ID: 1112121010

View in Genome Browser
Species Human (GRCh38)
Location 13:96411418-96411440
Sequence ATATTTACAAAGGTTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112121010 Original CRISPR ATATTTACAAAGGTTGAGAT GGG Intronic
902265909 1:15263939-15263961 ATATATGCAAAGGTTTATATGGG + Intronic
903497847 1:23782605-23782627 TTATTTATATAGTTTGAGATAGG + Intronic
904632553 1:31853566-31853588 ATATATATAAAGGATGAGAAAGG + Intergenic
904684044 1:32248083-32248105 ATATTTGCACATGTTGAGTTGGG - Intronic
906401947 1:45510910-45510932 ATATTGACACAGGTAGATATAGG - Exonic
906930446 1:50164485-50164507 ATATTTTCAAAGGTCATGATGGG - Intronic
907074745 1:51568010-51568032 CTATTTACAAAGGTTGGGGCAGG + Intergenic
907534256 1:55135153-55135175 ATTTTTAAAAAAATTGAGATGGG + Intronic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
907983924 1:59511743-59511765 AAATTTGCAAAGGTTTAGACTGG + Intronic
909033339 1:70567554-70567576 ATATTTACAAAGCTGAACATGGG - Intergenic
909451275 1:75800268-75800290 ATATTTACAAAGGTGTGGACAGG - Intronic
909559032 1:76989197-76989219 AGATTCACAGAGGTTGAGAATGG - Intronic
909635203 1:77810077-77810099 ATAATTACAAAGTTTTAGATGGG - Intronic
910018942 1:82561564-82561586 TTATTTACAAAGATTGGCATGGG - Intergenic
912565214 1:110582672-110582694 ATATTTACATAGTTTGAAATTGG + Intergenic
914889313 1:151608706-151608728 ATATTTAGAAAGGATCAGGTTGG - Intergenic
915132296 1:153704047-153704069 ATATTTATAATTGTAGAGATAGG - Intergenic
915159474 1:153907522-153907544 ATATATACAAAGTTTCAGTTTGG + Intronic
915375800 1:155394265-155394287 ATAGTGAATAAGGTTGAGATGGG + Intronic
915891509 1:159778597-159778619 ATATTTATACAAGGTGAGATGGG + Intergenic
916452234 1:164931914-164931936 ATAGTTCCAAATGTGGAGATGGG - Intergenic
917924514 1:179778162-179778184 ATATTCACAACTGTTAAGATGGG - Intronic
919326415 1:196112709-196112731 ATATTTCCTAAGGATAAGATGGG - Intergenic
919563817 1:199158871-199158893 ATATTTTCAAATGTCTAGATGGG + Intergenic
921541719 1:216424341-216424363 ATTTTGACAAAGGGTGAGAAAGG - Intergenic
921545573 1:216470867-216470889 CTATTTCCAAAGGTTTTGATGGG - Intergenic
922121055 1:222669107-222669129 ATAATTACAAAGTTTTAGATGGG - Exonic
923408111 1:233683169-233683191 ATATTCATAAAGATTGAGAAGGG + Intergenic
923840548 1:237666117-237666139 ATATTTACAAATGTCTTGATGGG - Intronic
923948381 1:238918413-238918435 ATATTTTTAAAATTTGAGATGGG + Intergenic
924329732 1:242929525-242929547 AAATTTTCCAAGGTTGGGATGGG - Intergenic
1064343786 10:14511742-14511764 AAATTTACAATGATTGAGGTGGG - Intergenic
1066406630 10:35125493-35125515 ATTTGAACAAAGGTTCAGATTGG + Intergenic
1067330477 10:45311350-45311372 AGATGTAGAAAGATTGAGATGGG - Intronic
1067349860 10:45465932-45465954 ATATTGACAAAGGTAGTGATGGG - Intronic
1067679694 10:48423753-48423775 TTATTTACAAAGTTTGTGTTTGG + Intronic
1068375082 10:56167614-56167636 ATATTTGCAAGTTTTGAGATGGG - Intergenic
1071797541 10:89022524-89022546 ATATTTAGATAGGTCGAGAATGG - Intergenic
1073194755 10:101681041-101681063 AAATTTATAAAGGTAGAGGTGGG + Intronic
1073198649 10:101716545-101716567 ATACTTACAAATGGTGAGAAGGG - Intergenic
1073815631 10:107203522-107203544 ATATTTATAAAAGATGATATTGG + Intergenic
1074437100 10:113443513-113443535 ATCTTCACAAAGGTTTGGATGGG - Intergenic
1077866801 11:6228996-6229018 ATATTTACAAAGATATGGATAGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078381407 11:10845076-10845098 ATATTTTAAAAAGCTGAGATGGG + Intronic
1081200757 11:40212552-40212574 ATATGTACAAAGAGTTAGATTGG + Intronic
1081239600 11:40688252-40688274 ATATTTGCAAATGTTAAGTTAGG - Intronic
1082064835 11:47891625-47891647 AAATTTACAAAGGTAGAAACTGG - Intergenic
1084267723 11:68013413-68013435 ATTCTTACAAAGGGTGAGAGAGG + Intronic
1085669916 11:78453570-78453592 ATATTTAAAAATACTGAGATAGG - Intronic
1086726047 11:90185792-90185814 ATATTAACAAATGTTCAAATAGG - Intronic
1088276469 11:108091888-108091910 ATATTTTGAAAGGCTGAGGTGGG + Intronic
1088502435 11:110496104-110496126 ACATTTACAAAGATAGAGCTGGG + Intergenic
1091039671 11:132265214-132265236 ATGTTTAAAATGCTTGAGATGGG - Intronic
1091165864 11:133475702-133475724 ATATTTTCAAAGGTTAAGACTGG - Intronic
1092550817 12:9497479-9497501 TTAATTAAAAAGGTTGAAATAGG - Intergenic
1094521002 12:31188894-31188916 TTAATTAAAAAGGTTGAAATAGG + Intergenic
1094760665 12:33528748-33528770 ATACTTTGGAAGGTTGAGATGGG - Intergenic
1095310025 12:40687717-40687739 ATATTAATTAAGGTTGAGAGTGG + Intergenic
1098030984 12:66253614-66253636 ATATTTACAGAGTTTTACATTGG + Exonic
1098459483 12:70716430-70716452 ATATTTACAAAATTTGAAGTAGG + Intronic
1098513494 12:71346546-71346568 ATATTAACCAAAGTTGAAATGGG - Intronic
1098609413 12:72436219-72436241 ATATTTTCAAAGGTTAAGCTAGG - Intronic
1098719141 12:73872769-73872791 ATATTTTCAAAAGTTGAAAATGG - Intergenic
1099679748 12:85810666-85810688 AAATTTTCAAAGATTGAGATGGG - Intronic
1100001706 12:89844580-89844602 ATATGAACAAAGGTTTAGAAAGG - Intergenic
1100673528 12:96842097-96842119 AAATTTACAAACATTTAGATAGG - Intronic
1102127330 12:110494647-110494669 ATATTTACTAAGGATCAGAAAGG + Intronic
1102746969 12:115257706-115257728 AGATTTACAAAGGCTGAGTGAGG + Intergenic
1102913349 12:116735728-116735750 ATGTTAAAAAAGGTTAAGATGGG + Intronic
1103365771 12:120382057-120382079 AATTTTAAAAAGGTTGAGAAAGG + Intergenic
1103637088 12:122316046-122316068 ACATTTCCAAATGTTAAGATTGG + Intronic
1104468909 12:129012860-129012882 ACATTTACACAGGTATAGATTGG + Intergenic
1105021364 12:132818704-132818726 ACATTTACAAAGGCTGATTTTGG + Intronic
1105247092 13:18663289-18663311 ATAATTACAAATGTGGAAATTGG - Intergenic
1105412280 13:20180560-20180582 AGATTTTCAAAGCTTGACATGGG + Intergenic
1105682063 13:22738499-22738521 ATATTTACGAAGGTTGTTTTTGG + Intergenic
1107331584 13:39307042-39307064 ATATTGTCAAAAGGTGAGATAGG - Intergenic
1107539096 13:41369271-41369293 AAAATTAGAAAGGGTGAGATGGG + Exonic
1107697655 13:43016157-43016179 ATATTTAAAAAGGTGGAGAAAGG + Intergenic
1108139255 13:47401381-47401403 GTGTTTACATAGGTAGAGATAGG - Intergenic
1108228466 13:48314930-48314952 ATCTTTTCAAAGGATGAAATTGG + Intronic
1108840651 13:54610256-54610278 ATATTTACAAACTTGGAAATAGG + Intergenic
1108962388 13:56250312-56250334 ATATTTACATATGTTGACATAGG - Intergenic
1109705733 13:66089596-66089618 ATATTTTAAAATGTTGATATTGG - Intergenic
1109729836 13:66397876-66397898 ATAATTATAAAGGTTGTTATGGG - Intronic
1109871672 13:68341311-68341333 ATATTTAAAAAGGATGAGTGAGG - Intergenic
1109970063 13:69756204-69756226 ATATCTACATATGTTGAGGTTGG + Intronic
1110681464 13:78318401-78318423 ACAGGTACAAAGGTAGAGATGGG - Intergenic
1111518905 13:89373539-89373561 ATATTTAAGAAGGGAGAGATGGG + Intergenic
1111537472 13:89622582-89622604 ATATTTACAAAGGATTATTTGGG - Intergenic
1112030568 13:95452935-95452957 ATATTTGCAATGTTTGAGTTGGG - Intronic
1112121010 13:96411418-96411440 ATATTTACAAAGGTTGAGATGGG + Intronic
1112417091 13:99212123-99212145 ATATTGAGACAGGTTGAGAACGG - Intronic
1115480334 14:33854797-33854819 TTATATCCAAAGGTTGAGATGGG - Intergenic
1116550279 14:46228809-46228831 ATATTTGCAAAACTTGAGATAGG - Intergenic
1117080208 14:52143875-52143897 ATAATTACAAAAGGTGGGATAGG - Intergenic
1119002748 14:70897820-70897842 ACATTTACACTGGTTGTGATTGG + Intergenic
1119129664 14:72159887-72159909 ATATTTGCAAAGTTTCAAATTGG - Intronic
1119910069 14:78341543-78341565 TTATTTCCAAAAGTTGAGAGTGG + Intronic
1120732967 14:88023452-88023474 ATATTTACAAAGGATGGGCAGGG + Intergenic
1121698496 14:95932712-95932734 ATATTTATGAAGCCTGAGATGGG + Intergenic
1123734757 15:23175016-23175038 TTATTTATTTAGGTTGAGATGGG - Intergenic
1123837009 15:24205049-24205071 ATAATAACAAAGGTTGATCTTGG + Intergenic
1123846270 15:24305155-24305177 ATAATAACAAAGATTGATATTGG + Intergenic
1123865315 15:24512863-24512885 ATAATAACAAAGGTTGATATTGG + Intergenic
1124285259 15:28396314-28396336 TTATTTATTTAGGTTGAGATGGG - Intergenic
1124297437 15:28515300-28515322 TTATTTATTTAGGTTGAGATGGG + Intergenic
1125074117 15:35592791-35592813 ATATGTACAAAGGTACAGACTGG + Intergenic
1125917891 15:43505717-43505739 ATATCTAAAAAGGTTGAGATGGG - Intronic
1126135606 15:45387728-45387750 ATATTTACAATGTTTGAGAGAGG + Intronic
1126224873 15:46259431-46259453 TTATTTAAAAAAATTGAGATGGG - Intergenic
1126345019 15:47684444-47684466 TCTTTTAAAAAGGTTGAGATAGG + Intronic
1126387144 15:48105919-48105941 ATATTTGCTGAGGTTGAGCTGGG + Intergenic
1127835317 15:62786228-62786250 ATATTTTCACATGTTGTGATAGG - Intronic
1129921901 15:79326546-79326568 ATATTTACAAAGGTTGGGCAGGG - Intronic
1130017295 15:80197409-80197431 ATATTTACAGAGGTTGGGCAAGG - Intergenic
1131025984 15:89141912-89141934 ATATTTTTAAAGGTAGAGGTTGG + Intronic
1133396268 16:5449906-5449928 ATATGTACAAAGCTAGAGGTGGG - Intergenic
1134473159 16:14546560-14546582 ATATTTTGAAAGCTGGAGATTGG - Intronic
1135129975 16:19845386-19845408 ATATTTCTAAAGGTTCAGTTTGG + Intronic
1136587185 16:31194275-31194297 AAATTTAAAAAGGATGAGACTGG - Exonic
1137399547 16:48142132-48142154 ATATTTACAGAGACGGAGATGGG + Intronic
1138749829 16:59406261-59406283 ATATTAACTAAGGTTTAGATTGG + Intergenic
1140573025 16:76130985-76131007 ATATTTACAAAGGGTGAGGAGGG + Intergenic
1141354510 16:83331977-83331999 AAATTTTCAAAGCTTGTGATGGG + Intronic
1143753714 17:9051052-9051074 ATTTTGACCCAGGTTGAGATGGG + Intronic
1144223324 17:13120097-13120119 ATATTTTGAAAGGTTAAGGTGGG - Intergenic
1145814045 17:27782792-27782814 ACATTCCCAAATGTTGAGATGGG - Intronic
1146114944 17:30127078-30127100 TTATTTACAAAAATGGAGATGGG + Intronic
1146318927 17:31831326-31831348 ATATTTTCAAAGTTTGACATGGG - Intergenic
1146991158 17:37274125-37274147 ATAGTCACAAATGTGGAGATTGG - Intronic
1147224140 17:38962895-38962917 AAATTTCCAAATGTTGATATGGG + Exonic
1149190113 17:54050862-54050884 GTATTTACAAAGATAGAGCTTGG - Intergenic
1149584396 17:57775745-57775767 ATATTTAAAAAGATAGAGAAGGG - Intergenic
1150091287 17:62327818-62327840 ACATTTATAAAGGTTGATTTTGG + Intergenic
1150824135 17:68459721-68459743 ACATTTAAAAAGGTAGAAATAGG + Intergenic
1152910066 17:82998718-82998740 ATATTTACAAAGTCTGACAAAGG + Intronic
1153330141 18:3865415-3865437 ATATATAAAAAGGTTGTAATAGG - Intronic
1154441755 18:14395833-14395855 ATAATTACAAATGTGGAAATTGG + Intergenic
1155006454 18:21733946-21733968 ATTTTAAGAAAGGATGAGATGGG - Intronic
1156354716 18:36331267-36331289 GTATATACAAAGGCTGAGAGAGG - Intronic
1156437205 18:37144986-37145008 ACATTTTCAAAGGCTGAGGTGGG + Intronic
1157851277 18:51053720-51053742 TTTTTTTCAAAGGTTGACATAGG + Intronic
1157956661 18:52105675-52105697 ATTTTTACAAAGAATTAGATTGG + Intergenic
1159513405 18:69426443-69426465 TAATTTACAAATGTTGAAATGGG + Intronic
1159686789 18:71431718-71431740 ATATTTATAAAGGCAGAGAGAGG + Intergenic
1159858975 18:73624438-73624460 ATTTTTAGATAGGTTCAGATGGG - Intergenic
1161754218 19:6119726-6119748 ATACTTTCAAAGGCTGAGGTGGG - Intronic
1163090797 19:15018705-15018727 ATATATACATATTTTGAGATAGG - Intronic
1167864242 19:52311310-52311332 ATATTTTAAAAAATTGAGATGGG - Intronic
926913994 2:17876480-17876502 ATGTTGACCAAGGTTGAGCTAGG - Intergenic
927417463 2:22893766-22893788 ATATTTAACAAGGGTGAGGTGGG + Intergenic
928963258 2:36951764-36951786 ATATATACCAAGTATGAGATAGG + Intronic
929265684 2:39916515-39916537 ATTTTTACATATGGTGAGATAGG + Intergenic
930555308 2:52887896-52887918 AGATTTAGAAGGGTAGAGATTGG - Intergenic
931413057 2:62053128-62053150 ATGTATTCAAAGGGTGAGATAGG - Intronic
933038695 2:77432663-77432685 ATATTTAGAGAGCTAGAGATAGG + Intronic
936468805 2:112778898-112778920 ATATTTTCAAAGGTCCAGAGAGG - Intronic
937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG + Intronic
937482289 2:122275127-122275149 ATATTTACAGAGGTATATATAGG - Intergenic
937861085 2:126710456-126710478 ATATTTACAAAAATTGAGCTGGG + Intergenic
938050922 2:128170528-128170550 ATCTTTACAAAGATTGACAGTGG + Intronic
939932707 2:148254747-148254769 ATGTTTACACAGGCTGCGATGGG + Intronic
940158122 2:150680911-150680933 ATGATTACAGAGGCTGAGATTGG + Intergenic
941283412 2:163580632-163580654 ATTTTTACAAAGGGTGAGCAGGG - Intergenic
941309360 2:163910220-163910242 ACATTTACAAACCTTGAGCTAGG - Intergenic
942699851 2:178693466-178693488 CTATGTACAAAGGATGTGATGGG - Intronic
943332480 2:186576144-186576166 ATATTTGAAAAGGTTTTGATGGG + Intergenic
944389477 2:199202684-199202706 TTATTTAGAGAGGTGGAGATAGG - Intergenic
944725105 2:202463099-202463121 ATATTTATAAATGAAGAGATTGG - Intronic
944940936 2:204625911-204625933 AAAATTACAAAATTTGAGATTGG + Intronic
1170252653 20:14302510-14302532 ATATTGACAAAGCCTGAAATAGG + Intronic
1170607590 20:17885521-17885543 CTATTTACAAAGGCACAGATAGG + Intergenic
1173414961 20:42847146-42847168 ATATTTACAAAGGTACAAAGCGG + Intronic
1174997950 20:55592509-55592531 CTATTTACAAAGGTTTGGACTGG + Intergenic
1176454313 21:6895341-6895363 ATAATTACAAATGTGGAAATTGG - Intergenic
1176701091 21:10050809-10050831 GTAATTACAGAGGATGAGATGGG + Intergenic
1176832487 21:13760389-13760411 ATAATTACAAATGTGGAAATTGG - Intergenic
1177029975 21:15970252-15970274 ATATTTGGAAAGGCAGAGATAGG + Intergenic
1177209077 21:18047398-18047420 ATATATCCAAAGTTTGAGAGGGG - Intronic
1178881223 21:36451608-36451630 ATCTTTAAAAATGTTGAAATAGG - Intergenic
1180789135 22:18564739-18564761 TTATTTACAAAGGTGTAAATAGG - Intergenic
1181232606 22:21430573-21430595 TTATTTACAAAGGTGTAAATAGG + Intronic
1181246045 22:21504284-21504306 TTATTTACAAAGGTGTAAATAGG - Intergenic
1182192844 22:28481689-28481711 ATAAATTCAAATGTTGAGATAGG + Intronic
1184455075 22:44605518-44605540 ATATTTGCAAAGGTTGCCAAAGG + Intergenic
953206363 3:40833543-40833565 ACATTTAAAAAGGTAGAGAAAGG - Intergenic
953844040 3:46412746-46412768 ATATTAAAAAAGGATGAGAAAGG + Intronic
955665870 3:61348678-61348700 CTAGTTACAAAGGTGTAGATTGG + Intergenic
956715177 3:72073009-72073031 AGATTTACAAAGGCTCACATAGG - Intergenic
957015569 3:75060392-75060414 TTATCTACAAAAGTTGAGAGTGG + Intergenic
958186021 3:90120088-90120110 ATAATTACAGAGGCAGAGATGGG - Intergenic
958646145 3:96876860-96876882 ATATTGCCAAAGGTTGAATTAGG + Intronic
959576725 3:107942318-107942340 ACATTTACAAAGGTTGATGTAGG - Intergenic
961587066 3:127939463-127939485 ATATTTACAAAGCATGAAAGAGG + Intronic
963426705 3:145138294-145138316 ACATTTACAAAGGATGAGTGAGG + Intergenic
964514066 3:157488178-157488200 GTATTTAGAAAGAATGAGATGGG - Intronic
964693363 3:159479076-159479098 ATATTTACAAAGGTTTAAAAAGG + Intronic
965367135 3:167814818-167814840 ATTTTTACAATGGATGAGATGGG - Intronic
967527952 3:190515371-190515393 ATATTTACAATAGTTGCCATTGG - Intronic
970167022 4:13249527-13249549 ATATTTGAAAAACTTGAGATAGG - Intergenic
970885628 4:20984700-20984722 ATATTTACAAAGGTGGACGGAGG + Intronic
971943820 4:33249042-33249064 ATATTTACATATTTTGAGGTTGG + Intergenic
973937395 4:55861713-55861735 AAATTTAGAAAGCTAGAGATTGG + Intronic
974445696 4:61978061-61978083 ATATTTATATAGGTTAAAATTGG + Intronic
974532497 4:63127615-63127637 ATATTCTCAAGGGTTGAGGTAGG + Intergenic
974641516 4:64638153-64638175 AAATTTAGAAATGATGAGATAGG - Intergenic
974647105 4:64709423-64709445 ATATTTACAATGATTGACTTGGG + Intergenic
975483397 4:74907083-74907105 ATATTTACAAAGGATGTTTTGGG + Intergenic
976813859 4:89124448-89124470 AAATTCACAGAGGTTGAGGTTGG + Intergenic
976849769 4:89531479-89531501 ATACATACAGAGGTAGAGATAGG + Intergenic
977275011 4:94966682-94966704 ATATTTACAAATATAGACATAGG - Intronic
977583850 4:98753716-98753738 ATAATTACAAAGGTTCTTATTGG - Intergenic
978166849 4:105619623-105619645 AGATTTAGAAAAGTGGAGATTGG + Intronic
978401743 4:108338497-108338519 ATACTTACAAGGGTTGAGAAAGG - Intergenic
978566963 4:110093604-110093626 TTATTTTCAAAGGTGGAAATAGG - Intronic
979008062 4:115329826-115329848 TCATTTATAAAAGTTGAGATTGG - Intergenic
979466956 4:121050934-121050956 ATACTTACAAAGGTAGAGATGGG + Intronic
979787980 4:124740544-124740566 ATATTTTAAAAGGTTTAAATGGG + Intergenic
980512670 4:133813784-133813806 AGATTTTCCAAGGTTGAAATGGG + Intergenic
981435736 4:144719565-144719587 ATATGTATAAATGTTGTGATGGG - Intronic
982667197 4:158279437-158279459 ATAATTACAAATTTTTAGATGGG + Intergenic
983702570 4:170615646-170615668 ATATTGAGTAAGGTTAAGATTGG - Intergenic
988316529 5:29637283-29637305 ATATTCCCAAAGGGAGAGATAGG + Intergenic
988884163 5:35537087-35537109 ATATTTACATAGTTTGAGGGTGG + Intergenic
989235812 5:39147427-39147449 ATATGTACAAAAGTTTAGCTGGG - Intronic
993261935 5:85668766-85668788 ATCTCTACAAATGCTGAGATTGG + Intergenic
993350536 5:86844487-86844509 ATATTTAAAAAGGTTAACATAGG + Intergenic
993351089 5:86851624-86851646 ATATAAACAAATGTTGAGAGAGG - Intergenic
994032053 5:95154366-95154388 ATATGTTCAAAGGTTAAGAATGG - Intronic
994304536 5:98186972-98186994 GTATCAACAAAGGTTGAGAAAGG + Intergenic
995783540 5:115803606-115803628 ATCTTTCCAAAGGATGAGAGAGG + Intergenic
996518931 5:124404911-124404933 GTATTTACAAGGGTAGAGAAGGG - Intergenic
997503017 5:134393152-134393174 ATCTTTTAAGAGGTTGAGATTGG + Intergenic
998561088 5:143172348-143172370 AGATTAACAAAGGCTGAGAGAGG + Intronic
998924850 5:147111495-147111517 TTATTTATAAAAGTTGAGGTAGG + Intergenic
1000452419 5:161406390-161406412 AAATCTACGAAGGTTGAGAAGGG + Intronic
1000543685 5:162572071-162572093 ATATTTGCAAATCTTGAGAAAGG - Intergenic
1000735247 5:164891244-164891266 ATATTTACAAGGTGTGAGATGGG - Intergenic
1002280742 5:178128789-178128811 ATACTTCCAAAGGCTGAGAGGGG + Intergenic
1002553017 5:180011474-180011496 ATATATACAAAGGTTGAGGGTGG + Intronic
1003549742 6:7092653-7092675 TTATTTTCAAAAGTTGAGCTAGG + Intergenic
1003708200 6:8559263-8559285 CTACTTACAAAGGTGTAGATGGG + Intergenic
1003868368 6:10382997-10383019 ATATTTATAAAGGCAGAGAGAGG + Intergenic
1005423818 6:25680004-25680026 ATATTTAGAAAGATTGAAGTAGG - Intronic
1005821510 6:29603411-29603433 GTATTTACAAGAGATGAGATTGG + Exonic
1010374351 6:75149186-75149208 ATATGTACAAGGGTAGAGAGAGG - Intronic
1010409940 6:75549931-75549953 ATATTCAAAAAGATTGAGAAAGG - Intergenic
1010410373 6:75554691-75554713 ATATTTACAAAGGTGTGGCTGGG - Intergenic
1010646255 6:78390687-78390709 ATTTTTACAAATTTTGAAATTGG - Intergenic
1010783821 6:79976421-79976443 GTTTTTACAATGGTTGAAATAGG - Intergenic
1010805932 6:80236668-80236690 ATACTAACAAGGGTTGAGCTGGG + Intronic
1011273305 6:85602324-85602346 ATACTTACAAAGGTATAGGTTGG - Intronic
1011692625 6:89884192-89884214 TTCTGTACAAAGGATGAGATAGG + Intergenic
1012121021 6:95366929-95366951 ATTTTTAAAAAGGTTTACATTGG + Intergenic
1013168189 6:107612712-107612734 ATAATTACAAAGGTTCTGTTTGG - Intronic
1014062123 6:117083555-117083577 TTATTTACAAAGAATGAGAGTGG - Intergenic
1014240038 6:119007300-119007322 ATTTCTACAAAAGTTGAAATTGG + Intronic
1014752928 6:125273335-125273357 ATGTTTACACAGGCTGTGATGGG - Intronic
1014795262 6:125717550-125717572 ATATTTAGAAAAGTTTAGTTCGG - Intergenic
1014953487 6:127587437-127587459 ATATTTTCAAAGGCTTATATTGG + Intronic
1015564800 6:134558196-134558218 ATAAATGGAAAGGTTGAGATAGG - Intergenic
1016751924 6:147639942-147639964 TTATTTTTAAAGGTAGAGATGGG + Intronic
1017560114 6:155617831-155617853 ATATTTTCAGAAGTTGATATAGG - Intergenic
1020836023 7:13152217-13152239 ATATTCACAAAAGTTGCTATTGG + Intergenic
1021930344 7:25574877-25574899 ATATTAAGAAAGGTTGACACAGG + Intergenic
1022690077 7:32640984-32641006 ATAATGAAAAAGGTTGAAATAGG - Intergenic
1023371912 7:39520130-39520152 AAATTTACAAAGGTAGTTATTGG - Intergenic
1023842770 7:44106317-44106339 GTCTTTAGAGAGGTTGAGATTGG + Intronic
1024688956 7:51779015-51779037 ATTTTTAAAAAGCTTGAGATTGG + Intergenic
1024718600 7:52108536-52108558 ATATATATAAAGGCTGTGATGGG - Intergenic
1026048151 7:66921904-66921926 ATATTTACCAAGCTTGACACAGG - Intronic
1026546498 7:71327664-71327686 ATATTTACAAAGATTGTGAAGGG + Intronic
1027656486 7:80936495-80936517 ATGTTTACCAATGTTGAGGTGGG - Intergenic
1028118955 7:87035589-87035611 ATATTGACAAAGGGTGACATTGG - Intronic
1028576793 7:92361029-92361051 TTATTTACAAAGGTTAGGCTTGG - Intronic
1028660819 7:93271875-93271897 GTATTTATAAAAGTTGAGATTGG + Intronic
1030216439 7:107047821-107047843 TTTTTTAAATAGGTTGAGATGGG + Intronic
1030379379 7:108795058-108795080 TTATTTACAAAGGTTTAGACAGG + Intergenic
1031048946 7:116925611-116925633 ATATATACAAAGATTGAGTCGGG + Intergenic
1031403326 7:121352587-121352609 ATCTTCACAGAGGCTGAGATTGG - Intronic
1032374970 7:131404481-131404503 ATTTTTAAAAATGTGGAGATGGG + Intronic
1032625591 7:133588333-133588355 ATATTTTTAAAGGGTGAAATGGG - Intronic
1033288019 7:140059166-140059188 GTATTTACCAAGGAGGAGATGGG + Intronic
1033682643 7:143610445-143610467 AGATTTAAAAAGGGTGGGATGGG + Intergenic
1033702250 7:143851476-143851498 AGATTTAAAAAGGGTGGGATGGG - Exonic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1037003858 8:13752371-13752393 ACATGCAGAAAGGTTGAGATAGG + Intergenic
1038865262 8:31432691-31432713 ATATTTACAAAGATACAGCTGGG - Intergenic
1039203513 8:35123402-35123424 ATATTAGCAAAGGTTGAGAGGGG + Intergenic
1039860034 8:41449129-41449151 ATAATTAGAGAGGCTGAGATAGG - Intergenic
1044502379 8:92973593-92973615 AGATATACAAAGGTTGACTTTGG + Intronic
1045005427 8:97913133-97913155 ATATTCACAAAGGATGAAGTGGG - Intronic
1045549186 8:103154909-103154931 ATATATATATAGCTTGAGATAGG - Intronic
1046655003 8:116884096-116884118 ATATATACAAAGGTAGAAAGAGG - Intergenic
1046751976 8:117935697-117935719 ATATTTAAGAAAGTTGAGTTTGG - Intronic
1047024921 8:120813840-120813862 AGATACACTAAGGTTGAGATAGG + Intergenic
1047068725 8:121317754-121317776 ATATTTAAAAGAGTTGAGAGAGG + Intergenic
1047546795 8:125826016-125826038 ATATTTACAAAGGTCTTAATTGG - Intergenic
1047888939 8:129285600-129285622 ATTTTTACAAAATTTAAGATTGG - Intergenic
1048208502 8:132434918-132434940 AAATTTACAGAGGTTCAAATTGG - Intronic
1049037336 8:140086756-140086778 ATTTTTAAAAAAGTAGAGATGGG - Intronic
1050776887 9:9274845-9274867 ATATTCATATAGGTTTAGATAGG + Intronic
1050784736 9:9387101-9387123 ACATTTACAAAGGCTTACATTGG + Intronic
1052152933 9:25141934-25141956 TTATTTACAAAGGCCAAGATAGG + Intergenic
1052177628 9:25483424-25483446 TTATTTACAAAATTTCAGATGGG - Intergenic
1052551656 9:29958314-29958336 AAATTTTCAATGGTTGAGAAGGG - Intergenic
1053565323 9:39243408-39243430 GTTTTTATAAAGGTTGATATTGG + Intronic
1054131829 9:61375631-61375653 GTTTTTATAAAGGTTGATATTGG - Intergenic
1054880293 9:70137472-70137494 ATATCTATAAAGGTTGTTATTGG - Intronic
1055528607 9:77160214-77160236 ATATTCATTAAGGTAGAGATTGG + Intergenic
1056842420 9:90009267-90009289 ATATTAACCAAGGTGTAGATTGG + Intergenic
1058282681 9:103135898-103135920 ACATTCACAAAGGTTGAGAAAGG - Intergenic
1058531531 9:105910470-105910492 ATATTTGCCAAGGCTGAGAATGG - Intergenic
1058842312 9:108921935-108921957 CTCCTTACAAGGGTTGAGATGGG - Intronic
1059624831 9:116051870-116051892 ATATTTACATAGATTGAAACTGG - Intergenic
1059737795 9:117119652-117119674 ATATTTAAAAAGATTCAGAGAGG - Intronic
1059783831 9:117558706-117558728 ACATTTAAAAAGGTTAATATGGG + Intergenic
1060460973 9:123854286-123854308 TTCTTTACAAATGTTGTGATTGG - Intronic
1202786105 9_KI270719v1_random:20866-20888 GTAATTACAGAGGATGAGATGGG + Intergenic
1203451167 Un_GL000219v1:118307-118329 ATATATTCAAGGGTCGAGATTGG + Intergenic
1186589442 X:10914380-10914402 ATATTTTAAAAGCTTGTGATAGG - Intergenic
1187189286 X:17018047-17018069 ACATTTAAAATGGTTAAGATGGG - Intronic
1187264715 X:17720338-17720360 ATATTTCCAAATGTAAAGATGGG + Intronic
1188740627 X:33775151-33775173 ATGTTGACAAATGGTGAGATTGG + Intergenic
1189734499 X:44055947-44055969 ATATTTCTGAAGGTTGAGAAGGG - Intergenic
1191586321 X:62830694-62830716 TTATTTGCAAAGCTTCAGATTGG - Intergenic
1191844637 X:65537762-65537784 AGATTTAGACAGGTTGATATTGG - Intergenic
1192588910 X:72343471-72343493 AGATTTACAAAATTTGAGTTCGG - Intronic
1192603398 X:72488309-72488331 ATATTCATAAAAATTGAGATTGG - Intronic
1193410760 X:81160140-81160162 ATCTTTATCAAGGTTGATATGGG - Intronic
1193431667 X:81413817-81413839 ACATTTACAAAAGCTGAGATAGG + Intergenic
1193477840 X:81988577-81988599 ATATTTAGAACTTTTGAGATTGG + Intergenic
1193602256 X:83521737-83521759 TTATTTATAAAGGTTAAGCTGGG - Intergenic
1194531383 X:95053820-95053842 AAAATTACAAAGTTTCAGATAGG + Intergenic
1194614293 X:96082516-96082538 ATATATACACACATTGAGATAGG - Intergenic
1194667923 X:96696084-96696106 TTATTTAAAAAGGTTGGGCTGGG + Intronic
1196277319 X:113782165-113782187 ATATTTACAAATATTGCTATGGG - Intergenic
1197233166 X:124028897-124028919 ATACTTTCGGAGGTTGAGATGGG - Intronic
1199207962 X:145171500-145171522 ATGTTTACAAAGATTGAGACTGG + Intergenic
1201651273 Y:16290243-16290265 ATTTTTAAAATGATTGAGATAGG + Intergenic