ID: 1112114386

View in Genome Browser
Species Human (GRCh38)
Location 13:96336404-96336426
Sequence CATTCTGCACCACTGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112114386_1112114392 -3 Left 1112114386 13:96336404-96336426 CCAACCCCCAGTGGTGCAGAATG 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1112114392 13:96336424-96336446 ATGTGACTGTACTTGGATATTGG 0: 2
1: 20
2: 323
3: 1156
4: 2710
1112114386_1112114391 -10 Left 1112114386 13:96336404-96336426 CCAACCCCCAGTGGTGCAGAATG 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1112114391 13:96336417-96336439 GTGCAGAATGTGACTGTACTTGG 0: 1
1: 1
2: 11
3: 114
4: 695
1112114386_1112114395 29 Left 1112114386 13:96336404-96336426 CCAACCCCCAGTGGTGCAGAATG 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1112114395 13:96336456-96336478 GAGGTAATTAAGTTAAGATGAGG 0: 4
1: 145
2: 782
3: 1764
4: 2957
1112114386_1112114394 10 Left 1112114386 13:96336404-96336426 CCAACCCCCAGTGGTGCAGAATG 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1112114394 13:96336437-96336459 TGGATATTGGGTCTTTATAGAGG 0: 1
1: 1
2: 39
3: 287
4: 899
1112114386_1112114393 -2 Left 1112114386 13:96336404-96336426 CCAACCCCCAGTGGTGCAGAATG 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1112114393 13:96336425-96336447 TGTGACTGTACTTGGATATTGGG 0: 1
1: 3
2: 47
3: 415
4: 1564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112114386 Original CRISPR CATTCTGCACCACTGGGGGT TGG (reversed) Intronic
900291929 1:1927335-1927357 CATTCTGCACCCGGGGGGCTGGG + Intronic
900415505 1:2532722-2532744 CATCCTGGCCCACTGCGGGTGGG - Intergenic
901624471 1:10616169-10616191 CATTCAGCAGCCCTGGGGGAGGG + Intronic
906276930 1:44523620-44523642 CCTTCTGCACCACTTGGTCTTGG - Intronic
907297046 1:53461835-53461857 CAGTCTGCACCACTCGGCTTGGG + Intronic
907583332 1:55591820-55591842 CATTCTGAAGTACTGGGGGTTGG + Intergenic
909473490 1:76056150-76056172 CCTTCTGCTCCACTCGGGGCTGG - Intergenic
910460472 1:87443623-87443645 CATTCTGAGGCACTGGGGGTTGG - Intergenic
913014873 1:114722640-114722662 CATTCTTCAGCACTGGCTGTGGG - Intronic
914317696 1:146529908-146529930 CATTCTGAGGCACTGGGGGCTGG - Intergenic
914496661 1:148203452-148203474 CATTCTGAGGCACTGGGGGCTGG + Intergenic
919551706 1:198998001-198998023 CATTTTGCACTACTGAAGGTTGG + Intergenic
920911083 1:210217444-210217466 CATTCTGAGACACTAGGGGTTGG - Intergenic
922163657 1:223097124-223097146 CATTCTGAGGCACTAGGGGTAGG + Intergenic
924757072 1:246951240-246951262 CATTCTGAGATACTGGGGGTAGG - Intronic
1064676676 10:17767090-17767112 CATTCTGAAGTACTGGGGTTTGG + Intronic
1064803889 10:19109189-19109211 CAAGCTTCCCCACTGGGGGTGGG + Intronic
1066454371 10:35560322-35560344 CATTCTCAAACACTAGGGGTTGG - Intronic
1067550267 10:47229442-47229464 CAGTCAGGACCAGTGGGGGTGGG + Intergenic
1068957093 10:62827989-62828011 CAGTCTGTAGCCCTGGGGGTTGG - Intronic
1069030506 10:63590663-63590685 AATTGTGCACCACTGGGAATGGG + Intronic
1069910779 10:71757824-71757846 CATTCTGCTGCGCTGGGGGGTGG + Intronic
1072057307 10:91772734-91772756 CATTCTGAAGTACTGGGGTTAGG + Intergenic
1073452326 10:103617303-103617325 CATACTTCTCCTCTGGGGGTGGG + Exonic
1075054914 10:119210084-119210106 AATTCTGCCCCAATGGGAGTCGG - Intronic
1075310803 10:121412115-121412137 CCTTCTTCTCCACTGGGGTTAGG - Intergenic
1075825708 10:125355813-125355835 CAGTCTGCAGCTCTGGGGCTGGG - Intergenic
1076170310 10:128313675-128313697 CTTTCTGCACAACTTGGGGCTGG - Intergenic
1076507773 10:130989230-130989252 CCTTCTGCACCTCTGGTGCTGGG - Intergenic
1077053708 11:579646-579668 CAGTCTGCACCCCTGGTGCTTGG - Intronic
1078273987 11:9825103-9825125 TATTCTGAGGCACTGGGGGTTGG - Intronic
1083275498 11:61594858-61594880 CTTTCTGCCCCACTCGGGCTGGG + Intergenic
1083279833 11:61620089-61620111 CATTCTGCAGCCCGGGAGGTTGG - Intergenic
1083750053 11:64755856-64755878 CACTCTGCAGCAATGGGGGCTGG + Intronic
1083938820 11:65884282-65884304 CATTCTGCTACCCTGGGGGTGGG - Intronic
1084288216 11:68145581-68145603 CTGGCTGCCCCACTGGGGGTGGG + Intergenic
1084662340 11:70553438-70553460 CATTCTGAAGTACTGGGGATTGG + Intronic
1085325056 11:75600216-75600238 CATTCTGCTCCTCTGAGGGGGGG + Intronic
1087010405 11:93508822-93508844 CACACTCCACCACTGGAGGTGGG + Intronic
1087730456 11:101772741-101772763 CATTCTGAGGTACTGGGGGTGGG - Intronic
1088704339 11:112448099-112448121 CAGCCTGCACCCTTGGGGGTGGG - Intergenic
1089327374 11:117666600-117666622 TGTTCTGCAGAACTGGGGGTGGG - Intronic
1093412131 12:18879517-18879539 CACTCTGGAGTACTGGGGGTAGG + Intergenic
1096212914 12:49780112-49780134 CATTCTGAGATACTGGGGGTAGG + Intergenic
1101539431 12:105651719-105651741 TATTCTGAAGTACTGGGGGTAGG + Intergenic
1102463977 12:113117254-113117276 CATTCTGCCCCTCTGTGGGTGGG - Intronic
1103184279 12:118942927-118942949 ACTGCTGGACCACTGGGGGTGGG + Intergenic
1107959147 13:45543349-45543371 CATTCACCAGCACTGGGGTTAGG - Intronic
1108615893 13:52131673-52131695 TAATCTCCACCTCTGGGGGTGGG - Intergenic
1109507259 13:63319946-63319968 CATTCTGAAGTACTGGGTGTAGG + Intergenic
1110419671 13:75291633-75291655 CATTCTGGACAACTAGGGTTTGG + Intronic
1112114386 13:96336404-96336426 CATTCTGCACCACTGGGGGTTGG - Intronic
1112333163 13:98492538-98492560 CATCCTGCCCACCTGGGGGTGGG - Intronic
1113642858 13:111970717-111970739 CCTTCTGCACCACGGGGCCTGGG + Intergenic
1116731960 14:48634546-48634568 CATTTTACATGACTGGGGGTGGG - Intergenic
1119144745 14:72301912-72301934 CATTTTGAAGCACTGGGGGTGGG + Intronic
1119596464 14:75939181-75939203 CATTCTGCTGCACTGGGGTGGGG - Intronic
1119940604 14:78637130-78637152 CATTCTTGAGCACTGGGGATGGG - Intronic
1121239865 14:92421386-92421408 AAATCAGAACCACTGGGGGTAGG - Intronic
1121798517 14:96754908-96754930 CCATCTGCCCCACAGGGGGTTGG + Intergenic
1121883721 14:97523689-97523711 CATTCTGAAGTACTGGGGTTAGG + Intergenic
1122432970 14:101667612-101667634 CATTCTGAGGCACTGGGGGTTGG + Intergenic
1125676964 15:41507279-41507301 TCTTCTGCTTCACTGGGGGTGGG + Exonic
1127907838 15:63389831-63389853 CATTCATCTCCACTGGGTGTAGG + Intergenic
1130400480 15:83547427-83547449 CATGCTGCACTGCTGGGGGATGG + Intronic
1132657113 16:1045988-1046010 CACTCTGCACCACTCGGGGTGGG + Intergenic
1132957324 16:2601820-2601842 CAATCTGCAACACTGTGGGCAGG - Exonic
1132969663 16:2680236-2680258 CAATCTGCAACACTGTGGGCAGG - Intergenic
1133987422 16:10679104-10679126 CACTCAGCAACCCTGGGGGTTGG - Intronic
1134537070 16:15034656-15034678 CGTTCTTCATCACTGGGTGTGGG + Intronic
1136661603 16:31767898-31767920 TCTTCTACACCACAGGGGGTAGG + Intronic
1137513625 16:49123414-49123436 CAATCTGCAGTACTGAGGGTAGG + Intergenic
1137752409 16:50876583-50876605 TATTCTGCAGCACTGGGGACAGG + Intergenic
1138452024 16:57098756-57098778 CATTCTGTGCCTCTGGGTGTTGG + Intronic
1139661015 16:68420952-68420974 CATTCTCCATCCCTGGGGTTTGG + Intronic
1141231583 16:82172053-82172075 CATTCTGAGGCACTGGGAGTTGG - Intergenic
1141428279 16:83957425-83957447 CATTCTGCATGACTGGGGAGGGG + Intronic
1141855622 16:86679496-86679518 CATTCTGCTGCTCTGGGGGTAGG + Intergenic
1141908179 16:87041356-87041378 CCGGCTGCATCACTGGGGGTGGG - Intergenic
1142246887 16:88974312-88974334 CCTTCTGCACCACTGGGCCCAGG + Intronic
1143527061 17:7479116-7479138 CAATCTGCCCCACGGGGGGAGGG + Intronic
1145010390 17:19364569-19364591 CACTCTGCAGCTCTTGGGGTGGG + Intronic
1145095430 17:20021457-20021479 CATTCAGCATTACTGGGAGTGGG - Intronic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1148443838 17:47725928-47725950 GATTCAGCACCACTAGGGGCAGG - Intergenic
1150650769 17:67008627-67008649 CATTCTGAAGTACTGGGGTTAGG - Intronic
1151195711 17:72430020-72430042 CAATCAGAACCTCTGGGGGTGGG - Intergenic
1152857680 17:82675473-82675495 CATACTTCAGAACTGGGGGTGGG + Intronic
1153416987 18:4856742-4856764 CATTCTTCAGGACTGAGGGTTGG + Intergenic
1153655755 18:7280721-7280743 CATTCTGAAATACTGGGGTTAGG + Intergenic
1154194188 18:12254069-12254091 CGTTTTGCACTTCTGGGGGTCGG - Intergenic
1156728243 18:40157155-40157177 CATTATGAACCACAGGGGCTGGG + Intergenic
1157217710 18:45799649-45799671 CAGGCTGCACCTCTGGGGGCAGG - Intergenic
1158249160 18:55467429-55467451 CAGTCTGAAACTCTGGGGGTGGG + Intronic
1158541502 18:58359790-58359812 GAATCAGCACCTCTGGGGGTGGG + Intronic
1158839416 18:61368047-61368069 CACTCTGAAGTACTGGGGGTTGG + Intronic
1160060559 18:75525562-75525584 CATTCTGAAATACTGAGGGTTGG + Intergenic
1160834742 19:1119396-1119418 CATTCAGCACCTCTGGGTGCTGG + Intronic
1160888429 19:1363529-1363551 CACGCTGCCCCACTGGGGTTGGG + Intronic
1161403148 19:4077810-4077832 GATTCTGCACAACTGGGGGCTGG - Intergenic
1161536576 19:4822923-4822945 CATTCTGAGCTACTGGAGGTTGG - Intronic
1161955095 19:7489239-7489261 CATTCTGCCCCACGGCGGTTTGG + Intronic
1163772099 19:19197453-19197475 CATTTGGCAGCACTGGGGATAGG + Intronic
1164929816 19:32166753-32166775 AAATCTGCATCACTGTGGGTTGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165281443 19:34801687-34801709 CATACAGCACCACTGAGTGTGGG - Intergenic
1165408703 19:35645264-35645286 CATTGCGCAGCACTGGAGGTGGG - Intergenic
925432272 2:3805312-3805334 CTTTCTCCACCACCAGGGGTCGG - Intronic
925898905 2:8494622-8494644 CATTCTGAGGCCCTGGGGGTTGG + Intergenic
927910758 2:26897805-26897827 AAATCTGCATCTCTGGGGGTGGG + Intronic
929632410 2:43477568-43477590 CATTCTGTACCACTGGCTGGTGG - Intronic
932600947 2:73125102-73125124 CATTCTGGGACACTGGGGTTAGG + Intronic
934528443 2:95068275-95068297 CATTCTGCAGCTCTGGGGATTGG + Intergenic
935243339 2:101196831-101196853 CATGCTGAACCATTGGGGTTTGG - Intronic
938105083 2:128524589-128524611 CATTCGGAAGCACTGGGGTTAGG - Intergenic
939720850 2:145649153-145649175 CATTCTGTACCACAGGGACTAGG - Intergenic
940052830 2:149482046-149482068 CAATTTGCATCTCTGGGGGTAGG - Intergenic
940157620 2:150675951-150675973 CATTCTGAGATACTGGGGGTTGG - Intergenic
942412998 2:175731207-175731229 CATTCTGAGTTACTGGGGGTTGG - Intergenic
943640669 2:190354405-190354427 CATTCTGAGGTACTGGGGGTTGG - Intronic
945098222 2:206239596-206239618 TCTTCTGCTCCACTGGGAGTAGG - Intergenic
946013127 2:216582616-216582638 CATTCTGAGGCACTGGGGGTTGG + Intergenic
947812231 2:233011791-233011813 CTTTCTGCCCCAGTGGGGCTGGG - Intronic
1169029550 20:2396940-2396962 CAGTCGGCAGCTCTGGGGGTGGG - Intronic
1169067105 20:2700247-2700269 GATTCGGAAACACTGGGGGTTGG - Intronic
1170472303 20:16680408-16680430 CATTCTAAAGTACTGGGGGTTGG - Intergenic
1175810377 20:61854460-61854482 CACACTGCAGCCCTGGGGGTGGG - Intronic
1175810402 20:61854552-61854574 CACACTGCAGCCCTGGGGGTGGG - Intronic
1175810437 20:61854690-61854712 CACACTGCAGCCCTGGGGGTGGG - Intronic
1175810495 20:61854919-61854941 CACACTGCACCCCTGGGGGTGGG - Intronic
1175810508 20:61854965-61854987 CACACTGCACCCCTGGGGGTGGG - Intronic
1175810521 20:61855011-61855033 CACACTGCAGCCCTGGGGGTGGG - Intronic
1175810534 20:61855057-61855079 CACACTGCAGCCCTGGGGGTGGG - Intronic
1175810547 20:61855103-61855125 CACACTGCACCCCTGGGGGTGGG - Intronic
1175810560 20:61855149-61855171 CACACTGCAGCCCTGGGGGTGGG - Intronic
1175810573 20:61855195-61855217 CACACTGCAGCCCTGGGGGTGGG - Intronic
1176429395 21:6566815-6566837 CATTCTGAGCCTTTGGGGGTAGG - Intergenic
1177116233 21:17090385-17090407 CATTCTGAGGTACTGGGGGTTGG + Intergenic
1179704789 21:43174277-43174299 CATTCTGAGCCTTTGGGGGTAGG - Intergenic
1179808304 21:43854119-43854141 CCTTCTGCAGTGCTGGGGGTTGG - Intergenic
1179881827 21:44296242-44296264 CACCCAGCTCCACTGGGGGTGGG - Intronic
1179946183 21:44678389-44678411 CATTCTGGAGCAGTGTGGGTGGG - Intronic
1180951566 22:19722842-19722864 CGTTCTGCAGCACTGGGGCAGGG - Exonic
1181535436 22:23540235-23540257 CATTCTGCATCACTGATTGTTGG - Intergenic
1183624878 22:38995827-38995849 AACTGTGCTCCACTGGGGGTTGG - Intergenic
951145240 3:19218983-19219005 CATTCTGCAGTACTAGGGGTTGG + Intronic
951579147 3:24143695-24143717 CATCCAGCACCACTGGGAGGGGG + Exonic
951944178 3:28115428-28115450 CAGTCTGCAGCCCTGGGGTTGGG - Intergenic
951969212 3:28424363-28424385 CATTCTGAGGCACTGAGGGTTGG - Intronic
952147495 3:30549034-30549056 AATTCTGCACCAATAAGGGTGGG + Intergenic
952323710 3:32301507-32301529 CTTTCTGCACCACTGGCAGGAGG - Intronic
953334703 3:42084556-42084578 CCTTGGGCCCCACTGGGGGTGGG + Intronic
956961547 3:74408127-74408149 AATTCTGCTCCACTGTGGGACGG + Intronic
958179266 3:90037095-90037117 CATTCTGAAGCACTGGGGTTAGG - Intergenic
958552314 3:95632113-95632135 CATTCTGATTTACTGGGGGTTGG - Intergenic
959070116 3:101694222-101694244 CATTCTGCATCACTGATTGTTGG - Intergenic
960139655 3:114139792-114139814 CTTTCTGCTGCACAGGGGGTGGG + Intronic
961262222 3:125611286-125611308 CATTCTAAAGTACTGGGGGTGGG + Intergenic
962279187 3:134037442-134037464 CCTTCTCCAGAACTGGGGGTGGG - Intronic
962529094 3:136262189-136262211 CTTTCTGTGTCACTGGGGGTGGG + Intronic
962910717 3:139847155-139847177 TATTCTGAAGTACTGGGGGTTGG - Intergenic
963370618 3:144395108-144395130 CATTCTGAGGTACTGGGGGTTGG + Intergenic
964417703 3:156465519-156465541 AATTCTACACCACTGGAGGGAGG - Intronic
964857827 3:161166121-161166143 CATTGTGCCTCACTGGGAGTTGG + Intronic
967978384 3:195048297-195048319 CAGCCTGCAGCACTGGGGCTGGG + Intergenic
968937993 4:3623671-3623693 CCTTCTGCCCCAGTGAGGGTGGG + Intergenic
970053156 4:11939229-11939251 CATTCTGTGATACTGGGGGTTGG - Intergenic
971841128 4:31853692-31853714 CATTCTGAAATACTAGGGGTAGG - Intergenic
972923113 4:43968183-43968205 CAGTCTGCGGCCCTGGGGGTTGG - Intergenic
975114199 4:70660677-70660699 AATTCAGCACTACTGGGGCTGGG - Intronic
975839658 4:78459971-78459993 CATTCTGAAATACTGGGGCTTGG + Intronic
976885706 4:89981081-89981103 CATTCTGAGATACTGGGGGTTGG - Intergenic
977363509 4:96036797-96036819 CATTCCTCACCAATGTGGGTGGG + Intergenic
980575099 4:134677193-134677215 AATTGTGCATCACTGGGGTTTGG + Intergenic
980876480 4:138667114-138667136 CATTCCGCGTTACTGGGGGTTGG + Intergenic
981220008 4:142220985-142221007 CATTCTGTAGTACTGGGGCTAGG + Intronic
983081866 4:163395992-163396014 CATTCTCCAACACTGGAGGCCGG - Intergenic
984058690 4:174964122-174964144 CATTCTCAAGTACTGGGGGTTGG - Intronic
984946731 4:184974579-184974601 CATTCTGAAGTACCGGGGGTTGG + Intergenic
986576567 5:9219441-9219463 CATTCTGGAGTACTGGGGGCTGG - Intronic
987313438 5:16701972-16701994 CATTCTGCAGTATTGGGGTTAGG - Intronic
987516894 5:18921440-18921462 CATTCACCAGTACTGGGGGTTGG + Intergenic
987785306 5:22491708-22491730 CATCCTGGACCACTGGCTGTGGG + Intronic
988843390 5:35104775-35104797 GATACTCCACCACTGGGGGCAGG + Intronic
990491258 5:56305098-56305120 CATTCTGAGGCCCTGGGGGTGGG + Intergenic
990842166 5:60094476-60094498 CATTCTAAAGTACTGGGGGTGGG - Intronic
994865035 5:105257569-105257591 CATTTTGCACCAGTGTAGGTAGG - Intergenic
995443535 5:112218038-112218060 CACTCTGTAGCACTGGGGGAAGG - Intronic
998562557 5:143184844-143184866 CAAATTGCCCCACTGGGGGTGGG + Intronic
1000669692 5:164045656-164045678 CATTCTGCACATCTTGTGGTTGG + Intergenic
1001589138 5:172853548-172853570 CAGTCTGCGCAACTGGGGCTGGG + Intronic
1001617946 5:173057206-173057228 ACTTCTGCACCAATGGGCGTGGG + Intronic
1001697902 5:173685982-173686004 CATTCTGAGACACTAGGGGTTGG - Intergenic
1001799301 5:174529528-174529550 CATTCAGTAAGACTGGGGGTGGG - Intergenic
1002410376 5:179070012-179070034 CGGTCTGCAAAACTGGGGGTTGG - Intronic
1003307483 6:4942849-4942871 CATCCTGCTCCACTGAGGGCTGG - Intronic
1003466007 6:6380732-6380754 CATTCTGAGGTACTGGGGGTTGG - Intergenic
1005883403 6:30076267-30076289 CATTCTGCAGCTCTGGGGTAAGG + Intergenic
1006768610 6:36531673-36531695 CATTCTGCAGCACTGTGTGATGG + Intronic
1007503447 6:42316034-42316056 TTCTCTGCTCCACTGGGGGTGGG + Intronic
1016631117 6:146232788-146232810 CATTCTGATGTACTGGGGGTTGG + Intronic
1016787778 6:148031742-148031764 CATTCTGAGGCACTGGGGGTAGG + Intergenic
1018063956 6:160112724-160112746 CATTCTGAAGTACTGGGGTTAGG - Intronic
1018900036 6:168046449-168046471 CATTCTGCCTCACTGCGAGTGGG + Intergenic
1021214678 7:17901264-17901286 CAAGCTGCACTACTTGGGGTGGG + Intronic
1023830596 7:44036887-44036909 CCTTCTGCAGCACCAGGGGTAGG + Intergenic
1023899814 7:44467061-44467083 CCTTCTTCACCACGGGGGGCTGG - Intronic
1024831561 7:53465409-53465431 CATTCTGAAGTACTAGGGGTAGG - Intergenic
1025077289 7:55953977-55953999 CAGTCTGCTGCCCTGGGGGTTGG + Intronic
1026365036 7:69639702-69639724 CATTCTGTGCCTCTGAGGGTGGG + Intronic
1029101084 7:98130526-98130548 CATTCTGAGGCACTGGGGTTAGG - Intronic
1029740926 7:102491201-102491223 CCTTCTGCAGCACCAGGGGTAGG + Intronic
1029758920 7:102590374-102590396 CCTTCTGCAGCACCAGGGGTAGG + Intronic
1029991071 7:104962965-104962987 GAATCAGCACCTCTGGGGGTTGG - Intergenic
1030935586 7:115581876-115581898 CATTGTGCACTGTTGGGGGTGGG - Intergenic
1031865916 7:127039174-127039196 CATTCTGAGCTACTGGAGGTTGG - Intronic
1033041289 7:137920833-137920855 CATTCTGAACTACTGGAGGTTGG + Intronic
1033518360 7:142132140-142132162 CATTCTGATTTACTGGGGGTGGG + Intronic
1033956260 7:146852106-146852128 CATTCTGAGACATTGGGGGTTGG + Intronic
1034169058 7:149048710-149048732 CCTTCTGCACCAGTGGTGGTGGG + Intergenic
1034420539 7:150988500-150988522 CAATCTGCTCCTCTGGGGGTGGG + Intergenic
1037204844 8:16304387-16304409 CATTCTGAGCAACTGGGGTTGGG - Intronic
1038647367 8:29372937-29372959 CACTCTGCACCCCTGGCGCTGGG - Intergenic
1041333165 8:56750535-56750557 CATTCTGAGACACTGAGGGTTGG + Intergenic
1041391897 8:57354271-57354293 CATTCTGAGGTACTGGGGGTAGG + Intergenic
1043464136 8:80487668-80487690 CATCATGCCCCACTGGGGGAAGG - Exonic
1044110215 8:88263789-88263811 CATTCTGGGGTACTGGGGGTTGG + Intronic
1044790729 8:95844279-95844301 CATTCTGGGGTACTGGGGGTTGG + Intergenic
1046852735 8:118993794-118993816 CATTCTGAGATACTGGGGGTTGG + Intergenic
1047245912 8:123144492-123144514 CACTCTGCAATACTGGGGGTTGG + Intronic
1047603123 8:126447317-126447339 CATTCTGAGGCACTGGGTGTTGG - Intergenic
1049963871 9:761156-761178 CTTTCCTCACCACTGCGGGTGGG - Intergenic
1050442851 9:5683731-5683753 CAGTCTCCACCTCTGGGGGCAGG - Intronic
1052487642 9:29122974-29122996 CATTCAGCAGTTCTGGGGGTAGG + Intergenic
1054453177 9:65414035-65414057 CCTTCTGCCCCAGTGAGGGTGGG - Intergenic
1056928222 9:90853023-90853045 CATCCAGCACAAGTGGGGGTGGG - Intronic
1056960728 9:91120323-91120345 CCTTCTGCCCCACTGGGCCTGGG + Intergenic
1057387219 9:94614681-94614703 GATGCTGCCCCACTGGGCGTGGG + Intronic
1057393445 9:94658323-94658345 GCTTCTGCACCCGTGGGGGTTGG + Intergenic
1057440252 9:95077794-95077816 CATTCGTCACCACAGGGAGTGGG - Intronic
1057470444 9:95351510-95351532 CATTGTGCACCCCTGGGTTTTGG + Intergenic
1061482112 9:130902500-130902522 GACTTGGCACCACTGGGGGTTGG - Exonic
1061904948 9:133691991-133692013 AATTGTGCACCACTGGGAGATGG + Intronic
1062035234 9:134379943-134379965 CAGCCTGCTCCCCTGGGGGTTGG + Intronic
1062111352 9:134783730-134783752 CAATCTGCACCTCTGTGGGAAGG + Intronic
1189230336 X:39447272-39447294 CATTCTGAGGCACTGGGAGTTGG + Intergenic
1189414563 X:40802821-40802843 CAGTGGGCACCACTGGGGGGTGG - Intergenic
1192922262 X:75719494-75719516 CAGACTCCACCGCTGGGGGTAGG - Intergenic
1195612803 X:106888038-106888060 CATTCTGAGTTACTGGGGGTTGG - Intronic
1195877463 X:109557094-109557116 CATTCTGCCCCACAAGGAGTAGG - Intergenic
1197008896 X:121536798-121536820 TATGCTCCACCTCTGGGGGTAGG - Intergenic
1197988744 X:132294795-132294817 CCTAATGGACCACTGGGGGTAGG + Intergenic