ID: 1112114099

View in Genome Browser
Species Human (GRCh38)
Location 13:96334017-96334039
Sequence CCACAGTGTACCCACCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112114099_1112114103 2 Left 1112114099 13:96334017-96334039 CCTGTAGGGTGGGTACACTGTGG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1112114103 13:96334042-96334064 CAGAATATGAGAGCTCTATCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1112114099_1112114104 3 Left 1112114099 13:96334017-96334039 CCTGTAGGGTGGGTACACTGTGG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1112114104 13:96334043-96334065 AGAATATGAGAGCTCTATCAGGG 0: 1
1: 0
2: 0
3: 8
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112114099 Original CRISPR CCACAGTGTACCCACCCTAC AGG (reversed) Intronic
900792900 1:4691466-4691488 CCACTGTGTACCCAGCCCAAAGG - Intronic
901815464 1:11791098-11791120 CCACACTGGACCCAGCCTTCAGG - Intronic
912628762 1:111228497-111228519 CCAAAGTGTGGCCTCCCTACGGG - Intronic
913584755 1:120263319-120263341 CCACAGTGTCCCAAACATACTGG + Intergenic
913623428 1:120635040-120635062 CCACAGTGTCCCAAACATACTGG - Intergenic
914566753 1:148875175-148875197 CCACAGTGTCCCAAACATACTGG + Intronic
914606067 1:149255065-149255087 CCACAGTGTCCCAAACATACTGG - Intergenic
918434004 1:184492236-184492258 CCACAGAGTAACCATGCTACAGG + Intronic
919958165 1:202439280-202439302 CCTCACTGTACTCACCCTGCTGG - Intronic
923812335 1:237332967-237332989 CCACAGTGTACCCAGCTTCTAGG + Intronic
923839625 1:237654319-237654341 CCAAAGTTTCCCCACCCTCCAGG - Exonic
1066478649 10:35773592-35773614 CCACATAGTCCCCACTCTACAGG + Intergenic
1067480238 10:46590945-46590967 CAAAAGTGTACACACCCTGCTGG - Intronic
1067614499 10:47750855-47750877 CAAAAGTGTACACACCCTGCTGG + Intergenic
1071287037 10:84158580-84158602 CCACAAAGTACCAACCCTTCTGG - Intergenic
1071731842 10:88255972-88255994 CTCCAGTGTACCCATCCTAGAGG - Intergenic
1075207746 10:120461689-120461711 CCACTGTGTACTTTCCCTACTGG - Intronic
1077024189 11:432087-432109 CCACAGTGGACCCTGCCTCCAGG + Intronic
1077340989 11:2026242-2026264 CCACTGTGTACCCACCCCGGGGG + Intergenic
1077515082 11:2996488-2996510 CCACAGTGTATCCTCTTTACTGG - Intergenic
1081895297 11:46580760-46580782 CCACAATGTACCCACAGTAATGG + Intronic
1084422534 11:69067451-69067473 CCACTGGGTCCCCACCCCACAGG - Intronic
1088133099 11:106519817-106519839 CCACCGTGTGACCATCCTACGGG + Intergenic
1089854568 11:121531812-121531834 CCACACTTTACCTACCCTATAGG + Intronic
1090063225 11:123481511-123481533 CCACATTGTACCCAACCTATAGG - Intergenic
1202823974 11_KI270721v1_random:81431-81453 CCACTGTGTACCCACCCCGGGGG + Intergenic
1095982135 12:47979828-47979850 CCACAGTGCACCCAGCCCACAGG + Intronic
1096048651 12:48586657-48586679 GCACTGTGTACCCACCCCTCTGG - Intergenic
1097847413 12:64380942-64380964 CCACAATGTAACCACCCAACAGG + Intronic
1103721887 12:122979653-122979675 CCACAGTGTGCCCACACCACCGG + Exonic
1107325827 13:39241221-39241243 CCACAGTGCACCCACTCTCAAGG + Intergenic
1112114099 13:96334017-96334039 CCACAGTGTACCCACCCTACAGG - Intronic
1112929763 13:104719143-104719165 CCAAAATGTAACCACCCAACAGG - Intergenic
1115185125 14:30678731-30678753 CCCCAGTGTTCCCACCTTAGAGG + Intronic
1130399575 15:83537037-83537059 TCACAGTCTTCCCTCCCTACTGG + Intronic
1130553947 15:84909902-84909924 CCAGAGTCTCCCCACCCTGCTGG + Intronic
1131211661 15:90503040-90503062 CCACAGTTTACCAACACAACAGG - Intergenic
1132142331 15:99406141-99406163 CCACAGTGTGCCTTCCTTACAGG + Intergenic
1133353700 16:5120345-5120367 CCACAGTGTCCGCACCCAGCAGG - Intergenic
1134664010 16:16005201-16005223 CCACAGCCTTCCCATCCTACTGG - Intronic
1135106352 16:19653294-19653316 CAACAGGGTACCCACCCTGCAGG + Intronic
1136238642 16:28930868-28930890 CCCCAGGGGACCCTCCCTACAGG - Intronic
1136776438 16:32874257-32874279 GCACAGTGCTCCCACCCTGCAGG + Intergenic
1136894177 16:33987255-33987277 GCACAGTGCTCCCACCCTGCAGG - Intergenic
1141449287 16:84086586-84086608 CCACACTGTAGCCACTTTACAGG - Intronic
1141753075 16:85972384-85972406 TCATAGTGTAACCACCCAACAGG - Intergenic
1203078853 16_KI270728v1_random:1136366-1136388 GCACAGTGCTCCCACCCTGCAGG + Intergenic
1143027917 17:3951844-3951866 GCACAGGGTGCCCACCCCACAGG + Intronic
1144423842 17:15122659-15122681 CCTCAGTGTAGCCACCCTCTAGG + Intergenic
1148511861 17:48177839-48177861 CAACACTGTACCCAGCCAACAGG - Intronic
1150398967 17:64842109-64842131 CCCCATTGTTCCCACCCTTCTGG + Intergenic
1151200436 17:72463957-72463979 CCACAGTGTGGCCATCCTATCGG + Intergenic
1151853952 17:76708820-76708842 CCAGAGAGAACCCACCCCACAGG - Intronic
1152584967 17:81184913-81184935 CCACAGTGAGCCCACCGGACAGG + Intergenic
1154982837 18:21518084-21518106 CGACAGTGAACACACACTACTGG + Exonic
1156453460 18:37279700-37279722 CCACAGTGTGCCAGCCCTGCTGG - Intronic
1157982124 18:52393998-52394020 CCACACAGTACCCTACCTACTGG + Intronic
1165311717 19:35032522-35032544 CCACAGTGTCCTCAGCCTGCGGG + Exonic
926700484 2:15800106-15800128 CCACAGGGAACACAGCCTACAGG + Intergenic
928731812 2:34240347-34240369 CCATAGTTTACCCAGCCTTCTGG + Intergenic
933042721 2:77488435-77488457 CCACAGTCTGCTCACGCTACTGG - Intronic
934239551 2:90254184-90254206 CTACACTGGCCCCACCCTACTGG + Intergenic
938971574 2:136437857-136437879 GCACAGTGTTCCCTCACTACAGG + Intergenic
942047410 2:172107956-172107978 TGATATTGTACCCACCCTACAGG - Intergenic
944224620 2:197337627-197337649 ACACAGTGTTCCTCCCCTACAGG + Intergenic
946406330 2:219493817-219493839 CCACAGTCTCCCCTCCCTCCAGG - Intronic
1168752842 20:295835-295857 CCACAGTGGACCCTCACTTCTGG + Intergenic
1173551767 20:43937612-43937634 CCTCTGTGCACCCTCCCTACGGG - Intronic
1174659677 20:52200902-52200924 CCACAGTGGGCCCATCCTATAGG - Intronic
1175832249 20:61971786-61971808 CCACTGTGTGCCCACCCTCAGGG - Intronic
1178524630 21:33316672-33316694 CCAGGGTGCACCCACCCTAGGGG + Intergenic
1181261254 22:21599473-21599495 CCACAGAGAAGCCACCCTCCTGG + Intronic
1183832745 22:40427340-40427362 CTGCATTGTAGCCACCCTACTGG - Intronic
1185297996 22:50063736-50063758 CCCCAGTGCCCCCACCCCACAGG + Intronic
951813020 3:26722284-26722306 CCACAGGGCACCCAACGTACTGG - Intergenic
952475502 3:33705778-33705800 CCATGGTGTATCCACACTACAGG + Intronic
952482091 3:33771974-33771996 CCACAGTGTGCCCAGCATCCTGG + Intergenic
954808542 3:53234106-53234128 CCACAGGGTCCTCACCCCACAGG - Intronic
961494105 3:127278416-127278438 CCACACTCTACCCACTCTGCAGG + Intergenic
963299655 3:143584350-143584372 CCACAGCCTACTCACCCTCCTGG + Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
968016631 3:195340771-195340793 CTGTAGTGTACCCACACTACAGG - Intronic
972479129 4:39481132-39481154 CCACGATGTATCCACCCTTCGGG - Intergenic
983947150 4:173599060-173599082 CAACAGTGTGACCACCCAACAGG + Intergenic
998376936 5:141697316-141697338 CCAAAGTGTCCCCACCATCCTGG + Intergenic
999058199 5:148604915-148604937 CCACTGTGTTCCTACCCCACTGG - Intronic
999692008 5:154156276-154156298 CCACTGTGTACCCACCAGAATGG + Intronic
1003155395 6:3589460-3589482 CCACAGTGGATCCACACTCCAGG + Intergenic
1005381137 6:25235588-25235610 CCACAGTGGGCCCCCCCAACAGG + Intergenic
1008187337 6:48410345-48410367 CCATATTATACCAACCCTACAGG - Intergenic
1018275794 6:162129865-162129887 CCTCAGTGTAAACACTCTACAGG - Intronic
1018788714 6:167129764-167129786 CCATAGTGTGCCCGCCCTACAGG + Intronic
1025079775 7:55971424-55971446 CCTCATTGTACCCACCCAAAGGG + Intronic
1026814817 7:73502407-73502429 CACCTGTGTACCCACCATACAGG + Intronic
1033323481 7:140360949-140360971 CCACTGCATACCCACCCTAAGGG + Intronic
1034743907 7:153504500-153504522 CCACTGTGCAGCCACCCTCCCGG - Intergenic
1040020084 8:42733496-42733518 GCACAGTGTACCCAGCACACAGG + Intronic
1045846683 8:106645261-106645283 CCAATTTGTACCTACCCTACTGG - Intronic
1049300735 8:141868050-141868072 CCCCTGTGTGCCCACCCTAGAGG - Intergenic
1049683738 8:143930989-143931011 CCACTGTGCACCCGCCCTCCTGG + Intronic
1049831657 8:144704836-144704858 CCACAGTGGACCCAAACTCCGGG + Intergenic
1056442870 9:86637866-86637888 TCCCAGTGTACCCACTCCACAGG - Intergenic
1060727713 9:126017020-126017042 CCCCAGGGACCCCACCCTACTGG + Intergenic
1061794566 9:133078321-133078343 CCCCATTGTACACACACTACAGG - Intronic
1185946147 X:4378929-4378951 CCCCAATGTAACCACCCAACAGG + Intergenic
1186915514 X:14215309-14215331 CCCCAGTGATCCCAACCTACTGG - Intergenic
1194245020 X:91500237-91500259 CCAAAGTGTTCCCAGGCTACAGG - Intergenic
1196940892 X:120774779-120774801 CCACACTGTACCCAGACTTCTGG - Intergenic
1200563995 Y:4741547-4741569 CCAAAGTGTTCCCAGGCTACAGG - Intergenic
1201733310 Y:17229548-17229570 CCCCAATGTAACCACCCAACGGG + Intergenic