ID: 1112123700

View in Genome Browser
Species Human (GRCh38)
Location 13:96441073-96441095
Sequence TTGAATCTGCATATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 299}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112123700_1112123706 11 Left 1112123700 13:96441073-96441095 CCCTCCACCATATGCAGATTCAA 0: 1
1: 0
2: 2
3: 26
4: 299
Right 1112123706 13:96441107-96441129 CTGTCTGTAAACCAGGAAGAGGG 0: 1
1: 28
2: 89
3: 321
4: 925
1112123700_1112123704 4 Left 1112123700 13:96441073-96441095 CCCTCCACCATATGCAGATTCAA 0: 1
1: 0
2: 2
3: 26
4: 299
Right 1112123704 13:96441100-96441122 AAGACTGCTGTCTGTAAACCAGG 0: 1
1: 4
2: 36
3: 173
4: 667
1112123700_1112123705 10 Left 1112123700 13:96441073-96441095 CCCTCCACCATATGCAGATTCAA 0: 1
1: 0
2: 2
3: 26
4: 299
Right 1112123705 13:96441106-96441128 GCTGTCTGTAAACCAGGAAGAGG 0: 2
1: 23
2: 123
3: 367
4: 818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112123700 Original CRISPR TTGAATCTGCATATGGTGGA GGG (reversed) Intronic
900837201 1:5014099-5014121 TTGACTCTGCAAATGGCAGAAGG - Intergenic
901217504 1:7562947-7562969 TTGAATCTGGATTTGGTTGGGGG + Intronic
902199016 1:14820137-14820159 CTGAATCTGCATATTTGGGAAGG - Intronic
902733200 1:18383498-18383520 GGGAATCTGCAGATGGTGGGTGG - Intergenic
903015328 1:20357964-20357986 CTGCATCTGCATGTGGTGGGAGG - Intergenic
903879975 1:26501529-26501551 TTGAAACTGAATATGAAGGAGGG - Intergenic
905258602 1:36701602-36701624 TTGGATCTCCAAATGTTGGAGGG + Intergenic
906696176 1:47824888-47824910 GTGAATATGCATATGTTGGAGGG - Intronic
907162844 1:52383999-52384021 TTAAATCTGCAAATGGAGGGAGG + Intronic
908187261 1:61664286-61664308 TTGACTCTGCATCTGGTGATGGG - Intergenic
908926095 1:69256882-69256904 TAGATTTTGCATATGGTAGATGG - Intergenic
910625050 1:89297632-89297654 CTGTATCTGCACATGATGGAAGG - Intergenic
910872965 1:91851899-91851921 CTGAATGTGCATATAGTGGAGGG - Intronic
911240726 1:95462949-95462971 TTGTGTCTTCACATGGTGGAAGG + Intergenic
911385112 1:97165002-97165024 TTGAATCTGTACATTGTGGCTGG - Intronic
911386140 1:97177938-97177960 CTGTATCTTCACATGGTGGAAGG + Intronic
911431942 1:97800797-97800819 TTGACTCTACAGAAGGTGGAAGG - Intronic
913346326 1:117814450-117814472 TTGTATCCTCACATGGTGGAAGG - Intergenic
915269164 1:154741117-154741139 TTGATTTTGCATATGGTGTGAGG + Intronic
918566297 1:185937349-185937371 TTGCATCAGCACATGGTGGAAGG + Intronic
920918363 1:210276941-210276963 CTGTGTCTTCATATGGTGGAAGG - Intergenic
921840364 1:219821726-219821748 TTTCATCTCCATGTGGTGGAAGG - Intronic
922978116 1:229801909-229801931 CTGAGTCTCCACATGGTGGAAGG + Intergenic
923189674 1:231608581-231608603 TTGATTTTGTATATGGTGTAAGG + Intronic
923404834 1:233649641-233649663 TTGCATCCTCATGTGGTGGAAGG + Intronic
923757378 1:236804321-236804343 CTGTATCTTCACATGGTGGAAGG - Intronic
923879697 1:238090185-238090207 TTGCTTCTGCATCTGGTGGTGGG - Intergenic
924226873 1:241929112-241929134 CTGTACCTGCAAATGGTGGAGGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1063212556 10:3894344-3894366 TGGAATCTGTTTCTGGTGGAGGG + Intergenic
1063857247 10:10269003-10269025 TTGTATCTTCACATGGTGGAAGG + Intergenic
1063860533 10:10302899-10302921 TAGAATCTGCATATGCTAAATGG + Intergenic
1064032585 10:11892480-11892502 TTGACTCTGAATATGATGGCAGG - Intergenic
1064285453 10:13987282-13987304 TCCATTCTGCATATGGGGGAAGG - Intronic
1064327094 10:14361591-14361613 TTGTATCTTCACTTGGTGGAAGG - Intronic
1067189017 10:44054303-44054325 CTGGCACTGCATATGGTGGAAGG + Intergenic
1067424423 10:46194326-46194348 TGGAGTCATCATATGGTGGAAGG + Intergenic
1068345830 10:55776594-55776616 TGGAGTCATCATATGGTGGAAGG - Intergenic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1070628142 10:78065889-78065911 TTTAATCTGCGTGTGGTGGCAGG + Intergenic
1070860843 10:79659735-79659757 TGGAGTCGTCATATGGTGGAAGG + Intergenic
1070876421 10:79815842-79815864 TGGAGTCGTCATATGGTGGAAGG - Intergenic
1071643351 10:87338018-87338040 TGGAGTCGTCATATGGTGGAAGG - Intergenic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1072839713 10:98758163-98758185 TTGATTTTTTATATGGTGGAAGG - Intronic
1072889042 10:99305236-99305258 TTGAAGCTTCATGGGGTGGAAGG + Intergenic
1074192037 10:111146462-111146484 TTGTATCTGCAAGTGCTGGATGG + Intergenic
1074953620 10:118365470-118365492 GGGAATCTGCATATGGAAGAAGG + Intergenic
1078444698 11:11395407-11395429 TTTAATCTGCATATGTAGCAGGG + Intronic
1080869235 11:36222595-36222617 TTTAATTTGCATCTGGAGGAGGG + Intronic
1080936025 11:36864592-36864614 TGGCATCTGCATGTGCTGGAAGG - Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081302602 11:41471021-41471043 TGGAAACTGCATTTGATGGAAGG - Intergenic
1081397629 11:42605646-42605668 GTGAATCTGGATATGGGGTATGG - Intergenic
1082648570 11:55758697-55758719 TTGAATCTGCATATTGTTTTAGG + Intergenic
1086538354 11:87877523-87877545 TGGATTCTGGATATGTTGGAAGG - Intergenic
1087476464 11:98641753-98641775 TTGTATCCTCACATGGTGGAAGG + Intergenic
1090031588 11:123211116-123211138 TAGAGTCTGCATATGTTGCACGG - Intergenic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1092835085 12:12479883-12479905 TTTAATTTGCATATGATGGGGGG - Intronic
1092937408 12:13376917-13376939 TTGAATCTGCAGCTGGTTCAAGG - Intronic
1093761146 12:22912850-22912872 GTGAAGCTGCATATAGTAGAAGG + Intergenic
1095503824 12:42870747-42870769 TTAAATTTGCATATGCTGGCTGG + Intergenic
1096310459 12:50516097-50516119 TTGCATCTTCACATGGTGGGAGG + Intronic
1098182601 12:67863859-67863881 CTGCATCTTCATATGGCGGAGGG + Intergenic
1098453954 12:70651334-70651356 TTGAATCTGGAGATGGGAGATGG - Intronic
1098819956 12:75214601-75214623 TTGCATCCTCAGATGGTGGAAGG + Intergenic
1098945604 12:76586054-76586076 TTGCAGCTGCATCTGGAGGAGGG + Intergenic
1099381776 12:81963356-81963378 TTTAATTTGTATATGGTGAAAGG - Intergenic
1099429402 12:82564230-82564252 TTGAATGTGAAAATGGTGGGAGG + Intergenic
1099773116 12:87089440-87089462 CTGTATCTTCACATGGTGGAAGG + Intergenic
1100700771 12:97145448-97145470 TTTAGTCTGCATGAGGTGGAGGG - Intergenic
1103300320 12:119921308-119921330 TTTTCTCTGCATAGGGTGGAAGG - Intergenic
1105649891 13:22365007-22365029 TTGAATCTACAGATTGTGGGGGG - Intergenic
1105801905 13:23912683-23912705 TTCAATCTGCATATTGTTTATGG - Intergenic
1107059250 13:36138518-36138540 TTGACTTTGCATTTGGTGTATGG - Intergenic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1108790162 13:53960549-53960571 CTGCATCAGCACATGGTGGAAGG + Intergenic
1110012221 13:70351216-70351238 TTGATTTTGTATATGGTGTAAGG + Intergenic
1111000565 13:82174481-82174503 TTGATTTTGTATATGGTGAAAGG - Intergenic
1111508364 13:89226383-89226405 TGAAATCTGAATAAGGTGGATGG + Intergenic
1111619000 13:90699513-90699535 TTAAATCTTCACGTGGTGGAAGG - Intergenic
1111809628 13:93083068-93083090 TTGATTCTCCATAATGTGGATGG - Intergenic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112251241 13:97782462-97782484 TTGTGTCTTCATATGGTGGAAGG - Intergenic
1113108881 13:106800578-106800600 ATGATTCTGCTTATGGTGTAAGG + Intergenic
1113717620 13:112524321-112524343 TTGAATCTGCAGATGTGGGGCGG + Intronic
1114208414 14:20595300-20595322 TGGAATTTACATCTGGTGGAAGG + Intronic
1114844191 14:26301192-26301214 CTGCATCTTCATGTGGTGGAAGG - Intergenic
1115917538 14:38332534-38332556 TTGAATCTTCATAGGGTTCACGG + Intergenic
1117141238 14:52792299-52792321 TGGAATCTACAGATGGTGGAGGG + Intergenic
1118511424 14:66478703-66478725 TTGAAGCAGCATATGGGGCAAGG + Intergenic
1120279023 14:82415499-82415521 TTGATTTTGTATATGGTGTAAGG + Intergenic
1121734288 14:96206948-96206970 ATGCATCCTCATATGGTGGAAGG + Intronic
1122297842 14:100715197-100715219 TTGAGTCAGTATATGATGGATGG - Intergenic
1124046789 15:26157883-26157905 TTGTATCCTCACATGGTGGAGGG + Intergenic
1126136686 15:45399494-45399516 TTGTACCTGCACATGGTGGAAGG - Intronic
1127646354 15:60963280-60963302 TAGAATGTGCAGATGGTGCAGGG + Intronic
1127801208 15:62478890-62478912 TTAATTCTGCATTTGGTGGGTGG - Intronic
1130672819 15:85927890-85927912 CTGCATCAGAATATGGTGGAGGG + Intergenic
1132582618 16:692240-692262 TAGAGTCTGGATATGTTGGAGGG + Intronic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1133563428 16:6970575-6970597 TTGTGTCTTCACATGGTGGAAGG + Intronic
1137237265 16:46626160-46626182 TGGAATGTGAAGATGGTGGAGGG + Intergenic
1140636683 16:76923218-76923240 TTGATTTTGTATATGGTGTAAGG + Intergenic
1141672372 16:85499012-85499034 TGGGACCTGCATTTGGTGGAAGG + Intergenic
1142748907 17:1975763-1975785 GTAAATCTGCAAATGGTGCAGGG - Intronic
1143991496 17:10967200-10967222 CTGCATCCGCATGTGGTGGAAGG - Intergenic
1144038563 17:11388461-11388483 TCGGATCTGCATATGTGGGACGG + Intronic
1144090966 17:11856121-11856143 TTGGATGTGCATGTGGTAGATGG - Intronic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1145408936 17:22638389-22638411 TGGAGTCATCATATGGTGGAAGG - Intergenic
1146536680 17:33658612-33658634 TTGTGTCTGCACACGGTGGAAGG + Intronic
1147497032 17:40926536-40926558 TTGAATCTGCATCTGGGTGCTGG + Intronic
1147716217 17:42510515-42510537 GTGAAGCTGCATATGCTGGTGGG - Intronic
1147836057 17:43332653-43332675 TTGAATATGGATAGGGTTGAGGG + Intergenic
1150151409 17:62811800-62811822 TTGCATCCTCATATGGTGGAAGG + Intergenic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1154336186 18:13466826-13466848 TTATATCTTCACATGGTGGAAGG + Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155776237 18:29765561-29765583 TTGTATCCTCACATGGTGGAAGG + Intergenic
1157049273 18:44141930-44141952 ATGTATCTTCACATGGTGGAAGG - Intergenic
1158229642 18:55239693-55239715 TTAAATCTGTTTATGTTGGAGGG - Intronic
1158710089 18:59829878-59829900 TTGAATTTCCATATGTTGGTGGG - Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1159674820 18:71269644-71269666 TTGAATCTGCATATTGTTTTGGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160073555 18:75650129-75650151 TTGAAGCTTCAGCTGGTGGAAGG - Intergenic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
925650257 2:6081809-6081831 TTGATTCTGCATATAATCGAGGG - Intergenic
926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG + Intergenic
926728905 2:16020003-16020025 ATGAACCTGCACAGGGTGGAAGG - Intergenic
927565536 2:24109271-24109293 TTGATTTTGTATATGGTGTAAGG - Intronic
927636555 2:24821049-24821071 GTAAATCTGCATATGGGGGGGGG - Exonic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
928707688 2:33968092-33968114 TTGCATCTTCATATGGCAGAAGG + Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929709834 2:44255712-44255734 TTGCTTCTGCTCATGGTGGAAGG + Intergenic
929862883 2:45694350-45694372 TTGGATCTGGATATGGATGATGG + Intronic
930444419 2:51451924-51451946 TTGAATTTGCATATGTTGTTGGG + Intergenic
931964009 2:67513472-67513494 TTGAATCTGCAGATGCAGTACGG - Intergenic
931998207 2:67859099-67859121 CTGAATCACCATATGGAGGATGG + Intergenic
932359290 2:71091324-71091346 CTGCATCCTCATATGGTGGAAGG - Intergenic
932784741 2:74590268-74590290 CTGTATCCTCATATGGTGGAGGG + Intronic
932937185 2:76117710-76117732 TTGATTTTGTATATGGTGTAAGG - Intergenic
934116647 2:88804161-88804183 TTCAATCTGCATATCGTTAATGG - Intergenic
934891398 2:98073348-98073370 TTGAATCTGCATATTGTTTTGGG + Intergenic
936329534 2:111535852-111535874 CTGCATCTGCTTACGGTGGAAGG + Intergenic
937871795 2:126791549-126791571 TAGAAGCTGCCTAGGGTGGATGG + Intergenic
939269266 2:139916692-139916714 CTGTATCTTCACATGGTGGAAGG - Intergenic
939434852 2:142162148-142162170 TTGATGCTGTATATGGTGTAAGG - Intergenic
940763320 2:157762483-157762505 TTGGTTCTGCAAATGGTGGAGGG - Intronic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
943441517 2:187932925-187932947 AAGAATCTGGATATGGAGGATGG + Intergenic
946045897 2:216820733-216820755 ATGTATCTTCACATGGTGGAAGG - Intergenic
947195653 2:227564233-227564255 TTGAATCTGTATTGGGTGGGTGG + Intergenic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
947993492 2:234506551-234506573 TTAAATCTGCATATGGTTGCAGG - Intergenic
1168758061 20:329503-329525 TTGAATCTGCAGATTGTGTTAGG + Exonic
1169118029 20:3079228-3079250 TTGCAACTGCTTATGGTGGGAGG - Intergenic
1169731566 20:8791557-8791579 TAGAATTTGCTTATGGTTGATGG + Intronic
1169837933 20:9901189-9901211 CTGTATCTTCACATGGTGGAAGG + Intergenic
1170671520 20:18438825-18438847 CTGTGTCTTCATATGGTGGAAGG + Intronic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1175048139 20:56126636-56126658 CTGTGTCTTCATATGGTGGAAGG - Intergenic
1175434255 20:58931534-58931556 CTGTATCTGTACATGGTGGAAGG - Intergenic
1175913019 20:62413632-62413654 TTGAGGCTGCAGCTGGTGGAGGG + Intronic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1177872506 21:26590496-26590518 TTGTGTCTTCACATGGTGGAAGG - Intergenic
1178023947 21:28443505-28443527 TTGTGTCATCATATGGTGGAAGG - Intergenic
1178189823 21:30267518-30267540 TTGTATCTTCACACGGTGGAAGG + Intergenic
1178352762 21:31884639-31884661 CTGAGTCCTCATATGGTGGAAGG - Intronic
1178441564 21:32602667-32602689 CTGGATCTACATAAGGTGGAGGG + Intronic
950758593 3:15199897-15199919 ATGAAGCTGCATCTGGTGGTAGG - Intergenic
950950322 3:16992040-16992062 TTGAATTTTCAGATGATGGAGGG + Intronic
952686241 3:36151816-36151838 CTGCATCCTCATATGGTGGAAGG + Intergenic
952806127 3:37354212-37354234 TAGACTTTGCATATGGGGGAAGG - Intronic
953211740 3:40881363-40881385 TAAAATCTGCTTATGGTGGCTGG - Intergenic
954496683 3:50971317-50971339 TTGAATTTACTTATGTTGGATGG + Intronic
954854981 3:53636087-53636109 GTGGATGTGTATATGGTGGAGGG + Intronic
957285115 3:78207839-78207861 TTGTATCCTCACATGGTGGAAGG - Intergenic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
957486846 3:80872387-80872409 TTGATTTTGTATATGGTGTAAGG - Intergenic
958063860 3:88517948-88517970 TTGATTTTGTATATGGTGAAAGG + Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
960562876 3:119104881-119104903 TTGAGAATGCATATGCTGGAGGG - Intronic
960671426 3:120158382-120158404 TCGAGTCTTCACATGGTGGAAGG - Intergenic
961750384 3:129090852-129090874 TGGAATGTGAAGATGGTGGAGGG + Exonic
962700374 3:137992651-137992673 TTGAGTCTGCAAATTGGGGAGGG + Intergenic
964663229 3:159143964-159143986 TTGTATCTTCACATGGTGGAAGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964690045 3:159440068-159440090 TTGGTTTTGCATATGGTGTAAGG + Intronic
965317238 3:167207986-167208008 GAGAATCTGCATTTGGGGGAGGG + Intergenic
965441376 3:168719294-168719316 CTGTATCCCCATATGGTGGAAGG - Intergenic
965701563 3:171463630-171463652 ATGCATCTTCATGTGGTGGAAGG - Intergenic
966634319 3:182115322-182115344 TTGAATGTGCATATGTATGAGGG - Intergenic
966828032 3:183981689-183981711 TTGTATGTGCATGTGGTAGAAGG - Intronic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
970172637 4:13305006-13305028 TTGATTCTGGATATATTGGAAGG - Intergenic
970697649 4:18696743-18696765 TGGAATTTGCATGTGGTGGAAGG + Intergenic
971095771 4:23400168-23400190 GAGAATCTGCATTTGGTGGTGGG - Intergenic
971357144 4:25905465-25905487 TTGTATCTTAACATGGTGGAAGG - Intronic
973090960 4:46135789-46135811 TTGATTTTGCATATGGTGAAAGG - Intergenic
974211262 4:58779241-58779263 TTGAATCTACATACAGAGGAAGG - Intergenic
974266613 4:59594014-59594036 TTGCATCAGCACATGGTGAAAGG - Intergenic
974439673 4:61899816-61899838 CTGAATCCTCACATGGTGGAAGG + Intronic
975033050 4:69647322-69647344 TAGAATCTCCAAATGGTTGAAGG + Exonic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
977392034 4:96423608-96423630 CTGAGTCTTTATATGGTGGAAGG - Intergenic
977807205 4:101315175-101315197 TTGTAACTTCACATGGTGGAAGG - Intronic
977956253 4:103030306-103030328 TTTAAGCTACATATGGTGTAAGG + Intronic
982069324 4:151681824-151681846 CTGTGTCTGCATGTGGTGGAAGG + Intronic
982121772 4:152150128-152150150 TTGTCTCTTCATGTGGTGGAGGG + Intergenic
984893928 4:184518512-184518534 GTTAAGCTGCATATGGTGCAAGG + Intergenic
986256355 5:6104105-6104127 TTTTGTCTTCATATGGTGGAGGG + Intergenic
986350348 5:6872325-6872347 ATTAAGCTGCATCTGGTGGAAGG - Intergenic
986496800 5:8350517-8350539 TTGCATCCTCACATGGTGGAAGG - Intergenic
987465961 5:18272344-18272366 CTGAATCCCCATGTGGTGGAAGG + Intergenic
987567180 5:19605569-19605591 TCAAATCTGGATATGATGGAGGG + Intronic
988521667 5:31951015-31951037 CTGTACCTGCACATGGTGGAAGG + Intronic
989192461 5:38684653-38684675 TTGGATCAAAATATGGTGGAAGG - Intergenic
989428607 5:41325929-41325951 TTGTGTCTTCACATGGTGGAAGG + Intronic
989447745 5:41550571-41550593 TTGATTTTGTATATGGTGTAAGG - Intergenic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
991049923 5:62261888-62261910 TGAAATCTGCATGTGGAGGACGG - Intergenic
991671352 5:69051278-69051300 TTGCATCCTCACATGGTGGAAGG - Intergenic
993446763 5:88022628-88022650 TTGTGTCTTCACATGGTGGAAGG + Intergenic
993821376 5:92621206-92621228 TTAAATCTCTATATGGTGTAAGG + Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995088776 5:108147022-108147044 TTGCATCCTCACATGGTGGAAGG + Intronic
995283526 5:110361237-110361259 CTGTTTCTGCATATGGTGAAAGG - Intronic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
996701253 5:126452248-126452270 TTGGATCCTCATGTGGTGGAAGG + Intronic
997056918 5:130454241-130454263 TTGCATCCTCATGTGGTGGAAGG - Intergenic
997089309 5:130838493-130838515 CTGAATCCTCAAATGGTGGAAGG + Intergenic
997201068 5:132010671-132010693 CTGAATCTGCACATGGGGGTTGG + Intronic
998700775 5:144696995-144697017 GTGCATCCTCATATGGTGGAAGG - Intergenic
999951306 5:156654040-156654062 GTGAATCTGCAGATAGTGAAAGG - Intronic
1003399239 6:5778403-5778425 TATAATTTGCATATGGTGAAAGG - Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1004463174 6:15858022-15858044 TGGAGTCTGCATGTGGGGGAAGG - Intergenic
1005226355 6:23647588-23647610 TTGCCTCTGCATCTGGTGGCAGG - Intergenic
1005405512 6:25483643-25483665 CTGAATCTGCATAGGATGCATGG - Intronic
1006264461 6:32907205-32907227 TTTTATCTGAATAGGGTGGATGG - Intergenic
1006278479 6:33026936-33026958 TTGTATTTGCATATGGTGTCAGG + Intergenic
1007063628 6:38966918-38966940 TTGTGTCTTCACATGGTGGAAGG + Intronic
1007190464 6:40012169-40012191 GAGAATCTGCATTTGGGGGAGGG - Intergenic
1007258867 6:40547980-40548002 TTGAAGCTGCATATTGTTCAGGG - Intronic
1007953030 6:45889253-45889275 TTGTATCCTCACATGGTGGAGGG + Intergenic
1011856833 6:91703465-91703487 TTCATTCATCATATGGTGGAAGG + Intergenic
1012023976 6:93964671-93964693 TTGAATATGCACTTGGTGAATGG - Intergenic
1012255294 6:97024306-97024328 TAGAGTCTGCACATGGTGGTGGG + Intronic
1013580838 6:111533057-111533079 TTTATTCTGTATAGGGTGGAGGG - Intergenic
1014586676 6:123205577-123205599 TTAATTCTTCATATGGTGCAAGG - Intergenic
1015744675 6:136497406-136497428 TTGCATTTGCATCTGGTGGGTGG - Intronic
1016072556 6:139757368-139757390 TTGAATCAGAATATGGAGGGTGG - Intergenic
1016797424 6:148132878-148132900 TTGTATCCTCATATAGTGGAAGG + Intergenic
1017051877 6:150400924-150400946 TTGAATGTGGATCTGGTGGTAGG + Exonic
1018643377 6:165925884-165925906 GGAAATCTGAATATGGTGGATGG + Intronic
1022419929 7:30210723-30210745 ATGAGTCTGCATAGGGAGGAAGG + Intergenic
1023570708 7:41568504-41568526 TTGTACCCTCATATGGTGGAGGG - Intergenic
1024014059 7:45295125-45295147 CTGAAGCTGCATGTGGTTGATGG + Intergenic
1024848396 7:53678614-53678636 TTGATTTTGTATATGGTGTAAGG + Intergenic
1024968888 7:55050894-55050916 GTGATTCTGCTTATGGAGGAAGG - Intronic
1026666528 7:72345276-72345298 TTGAAACTGCACATGGTGAATGG + Intronic
1027735702 7:81930494-81930516 TTGTATCTCCACATGGTGGAGGG - Intergenic
1028892269 7:96001676-96001698 TTGTGTCTTCACATGGTGGATGG + Intronic
1030531183 7:110713075-110713097 TTGATTTTGTATATGGTGAAAGG + Intronic
1031536182 7:122936117-122936139 TTGAAGCTACATAATGTGGAAGG - Intergenic
1031545201 7:123044015-123044037 TTGAACATGTATATGGTAGATGG - Intergenic
1031851659 7:126872128-126872150 TTGCATGTGCATAGGATGGAAGG + Intronic
1033490121 7:141835135-141835157 TTGAATCTTCACCTGCTGGAAGG + Intergenic
1034006993 7:147483763-147483785 GTGGTTCTGCATATGATGGAAGG - Intronic
1034586142 7:152094121-152094143 GTGATTCTGTATTTGGTGGATGG + Intronic
1034877380 7:154737510-154737532 TTTGATCTGCATTTGGTGGGAGG + Intronic
1036161497 8:6393046-6393068 ATGTATCTTCATGTGGTGGAAGG - Intergenic
1036234005 8:7022552-7022574 TTGTGTCTTCATCTGGTGGAAGG - Intergenic
1037646664 8:20798692-20798714 TTAGTTCTGCATATGGTGGAAGG - Intergenic
1038530411 8:28314013-28314035 ATGAAGCTGCATGTGGTGGCAGG - Intergenic
1038860696 8:31386295-31386317 TTGACTCTTCATTTTGTGGATGG - Intergenic
1040091098 8:43399706-43399728 TTGAATTTGTATATGGTGGAAGG + Intergenic
1040671252 8:49693325-49693347 TTGAATAAGCATATAGTGTAAGG - Intergenic
1040989785 8:53337638-53337660 TTAAAACTGGATATGGGGGAGGG + Intergenic
1041819211 8:62010480-62010502 CTGCATCTGCATTTGCTGGATGG - Intergenic
1041925457 8:63231318-63231340 TTGTATCCTCATATGGTGAAAGG + Intergenic
1042067390 8:64893217-64893239 TAGAGTATGCATATGGGGGAGGG - Intergenic
1043119474 8:76304615-76304637 TTGAAGTTTCATCTGGTGGAAGG + Intergenic
1043324979 8:79038896-79038918 TTGATTTTGGATATGGTGTAAGG - Intergenic
1043967935 8:86500008-86500030 TTGATTTTGTATATGGTGAAAGG - Intronic
1044087866 8:87963239-87963261 TCCCATCTGCATATGGTGGCAGG - Intergenic
1045573529 8:103394420-103394442 TAAAATATGCTTATGGTGGAAGG - Intergenic
1046015764 8:108603381-108603403 TTGCATCCTCACATGGTGGAGGG + Intergenic
1046852548 8:118991507-118991529 TTGAGTTTGCAAATGGTGGATGG + Intergenic
1047002786 8:120589655-120589677 TTGTATCCTCATATGGTGGAAGG + Intronic
1051109866 9:13623700-13623722 TTGAGTCTGTATATCTTGGAAGG + Intergenic
1051861212 9:21627236-21627258 TTGTATCCTCACATGGTGGAAGG - Intergenic
1054941582 9:70748643-70748665 CTGCATCTTCATGTGGTGGAGGG - Intronic
1056134600 9:83619651-83619673 TTGAATCTGTATAATTTGGAGGG + Intergenic
1056255781 9:84798167-84798189 TTGTGTCTTCATCTGGTGGAAGG + Intronic
1057415030 9:94854159-94854181 TTGCATTAGAATATGGTGGACGG + Intronic
1058827257 9:108786201-108786223 TAGAATTTGCATAAGGTGGGTGG - Intergenic
1060731727 9:126041503-126041525 CTGCATCCTCATATGGTGGAAGG - Intergenic
1062367052 9:136215454-136215476 TTAAATTTGCATATGGTAGGAGG - Intronic
1185884094 X:3766686-3766708 TTGAATTTGCATATCTTTGATGG + Intergenic
1187904885 X:24056533-24056555 TTTAATCTGGAAATGCTGGAAGG + Intronic
1187948364 X:24448225-24448247 CTGAATCCTCACATGGTGGAAGG + Intergenic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1192018153 X:67354461-67354483 CTGCATCCTCATATGGTGGAAGG + Intergenic
1192534335 X:71914299-71914321 TTGACTCAGCATATGGTGGCAGG - Intergenic
1193625588 X:83816461-83816483 TTGATTTTGTATATGGTGTAAGG + Intergenic
1193985474 X:88236155-88236177 TTGATTTTGTATATGGTGTAAGG + Intergenic
1196475222 X:116076624-116076646 TTGATTTTGTATATAGTGGAAGG - Intergenic
1197348038 X:125348211-125348233 TTGAGTTTGCATATGGTGAGGGG - Intergenic
1197748362 X:129948123-129948145 TTGGATCTGAATGTGGGGGATGG + Intergenic
1198455353 X:136812208-136812230 TTGCATCCTCACATGGTGGAAGG + Intergenic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1199949267 X:152693502-152693524 TTTAATCTCCATAATGTGGATGG - Intergenic
1199960409 X:152774947-152774969 TTTAATCTCCATAATGTGGATGG + Intergenic
1200007096 X:153094180-153094202 CTGCATCAGCATATAGTGGAAGG + Intergenic
1200288940 X:154852920-154852942 TTGAATCTGCAAATGGTTTGTGG + Intronic
1200781280 Y:7218250-7218272 TTGAATTTGCATATCTTTGATGG - Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201492271 Y:14555368-14555390 TTGTATCCTCATGTGGTGGAAGG + Intronic
1201906414 Y:19090263-19090285 TTGTATCCTCACATGGTGGAAGG - Intergenic
1202335425 Y:23804179-23804201 TTGACTTTGCATAAGGTGAAAGG - Intergenic
1202535342 Y:25865880-25865902 TTGACTTTGCATAAGGTGAAAGG + Intergenic