAGAAGGGGGAGGG + Intergenic
1024566508 7:50685863-50685885 CTGGTTTTCCAGAATGTGGATGG + Intronic
1026235076 7:68520345-68520367 TTGGCTTTGCAGAAGTGGGAAGG + Intergenic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1028513140 7:91647074-91647096 TTGAATTTGTAGAAGGTTGAGGG + Intergenic
1030889896 7:114986533-114986555 TGGAGTTTGCAGATGGTGAAAGG - Intronic
1031984184 7:128152254-128152276 TTGGGGTTGAAGGAGGAGGAAGG - Intergenic
1032781563 7:135168635-135168657 TTGAGCTTTTAGAAGGTGGAGGG - Intronic
1033086317 7:138345267-138345289 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1033116788 7:138632574-138632596 TGGGGGATGGAGAAGGTGGAGGG + Intronic
1034509575 7:151522695-151522717 TTGACTTTGCAGCAGCTGGAAGG + Intergenic
1035683844 8:1508442-1508464 GGGGGTTTGCAGAGGGTGGCGGG - Intronic
1035710510 8:1709882-1709904 TTGTGTTTCCAGCAGGTGGGGGG + Intergenic
1036176572 8:6543869-6543891 TGGGCTTTGCAGAAGCTGAAAGG + Intronic
1037587932 8:20290804-20290826 TTGGCTTTGAAGCAGGAGGAAGG + Intronic
1038056999 8:23869009-23869031 TGGGCTTTTCAGAAGGTGGAGGG + Intergenic
1038322798 8:26543989-26544011 TTGGGTTGACAGAAGTAGGAAGG - Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040447563 8:47511224-47511246 TTCGGCTTGCAGACGGTGGGAGG - Intronic
1041574427 8:59377656-59377678 TTGGGTTGGGAGAGGGGGGAGGG + Intergenic
1043795322 8:84530422-84530444 TTGGGAGTGGAGAAGGTTGAGGG - Intronic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044661168 8:94592563-94592585 TTGGGTTTGGAGCAGGTCAAAGG - Intergenic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1045607923 8:103799001-103799023 TTGAGTTTGAAGATGGGGGAAGG + Intronic
1045911313 8:107413852-107413874 TTAGTCTTGCAGAAGGAGGATGG + Intronic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046852548 8:118991507-118991529 TTGAGTTTGCAAATGGTGGATGG + Intergenic
1047155474 8:122312873-122312895 TTTGGTTGGTAGAAGCTGGAAGG + Intergenic
1047375873 8:124295565-124295587 GTGAGTTCGCAGAAGCTGGAGGG - Intergenic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047509211 8:125503520-125503542 TTGGCTTTGAAGACGGAGGAAGG + Intergenic
1048281116 8:133106271-133106293 TGGGGTTTGCAGCAGGAGGCAGG + Intronic
1048631932 8:136252882-136252904 TTTGATTGGCAGAAGGTGAATGG + Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049314614 8:141956934-141956956 TGGGGTGTGGAGCAGGTGGAGGG + Intergenic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050505277 9:6341850-6341872 TAGGGTGGGCTGAAGGTGGAGGG + Intergenic
1050729786 9:8695934-8695956 TTTGGTTTGGAGCAGGTGGTTGG - Intronic
1050825262 9:9937075-9937097 TTGGGTTGGGGGAAGGGGGAGGG + Intronic
1052528786 9:29655743-29655765 TAGGGGTTGCAGAAGGATGAAGG + Intergenic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055717337 9:79132288-79132310 TTTCTTTTGCTGAAGGTGGAAGG - Intergenic
1055953938 9:81756572-81756594 GTGGGTTTGGTGAAGGTGGCAGG + Intergenic
1056019851 9:82430381-82430403 TTGGTGTGGGAGAAGGTGGAGGG + Intergenic
1056620173 9:88205999-88206021 TTGGCTTAGCAGAACCTGGAAGG + Intergenic
1056735022 9:89201994-89202016 TTGGGGTTGGAGAGGGTGGATGG - Intergenic
1057048845 9:91906735-91906757 TTTGGTTTGCAGTAGCTGGAGGG + Intronic
1057847846 9:98539181-98539203 TGAGGTTTGCAGAGGGTGGGAGG - Intronic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059139115 9:111835333-111835355 TTGGGTTAGATGAAGGTTGAGGG - Intergenic
1059603357 9:115805928-115805950 TGGGGATTCCAGAAGGGGGAAGG + Intergenic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1059752663 9:117262876-117262898 TTGGCTTTGCAGATGGAGGAAGG + Intronic
1060389294 9:123266137-123266159 ATGGGATTGCAGCAGGTGCAGGG - Intronic
1061362961 9:130155329-130155351 TGGGGTTGGCAGAAGGCAGAGGG - Intergenic
1061595975 9:131629274-131629296 TTGGGGTTACAGAAGGTCAAAGG + Intronic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186483403 X:9913547-9913569 TTGTGTGTGCAGAGGGTCGATGG + Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1186851921 X:13588962-13588984 TTGGGTTTCCAGGAGGTCAATGG + Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1189426688 X:40908112-40908134 TAGGGTTTGTAGAAGGTTCAAGG + Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1191694349 X:63974158-63974180 TGGGGGTTGCAGAATGAGGATGG + Intergenic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1193316951 X:80076010-80076032 TGGGGTTGGGAGAAGGGGGAGGG + Intergenic
1193328232 X:80207139-80207161 TTGGGTTTTCAGAAGGTCTCTGG + Intergenic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1193746925 X:85293506-85293528 TTGGCCTTTTAGAAGGTGGAAGG + Intronic
1195863944 X:109409470-109409492 TTGGCTTTGAAGATGGGGGAAGG + Intronic
1198344542 X:135746803-135746825 TAGGGGTTGCAGAAGGATGAAGG - Intergenic
1198886269 X:141342109-141342131 TTGGGATTACAGAAGTTGCATGG + Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199944450 X:152654000-152654022 TGGGGTTGGCAGAGGGTGGGGGG + Exonic
1202335425 Y:23804179-23804201 TTGACTTTGCATAAGGTGAAAGG - Intergenic
1202535342 Y:25865880-25865902 TTGACTTTGCATAAGGTGAAAGG + Intergenic