ID: 1112113225

View in Genome Browser
Species Human (GRCh38)
Location 13:96325646-96325668
Sequence GGATGGTTCCAGAACTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112113225_1112113229 -6 Left 1112113225 13:96325646-96325668 CCTTGGGAGTTCTGGAACCATCC 0: 1
1: 0
2: 1
3: 19
4: 200
Right 1112113229 13:96325663-96325685 CCATCCCTCATGGGTACTGAAGG 0: 1
1: 0
2: 12
3: 86
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112113225 Original CRISPR GGATGGTTCCAGAACTCCCA AGG (reversed) Intronic
900800324 1:4733172-4733194 GGAAGGTAGCAGAACCCCCAGGG + Intronic
904479779 1:30786647-30786669 GGATGGTCCCACAAATCCCTGGG + Intergenic
904971041 1:34419711-34419733 AGATGGGTCCAGAATTCCCTGGG - Intergenic
905040230 1:34950076-34950098 GGCTGGTTCCAGAACCCTCTTGG - Intergenic
906286828 1:44593007-44593029 GGATGGGCCCAGAGCTGCCATGG + Intronic
908219680 1:61992419-61992441 GGTTGGTTAAAGAAGTCCCATGG - Intronic
908398997 1:63752715-63752737 GTATCTTCCCAGAACTCCCAGGG - Intergenic
909901421 1:81141288-81141310 GAATGGTTCCCCAACTTCCATGG - Intergenic
912449864 1:109762030-109762052 GGAAGGCTCCAGGCCTCCCATGG + Intronic
913033877 1:114941050-114941072 GATTGGTTCCAGAACCCCCCAGG + Intronic
915022486 1:152794548-152794570 GGATGGTGTCAGACCTCTCAGGG + Intronic
915937659 1:160098657-160098679 GAATGGTTTCAGAACTGCCGAGG - Exonic
917856510 1:179105271-179105293 GCTTAGTTCCAGAACTCTCAAGG + Exonic
918376262 1:183912220-183912242 GGAGGGCTCCATTACTCCCATGG + Exonic
918416302 1:184311518-184311540 GGATGATGCCAGCACTCCCTTGG + Intergenic
919482282 1:198105318-198105340 TGATGGTCCCAGAATACCCAAGG - Intergenic
919484744 1:198132524-198132546 GTATGTTTCCAGAACTGCAACGG - Intergenic
920113917 1:203606462-203606484 TCAGGGTTCCAGAATTCCCAGGG - Intergenic
921698383 1:218238734-218238756 GATTGGTTCCAGGACCCCCATGG + Intergenic
921993927 1:221396784-221396806 GGATGATACCAGCACTCCCTTGG - Intergenic
922534527 1:226370103-226370125 GATTGGTTCCAGGACTCCCTCGG - Intronic
923706974 1:236351952-236351974 GGATGTTCCCAGAACTGTCATGG + Intronic
1062922026 10:1287561-1287583 GCATGGCTGCAGAACTCTCACGG - Intronic
1065138372 10:22695642-22695664 GATTGGTTCCAGGACTCCCCAGG + Intronic
1065474002 10:26114175-26114197 GGATGGTGCCAGATCTGCCAGGG + Intronic
1065541544 10:26774032-26774054 GCTTGGTTCCAGGACCCCCATGG + Intronic
1067147220 10:43702487-43702509 GGCGGCTTTCAGAACTCCCAGGG + Intergenic
1067183618 10:44008773-44008795 GGGTGGGTACAGAACTCCCAGGG - Intergenic
1069286802 10:66724934-66724956 GACTGGTTCCAGGACCCCCATGG + Intronic
1069997400 10:72351136-72351158 GGAAGGTGCCAGATTTCCCAGGG - Intronic
1073421023 10:103423771-103423793 GGATGGATCCAGGACACCCCCGG + Intronic
1073678776 10:105679483-105679505 GGGTGATTCCAGCACTCCCTTGG - Intergenic
1075507885 10:123041852-123041874 GAGTGGTTCCAGGACCCCCATGG - Intronic
1077195921 11:1279962-1279984 AGACTGTTCCGGAACTCCCAAGG + Intronic
1077325733 11:1963226-1963248 AGAAGATTCCAGAAATCCCATGG + Intronic
1078226856 11:9399974-9399996 GACTGGTTCCAGGACCCCCACGG + Intronic
1080137746 11:28876657-28876679 GATTGGTTCCAGGACTCCCTTGG - Intergenic
1080951942 11:37044085-37044107 GGCTGATTCCAGAACTTGCAAGG - Intergenic
1081616239 11:44593059-44593081 GGAGGGTTCATGACCTCCCAAGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1085080050 11:73626455-73626477 GGTGGGTTCCAGGACCCCCATGG + Intergenic
1088285844 11:108186699-108186721 GGCTGGTTTCAGGACCCCCAAGG + Intronic
1091035378 11:132228247-132228269 GGATGTTCACAGAATTCCCAGGG - Intronic
1202808713 11_KI270721v1_random:18405-18427 AGAAGATTCCAGAAATCCCATGG + Intergenic
1093717140 12:22396094-22396116 GGCTTCTTCCAGAAATCCCATGG - Intronic
1095825449 12:46525855-46525877 GAATGGTAGCAGAACTTCCATGG - Intergenic
1099421180 12:82462752-82462774 GATTGGTTCCAGGACTCCCATGG + Intronic
1103670582 12:122611695-122611717 GACTGGTTCCAGGACCCCCAAGG + Intronic
1103817688 12:123671652-123671674 GACTGGATCCAGACCTCCCAAGG + Intronic
1104024046 12:125013471-125013493 GCATGGTTCCAGAAATGGCAAGG - Intronic
1104777609 12:131400415-131400437 GGAAGGGACCAGAGCTCCCATGG - Intergenic
1106385584 13:29282321-29282343 GGATGGATCCACTACTCCCATGG + Intronic
1107067946 13:36236853-36236875 GATTGGTTCCAGGACCCCCATGG + Intronic
1110272165 13:73603172-73603194 GATTGGTTCCAGGACTCCCTTGG + Intergenic
1110849489 13:80228855-80228877 GGATTGTTCCAGGACACTCATGG + Intergenic
1112113225 13:96325646-96325668 GGATGGTTCCAGAACTCCCAAGG - Intronic
1112429659 13:99339699-99339721 GTATGGTTACAGAAGTCTCAAGG - Intronic
1114189265 14:20428666-20428688 TGGTGGTTCCAGAACTCCTAGGG - Intergenic
1116894821 14:50305763-50305785 GATTGGTTTCAGGACTCCCATGG + Intronic
1118084006 14:62394696-62394718 GATTGGTTCCAGAACTTCCCGGG + Intergenic
1119311429 14:73649799-73649821 GATTGGTTCCAGGACTCCCTAGG + Intronic
1119967709 14:78935399-78935421 GACTGGTTCCAGAACTTCAAAGG + Intronic
1123962447 15:25418882-25418904 GACTGGTTCCAGGACTCCCATGG + Intronic
1124913678 15:33947513-33947535 GGTTGGTTCCAGAACCCCTGAGG + Intronic
1128157724 15:65402302-65402324 GGCTGGTTCCAGAAACCCCCAGG + Intronic
1129823746 15:78620969-78620991 GGATGGTTCCTGTCCTCCCGCGG - Exonic
1130380441 15:83367661-83367683 GTATGGTTTCAGAGCTCCCCAGG - Intergenic
1130393522 15:83480876-83480898 GAATGGTTCCAGGACTCCCATGG - Intronic
1130766901 15:86879856-86879878 GGATGTTGCCAGAATACCCATGG + Intronic
1131550783 15:93354972-93354994 CGATGGTTCCAGCACTCCAGAGG - Intergenic
1131561800 15:93450201-93450223 GATTGGTTCCAGGACCCCCATGG + Intergenic
1132071825 15:98784902-98784924 GATTGGTTCCAGGACTCCCACGG - Intronic
1132119056 15:99160590-99160612 GATTGGTTCCAGAGCCCCCAAGG - Intronic
1133300319 16:4778445-4778467 GGGTGGTTCCAGGACCCCCAGGG - Intronic
1135143469 16:19941044-19941066 AGATTCTCCCAGAACTCCCACGG - Intergenic
1139204128 16:65009658-65009680 GGATTGTTCAAGAACTACCTTGG - Intronic
1140046485 16:71443164-71443186 GGATGGTCCCAGGACTCTGACGG - Intergenic
1142118436 16:88373477-88373499 GGGTGGGACCAGATCTCCCAAGG - Intergenic
1142857893 17:2742638-2742660 GGATGGGACAAGAACACCCAGGG - Intergenic
1144478768 17:15611969-15611991 GGCTGGTTCCAGAATGCCTAGGG - Intronic
1144592811 17:16539035-16539057 GATTGGTTCTAGGACTCCCATGG - Intergenic
1144919534 17:18751764-18751786 GGCTGGTTCCAGAATGCCTAGGG + Intronic
1146762456 17:35490261-35490283 GGATGGTTCAAAAACCCCCAAGG + Intronic
1149398129 17:56265643-56265665 GATTGGTTCCAGGACCCCCATGG + Intronic
1152379771 17:79936406-79936428 GGATGGTTTATGAAGTCCCAGGG - Exonic
1153123907 18:1766150-1766172 AGCTGGTTCCAGGACCCCCATGG - Intergenic
1153526277 18:5997917-5997939 GATTGGTTCCAGGACCCCCATGG - Intronic
1155373763 18:25134213-25134235 GGATGGTTCCAGAAGTCTTTAGG - Intronic
1155699696 18:28728435-28728457 AGAAGGCTCCAGAACTGCCAGGG - Intergenic
1163373831 19:16917886-16917908 GACTGGTTCCAGGACCCCCAAGG + Intronic
929596160 2:43177710-43177732 GATTGGTTCCAAGACTCCCATGG - Intergenic
929964516 2:46524257-46524279 GGATGGTTTGAGACCTTCCATGG + Intronic
931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG + Intergenic
932404539 2:71504531-71504553 GGGTAGTTCCAGAACTCCTTGGG - Intronic
934777677 2:96949550-96949572 GGGTGGTTCCTGAGGTCCCAGGG - Intronic
936045432 2:109184220-109184242 AGAAGCTCCCAGAACTCCCAAGG - Intronic
936792075 2:116162854-116162876 GGATGGTCCCAGAAGTGTCATGG + Intergenic
937846008 2:126579719-126579741 GAGTGGTTCCAGGACTCCCTTGG - Intergenic
939156735 2:138534476-138534498 GACTGATTCCAGGACTCCCATGG - Intronic
939614316 2:144345649-144345671 GATTGGTTCCAGGACCCCCAAGG + Intergenic
940509318 2:154592708-154592730 AGATGTTTCCAGAACTGTCATGG + Intergenic
940884155 2:158974323-158974345 GATTGGTTCCAGGATTCCCACGG + Intronic
941066096 2:160904488-160904510 GATTGGTTCCAGGACCCCCATGG + Intergenic
942201626 2:173577199-173577221 GGTTGTTTCCAGAACTCTGACGG - Intergenic
943507019 2:188773689-188773711 GATTGGTTCCGGAACCCCCATGG - Intronic
944036613 2:195302180-195302202 GGCTAGTGCCAGATCTCCCAGGG - Intergenic
944710601 2:202331882-202331904 GATTGGTTCCAGGACCCCCAAGG - Intergenic
945830815 2:214783054-214783076 GACTGGTTCGAGAACTCCCTTGG + Intronic
945846410 2:214950269-214950291 GATTGGTTCCAGGACCCCCAAGG - Intronic
946653659 2:221921195-221921217 GGATGATGTCAGAACTGCCAAGG - Intergenic
946829541 2:223713878-223713900 GATTGGTTCCAGGACCCCCAAGG + Intergenic
1169053903 20:2604169-2604191 AGAAGGTTCCAGAGTTCCCATGG + Intronic
1171093647 20:22310528-22310550 GGCTGGTTCCAGGACCCCCATGG + Intergenic
1171411315 20:24950398-24950420 GGATGGCTCCAGAGCACCCAAGG + Intronic
1172546801 20:35768140-35768162 GGAAAGTTCCCGAACTCCCCAGG - Intergenic
1173864773 20:46307078-46307100 GGCTGATTCCAGCACTCCCCAGG - Intronic
1174413957 20:50354868-50354890 GGATGGACCAAGAACTCCAATGG + Intergenic
1174549374 20:51350617-51350639 GATTGGTTCCAGGACTCCCATGG + Intergenic
1175516048 20:59570901-59570923 GGTTGATTACAGAACACCCAGGG - Intergenic
1179022609 21:37653990-37654012 GGCTGGTTCCAGAACTTTCTAGG - Intronic
1181150890 22:20882492-20882514 GGTGGGTTCCAGAGCTTCCATGG - Intronic
1181889235 22:26047048-26047070 GGGAGGTTACAGAACTCCAAAGG + Intergenic
1182093794 22:27613174-27613196 GGAATCTTCCAGATCTCCCAGGG - Intergenic
1182100514 22:27654537-27654559 GGCTGCTTGGAGAACTCCCAGGG - Intergenic
1183302254 22:37064113-37064135 GGGTGATTCCAGATCACCCAAGG + Intergenic
1183475970 22:38035921-38035943 GGCTGGTTCCTGGCCTCCCAGGG - Intronic
1185064085 22:48622015-48622037 GGATGGTTCAAGAAATACCTGGG - Intronic
950103977 3:10376869-10376891 GGGTTGCTCCAGAGCTCCCATGG + Intronic
950251415 3:11468730-11468752 GGATGCTTCCTGAATGCCCAGGG + Intronic
951293369 3:20901696-20901718 GGTTAGTTCCAGGACTTCCATGG + Intergenic
953793265 3:45964656-45964678 GGCAGGTACCAGAATTCCCAGGG + Intronic
956757057 3:72399065-72399087 GATTGGTTCCAGGACCCCCACGG + Intronic
956800125 3:72749875-72749897 GGTTGGTTCCAGGACTCCTGAGG + Exonic
957672481 3:83323803-83323825 AGATGGTGCAAGCACTCCCATGG + Intergenic
959677667 3:109054825-109054847 GGATGGTTCCATGACCTCCAAGG + Exonic
960298139 3:115968668-115968690 GGATGGTGCAAGAACTCCTTTGG + Intronic
961409578 3:126708940-126708962 CGTTGGTTCCAGGACCCCCATGG + Intronic
962151863 3:132902251-132902273 GGGTGGTGCCAGCACTCCCTTGG - Intergenic
962283924 3:134071268-134071290 GGATGCTTCCAGAAATTCCCGGG - Intronic
962638707 3:137360895-137360917 GGATGATGCAAGAACTTCCATGG + Intergenic
962920612 3:139947127-139947149 TGATGGTTCCAAACCTACCAAGG + Intronic
963286267 3:143437348-143437370 GGTTGCTTCCAGAACTGCCCTGG + Intronic
964037755 3:152218981-152219003 GACTGGTTCCAGGACCCCCACGG + Intergenic
965878349 3:173356284-173356306 GATTGGTTCCAGGACCCCCATGG + Intergenic
966820647 3:183921708-183921730 GGTTGGTTCCTTCACTCCCAAGG - Intronic
967518308 3:190398330-190398352 GGATTCTTCCAGAACTTTCAGGG - Intronic
967651039 3:191987276-191987298 TATTGGTTCCAGAACTGCCAAGG + Intergenic
968053367 3:195672131-195672153 GGTTGGGTCCAGGACCCCCACGG - Intergenic
968102445 3:195976231-195976253 GGTTGGGTCCAGGACCCCCACGG + Intergenic
968218578 3:196915655-196915677 GGGTGGTGCAAGCACTCCCATGG - Intronic
968706893 4:2083066-2083088 GGATGATTCCAGAGTTACCATGG - Intronic
975894186 4:79066854-79066876 GTATGGTTCCAGGACCCCCAAGG + Intergenic
976016347 4:80560000-80560022 GGATGTTGCCAGCACTCCCTTGG - Intronic
976284757 4:83360700-83360722 GACTGGTTCCAGGACCCCCATGG + Intergenic
976451944 4:85200100-85200122 GGGTGATTCCAGCACTCCCTTGG + Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
984330488 4:178309268-178309290 GCATGGTTCCAGGACCCCCTTGG - Intergenic
984484176 4:180345545-180345567 GTATGATTCCAGAACAGCCAAGG - Intergenic
984840218 4:184061118-184061140 GATTAGTTCCAGGACTCCCATGG + Intergenic
985499659 5:234785-234807 GGTTGGGTCCAGGACCCCCACGG - Intronic
985929763 5:3047571-3047593 GAATGGTGCCAGGACTCCCATGG - Intergenic
990592488 5:57280478-57280500 GATTGGTTCCAGGACCCCCACGG + Intergenic
992308562 5:75468896-75468918 GGAAGGATCCAGAACAACCAGGG + Intronic
994630036 5:102274177-102274199 GATTGGTTCCAGGACCCCCATGG - Intronic
995569264 5:113462180-113462202 GGATGGTTCCAGAAGGCCAGAGG - Intronic
996314495 5:122146733-122146755 TGATGGTTCCAGCATTACCAGGG + Intronic
996982745 5:129519447-129519469 GGGTGATGCCAGAACTCCCTTGG + Intronic
997156269 5:131562536-131562558 GATTGGTTCCAGAATCCCCAAGG + Intronic
997168044 5:131683185-131683207 GATTGGTTCCAGAATTCCCATGG + Intronic
1000039729 5:157476432-157476454 GATTGGTTCCAGGACCCCCATGG + Intronic
1001644468 5:173269836-173269858 TGATGGTCTCAGAGCTCCCAAGG - Intergenic
1003987306 6:11449679-11449701 GATTGGTTCCAGGACCCCCATGG + Intergenic
1004241818 6:13930314-13930336 GGCTGGCTCCAGGACCCCCAAGG - Intronic
1005134565 6:22553143-22553165 GATTGGTTCCAGAACCCCCGTGG - Intergenic
1005275438 6:24211930-24211952 GGAGGGGTCCCCAACTCCCAGGG + Intronic
1011749069 6:90437069-90437091 GATTGGTTCCAGAACTCCTGTGG - Intergenic
1011989261 6:93492231-93492253 GGTTAGTTCCAAAACCCCCATGG + Intergenic
1012091392 6:94902476-94902498 GGGTGATGCCAGAACTCCCTTGG - Intergenic
1012467179 6:99529177-99529199 GATTGGTTCCAGTACTCCCTTGG - Intergenic
1012714223 6:102648541-102648563 GGATGATTCCAGCACTCCATTGG - Intergenic
1014768206 6:125431706-125431728 GATTGGTTCCAGGACCCCCATGG + Intergenic
1018070386 6:160159652-160159674 GATTGGTTCCAGGACCCCCATGG - Intergenic
1018195503 6:161353234-161353256 GGATGGTTCCAGTCCTGCCCTGG - Intronic
1018285608 6:162234480-162234502 GGTTGGTTCCAGGATGCCCATGG + Intronic
1018914948 6:168127398-168127420 GCAGGGTTTCAGAACTCACAAGG + Intergenic
1020377728 7:7507053-7507075 GGATGGTTTAAAAACTCCCCAGG + Intronic
1020613202 7:10426793-10426815 GGATGATACCAGCACTCCCTTGG + Intergenic
1020844720 7:13268632-13268654 TGATGGATTCAGAACTTCCAAGG - Intergenic
1023574774 7:41615407-41615429 GGATGCCTCCAGAACTGCTAGGG + Intergenic
1025071729 7:55905471-55905493 CACTGGTTCCAGAACCCCCATGG - Intronic
1026703868 7:72672705-72672727 GATTGGTTCCAGGACCCCCATGG - Intronic
1031280851 7:119797626-119797648 GGGTGGTACCAGCACTCCCTTGG + Intergenic
1031587417 7:123549125-123549147 GATTGGTTCCAGGATTCCCATGG - Intronic
1033227332 7:139572363-139572385 GGATTTTTCCAGAACTCGAAAGG - Exonic
1034528499 7:151681128-151681150 GGATCATTCCAGTACTCACACGG - Intronic
1035138225 7:156729345-156729367 GACTGGTTTCAGAACCCCCATGG - Intronic
1036938720 8:13031141-13031163 GGTTGGTTCCAGGACGCCCTCGG - Intronic
1038752312 8:30306820-30306842 GATTGGTTCCAGGACCCCCATGG + Intergenic
1039320613 8:36426383-36426405 GGCTGTTTCCAGAACTCCATGGG + Intergenic
1039612510 8:38930891-38930913 GCCTGTTTCCAGAGCTCCCAAGG - Intronic
1041103568 8:54420083-54420105 GATTGGTTCCAGGACCCCCATGG - Intergenic
1041862444 8:62529930-62529952 GGATGGTGCCAGAACTGGTAGGG - Intronic
1042138262 8:65652936-65652958 GATTGGTTCCAGGAATCCCATGG - Intronic
1042574237 8:70200196-70200218 GATTGGTTCCAGGACCCCCATGG - Intronic
1043710261 8:83407696-83407718 GGTTGATTGCAGAACTTCCATGG - Intergenic
1044300760 8:90580498-90580520 GGGTGTTTCCAGAACTGTCATGG - Intergenic
1050783025 9:9363044-9363066 GCACAGTTCCAGAACTCTCAAGG - Intronic
1051288528 9:15521498-15521520 GGATTGTTCCAGAACCCCCGTGG - Intergenic
1053053239 9:34978311-34978333 GGATGCTGCCACAGCTCCCAGGG - Exonic
1056304651 9:85277973-85277995 GGTTGCTTTCAGAACTCACAGGG - Intergenic
1058680277 9:107434713-107434735 GGCTGACTCCAGCACTCCCAGGG + Intergenic
1060546043 9:124459852-124459874 GATTGGTTCCAGGACCCCCAAGG - Intronic
1061070830 9:128309593-128309615 GGATGGTCCTGGGACTCCCAGGG - Exonic
1061778225 9:132980278-132980300 AGATGGCTCCAGATCACCCAGGG + Intronic
1185609715 X:1387194-1387216 TGATGGTTCCTGACCTCCCACGG + Intronic
1186676287 X:11821034-11821056 GATTGGTTCCAGAACCCCCATGG - Intergenic
1188199724 X:27283495-27283517 GGATGGGTACAGAAATCTCAAGG - Intergenic
1194857940 X:98956892-98956914 GGGTGATGCCAGAACTCCCTTGG + Intergenic
1195196294 X:102500562-102500584 GGATGGTGTCTGAATTCCCATGG - Intergenic
1197216473 X:123871346-123871368 AGATGGTTCCAGAAATGCCATGG - Intronic
1200245868 X:154524983-154525005 GATTGGTTCCAGGACCCCCAGGG - Intergenic