ID: 1112125696

View in Genome Browser
Species Human (GRCh38)
Location 13:96465256-96465278
Sequence ACAAATATGCAAAAGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 508}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112125696_1112125699 20 Left 1112125696 13:96465256-96465278 CCAGAGAACTTTTGCATATTTGT 0: 1
1: 0
2: 4
3: 25
4: 508
Right 1112125699 13:96465299-96465321 ATATTCTTAGCAACAGAATATGG 0: 1
1: 0
2: 3
3: 29
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112125696 Original CRISPR ACAAATATGCAAAAGTTCTC TGG (reversed) Intronic
900292938 1:1931902-1931924 AAAAAAATGCAAAAGTTAGCTGG + Intronic
901278601 1:8013363-8013385 ACAAATATGAAAAATTTTTTAGG - Exonic
901409827 1:9074859-9074881 ACAAATAATCAAAAATTATCTGG + Intronic
902176408 1:14654123-14654145 CCAAAAATACAAAAATTCTCTGG + Intronic
902688971 1:18097741-18097763 ACAAATATCCAAAATATATCAGG - Intergenic
902901769 1:19522015-19522037 ACAAAAATACAAAAGTTAGCTGG + Intergenic
903047785 1:20577122-20577144 ACAAAAATACAAAAGTTAACCGG + Intergenic
903083068 1:20828192-20828214 ACTAAAATGCAAAAATTATCTGG - Intronic
903476642 1:23623923-23623945 AAAAATATACAAAAATTATCTGG - Intronic
903797291 1:25939286-25939308 ACAAAAATGCAAAAATTAGCTGG - Intergenic
904092198 1:27953166-27953188 ATATATATGCAAAAGCACTCGGG - Intronic
904777735 1:32921639-32921661 ACAAAAATACAAAAATTATCTGG + Intergenic
904854327 1:33485567-33485589 AAAAATATACAAAAGTTAGCTGG - Intronic
904968588 1:34400764-34400786 ACAAAGATCCAAAAAATCTCAGG + Intergenic
905414973 1:37797630-37797652 ACAAAAATACAAAAGTTAGCTGG - Intronic
906056464 1:42922016-42922038 AAAAATATATAAAAGATCTCTGG + Intergenic
906234532 1:44197122-44197144 ACAAAAATGCAAAAATTAGCTGG + Intergenic
906445525 1:45894052-45894074 AAAAATATGTAAAAGTTAGCTGG + Intronic
907229715 1:52984999-52985021 AAAAATATGCAAAAATTAGCCGG - Intronic
908244099 1:62214008-62214030 ATAAATATGTCAAAGTGCTCAGG - Intergenic
908328810 1:63050386-63050408 ACAAAGATGCCAAAATACTCAGG - Intergenic
908343966 1:63212425-63212447 ATTAATATAAAAAAGTTCTCTGG - Intergenic
908732149 1:67237202-67237224 ACAAAAATGCAAAAATTAGCTGG - Intronic
909224565 1:73001637-73001659 GCAAGTATGCAAAGGTTTTCAGG + Intergenic
909721030 1:78769707-78769729 ACAAATACACAAAAGTTAGCTGG - Intergenic
909777238 1:79496955-79496977 ACAAATAGACAACAGCTCTCTGG - Intergenic
910373681 1:86546075-86546097 ACAAATATACAAAAATTAGCCGG + Intergenic
911004926 1:93209897-93209919 ACAAAAATGCAAAAATTAGCTGG + Intronic
911459282 1:98169090-98169112 ACAAATATGTATTAGTTTTCTGG - Intergenic
912563689 1:110569339-110569361 ACAAAAATACAAAAATTATCCGG - Intergenic
914729434 1:150357683-150357705 AAAAATATGCAAAACTTAGCTGG - Intergenic
915197852 1:154203419-154203441 ATATATATGCAAAAGTTACCTGG - Intronic
915258145 1:154651530-154651552 ACAAAAATGCAAAAATTAGCTGG - Intergenic
915375085 1:155387133-155387155 ACAAAAATGCAAAAATTAGCTGG - Intronic
916304777 1:163318145-163318167 ACAAGAATGCAAAAGGTCTCAGG + Intronic
916760024 1:167807226-167807248 AAAAAAATGCAAAAGTTAACTGG - Intergenic
917427339 1:174928663-174928685 ACAAATTTGCAAAAGATTGCAGG - Intronic
917764219 1:178199477-178199499 ACATATATAAAAAAGTTCACAGG + Intronic
918018499 1:180661711-180661733 AAAAATATGCAAAAATTAGCTGG + Intronic
919297419 1:195720806-195720828 ACAAATATACAAAAATTAACCGG + Intergenic
920058280 1:203208862-203208884 ACAAATAAACAAAAGTTATATGG + Intergenic
920178091 1:204115826-204115848 ACAAAAATGCAAAAATTAGCCGG - Intronic
921677482 1:217992156-217992178 AAAAAAATGCAAAAGTTAGCCGG + Intergenic
922149722 1:222988813-222988835 ACAAAAATGCAAAAATTAACTGG - Intronic
922253890 1:223874783-223874805 ACAAAAATACAAAAATTATCTGG + Intergenic
922311768 1:224400206-224400228 ACAAAGATTGAAAAGTACTCTGG + Intronic
922740743 1:228013038-228013060 ACAAATATACAAAAATTAGCTGG - Intronic
922776741 1:228217854-228217876 ACAGAGAAGCAAATGTTCTCTGG - Intronic
922895638 1:229097846-229097868 ACACGTATGCAAAAGTTGTTCGG - Intergenic
924005415 1:239604713-239604735 GAAAATATCTAAAAGTTCTCAGG - Intronic
924509975 1:244722256-244722278 AAAAAAATGCAAAAGTTAGCTGG - Intergenic
1062873729 10:929640-929662 ACAAACATGGAAATGTTGTCTGG - Intronic
1063986116 10:11504705-11504727 ACAAACATGAAAAAGATCTGTGG + Intronic
1064138393 10:12770000-12770022 CCAACTGTGCAAAAGTTTTCAGG - Intronic
1064431642 10:15276340-15276362 CCAAAAATGCAAAAATTATCTGG - Intronic
1064463505 10:15557216-15557238 ACAAAAATGCAAAAATTAGCTGG + Intronic
1064743716 10:18458925-18458947 ACAAAAATGCAAAAATTAGCTGG - Intronic
1065048017 10:21761395-21761417 ACAAAAATGCAAAAATTAGCCGG + Intronic
1065419891 10:25531461-25531483 ACAAATCTGAAAAAGTTTTATGG + Intronic
1065420512 10:25538761-25538783 AAAAATATGGGAAAGCTCTCAGG - Intronic
1065723073 10:28644518-28644540 ACAAATAGGCAAAAATTAGCCGG - Intergenic
1066014539 10:31227202-31227224 AAAAATATGCAAGACTTCTATGG - Intergenic
1067781601 10:49211518-49211540 ACCAATGTGAAATAGTTCTCAGG + Intergenic
1068032191 10:51717668-51717690 AAAAATATGAAAAAGTTAGCCGG + Intronic
1068370110 10:56102351-56102373 ACAAAAATGCAAAAATTACCCGG - Intergenic
1068736012 10:60414374-60414396 AGGAATATACAAAATTTCTCAGG + Intronic
1069033868 10:63628373-63628395 AACAATATGCAAAAGTACTTGGG + Intergenic
1069261830 10:66407873-66407895 AAAAATATGTAAAAGTTGGCCGG - Intronic
1069297975 10:66870927-66870949 ACCACTATGCAAAAGTTCAAGGG + Intronic
1070413602 10:76168171-76168193 ACAAGTCAGCAAAAGTTCTATGG - Intronic
1070595519 10:77830259-77830281 ACAAATATGCCACAGTCCCCCGG + Exonic
1070655949 10:78271362-78271384 ACAAATATACAAAAATTAGCTGG + Intergenic
1071557208 10:86613833-86613855 ACAAAAATGCAAAATTTAGCTGG - Intergenic
1072163499 10:92789645-92789667 ACAAAAATGCAAAAATTAGCCGG - Intergenic
1072655041 10:97324076-97324098 ACAAATATACAAAAATTAGCTGG - Intergenic
1073284335 10:102378464-102378486 ATAAAAATGCAAAAATTATCTGG + Intronic
1073402371 10:103268895-103268917 AAAAATAGGCAAATGTTCTTAGG - Intergenic
1074223288 10:111459481-111459503 AGAAAAATGCAAATGTTCACTGG + Intergenic
1074609543 10:115008138-115008160 GAAATTATGCTAAAGTTCTCAGG - Intergenic
1074911333 10:117912069-117912091 AAAAATATGAAAAAGTTATAGGG - Intergenic
1075056770 10:119224569-119224591 AAAAAAATGCAAAAGTTAGCCGG - Intronic
1076289076 10:129330245-129330267 CCAAATATTCACAAGTACTCAGG + Intergenic
1077133192 11:985143-985165 ACAAAAACGCAAAAGTTAGCCGG - Intronic
1077294397 11:1818568-1818590 ACAAATATCCTAAAGTGCACAGG + Intergenic
1077624717 11:3760387-3760409 GGAAATATTTAAAAGTTCTCAGG - Intronic
1078697644 11:13650488-13650510 ACAAATAAGCAAAATTAGTCAGG - Intergenic
1079387245 11:19991285-19991307 ACAAAAATGCAAAAATTAGCCGG - Intronic
1079431221 11:20389987-20390009 ACTAAAATACAAAAGTTATCTGG + Intronic
1079869291 11:25776467-25776489 TCAAATATGTAAAAGATCTCTGG - Intergenic
1080201666 11:29678485-29678507 ACAAAGAGTCCAAAGTTCTCAGG + Intergenic
1081106521 11:39077214-39077236 ATATAGATGCAAAAATTCTCAGG + Intergenic
1081716592 11:45254952-45254974 AAAAATAAGCAAAAATTATCTGG + Intronic
1084101492 11:66952557-66952579 ACAAGACTGAAAAAGTTCTCTGG - Intronic
1085174567 11:74474681-74474703 ACAAATATGCATAACATCTGAGG - Intergenic
1085591290 11:77763797-77763819 CCATATATGCAAAAATTCTGAGG + Intronic
1085635190 11:78153632-78153654 ACAAATATACAAAAATTAGCTGG - Intergenic
1086694072 11:89823297-89823319 ACAAAGAAGCTTAAGTTCTCAGG - Intergenic
1086712075 11:90021272-90021294 ACAAAGAAGCTTAAGTTCTCAGG + Intergenic
1087714578 11:101593872-101593894 GCAAATTAGCAAAACTTCTCAGG - Intronic
1089038683 11:115424686-115424708 ACAAAAATGCAAAAATTAGCTGG - Intronic
1089224581 11:116906741-116906763 ACAAATAAACAAAAATTCTGAGG - Intronic
1092870469 12:12801446-12801468 CTAAAAATGCAAAAGTTATCTGG + Intronic
1094420980 12:30271071-30271093 ACAAACATGCAAGAGATATCTGG - Intergenic
1094611460 12:31999264-31999286 ACAAAAATACAAAAGTTAACTGG + Intergenic
1095123342 12:38444260-38444282 TCAAATATGCAAATGTGCTGAGG + Intergenic
1095262156 12:40109179-40109201 ACAAATATCCAAACTATCTCAGG - Intergenic
1096286922 12:50308368-50308390 AAAAATATGAAAAAATTATCTGG - Intergenic
1096305070 12:50467450-50467472 ACAAAAATACAAAAGTTAGCTGG - Intronic
1096353164 12:50916992-50917014 ACAAAGATACAAAAATTCACTGG - Intergenic
1096426299 12:51506594-51506616 ATAAAAATGCAAAAGTTATCTGG - Intronic
1098867966 12:75783997-75784019 GCAAATATGTAAAAGTCCTGGGG + Intergenic
1099650571 12:85422541-85422563 TGAAATATGCAAAAGTACTGTGG - Intergenic
1100181711 12:92093231-92093253 ACAAAAATGCAAAAATTATCTGG - Intronic
1100220455 12:92499359-92499381 ACAAATAAGCAAATATTCTTAGG - Intergenic
1101190394 12:102326566-102326588 AGAAACATGTCAAAGTTCTCAGG + Intergenic
1101359549 12:104013502-104013524 ACATATATACAAATGTTCTTAGG - Intronic
1101933867 12:109039770-109039792 CCAAAAATGCAAAAATTCACTGG - Intronic
1102416690 12:112768748-112768770 ACAAAAATACAAAAGTTAGCTGG + Intronic
1102840161 12:116111161-116111183 ACAAATATGCAAATGATTTAGGG + Intronic
1103137501 12:118520134-118520156 CTAAAAATACAAAAGTTCTCTGG - Intergenic
1103367885 12:120396470-120396492 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1103423309 12:120808237-120808259 CCAAATATGCAAAAATTAGCTGG - Intronic
1103582709 12:121927457-121927479 ACAAAAATACAAAAGTTAGCTGG - Intronic
1104168460 12:126256856-126256878 ACAAAAATGCAAAAATTAGCCGG - Intergenic
1104448165 12:128849392-128849414 CCAAATTTCCAAAAGTCCTCTGG + Intergenic
1104956955 12:132471550-132471572 ACAAATATAAAAAAATTATCTGG - Intergenic
1106056567 13:26243347-26243369 ACAAAGATGAACAAGTTCTGAGG + Intergenic
1106199994 13:27528166-27528188 ACAAATATGCAAACTATATCAGG - Intergenic
1106444948 13:29820336-29820358 ACAAAAATGCAAAAATTAGCTGG - Intronic
1106543623 13:30712445-30712467 ACAAATATACAAAAATTAGCTGG - Intergenic
1106634415 13:31511738-31511760 ACAAATATGGAAAATTTCTGGGG - Intergenic
1107047072 13:36004735-36004757 AAAAAAATGCAAAAATTATCTGG - Intronic
1107179560 13:37443150-37443172 ACAATCATGCAAAACTTCCCAGG + Intergenic
1107218792 13:37954717-37954739 ACAAAAATACAAAAGTTAGCTGG + Intergenic
1108476777 13:50827522-50827544 AAAAAAATGCAAAAATTATCTGG + Intronic
1108698873 13:52926780-52926802 CCAAATATACAAAAATTATCCGG + Intergenic
1108781392 13:53840419-53840441 AAAAATATCCAAAAGTATTCAGG + Intergenic
1108873442 13:55015466-55015488 AAAAAAATGCAAAAATTATCTGG + Intergenic
1109929193 13:69191664-69191686 ACAACTATTCTAAAGTTCTAAGG - Intergenic
1110819704 13:79900310-79900332 ACAAATATGTTATAGTTCTTAGG - Intergenic
1110942638 13:81369261-81369283 GGAAATATGCTTAAGTTCTCTGG + Intergenic
1111453637 13:88451730-88451752 ACAAAAATACAAAATTTATCCGG + Intergenic
1111796486 13:92927221-92927243 AAAAAAATGCAAAAGTTAGCTGG + Intergenic
1112125696 13:96465256-96465278 ACAAATATGCAAAAGTTCTCTGG - Intronic
1112785392 13:102945921-102945943 TAATATATGCAAAAGATCTCTGG - Intergenic
1113110953 13:106822938-106822960 ACATAAATGCAAGAGTTCTATGG - Intergenic
1113802069 13:113091854-113091876 AAAAATTTGCAAAGGTTCCCAGG + Intronic
1114017476 14:18444282-18444304 ACAAACATTCAGAAGTTCTTAGG + Intergenic
1114018875 14:18458404-18458426 AGAAATCTGCAACAGTGCTCTGG + Intergenic
1115195839 14:30798462-30798484 ACAAATAGGCAAAACCTGTCAGG - Intergenic
1115314225 14:32009316-32009338 AAATATTTGTAAAAGTTCTCTGG - Intronic
1116088819 14:40277748-40277770 ACAAATAAGCCAAAGTACACAGG - Intergenic
1116414365 14:44662776-44662798 ACAAATAAGGGAAAGTTTTCTGG + Intergenic
1117702896 14:58432876-58432898 ACAAATATACAAAAATTAGCTGG - Intronic
1117982914 14:61359436-61359458 TAAAATATGAAAATGTTCTCTGG - Intronic
1118147836 14:63159242-63159264 ACTTATAAGCAAAAGTTTTCTGG - Intergenic
1118194992 14:63616920-63616942 ACAAATATGAAAGAATTTTCTGG + Intronic
1118211935 14:63773359-63773381 CAAAATATACAAAAATTCTCAGG - Intergenic
1119112300 14:71986546-71986568 AAAAAAATACAAAAGTTGTCTGG + Intronic
1119570289 14:75664383-75664405 ACACATATCCAAAAGGACTCAGG - Intronic
1119969500 14:78953615-78953637 ATAAAGATGCAAAAGATTTCTGG - Intronic
1120565738 14:86054070-86054092 ACAAATATCAAATTGTTCTCAGG - Intergenic
1120603413 14:86541058-86541080 AAAAATATGCAATATTTGTCTGG + Intergenic
1120743406 14:88132256-88132278 ACAAATATGTAAAAGGTTCCAGG - Intergenic
1120853183 14:89189159-89189181 TCAAATATCCTAAAGTTGTCAGG + Intronic
1124839236 15:33226408-33226430 ACAAATATGAAAAAATAATCAGG + Intergenic
1125830195 15:42710218-42710240 ACAAAAATACAAAAGTACCCGGG - Intronic
1126577725 15:50212895-50212917 ACAAAAAAACAAAAGTTCACAGG + Intronic
1127366476 15:58295188-58295210 CCAAATGAACAAAAGTTCTCAGG - Intronic
1128269852 15:66299379-66299401 ACAAAAATCCAAAAATTATCTGG + Intronic
1128406024 15:67339986-67340008 CCAAATATCCTAAAGTTCTTAGG + Intronic
1128811187 15:70574003-70574025 GCAAACGTGCAAATGTTCTCAGG + Intergenic
1128996561 15:72301151-72301173 AAAAATATGCAAAAATTAGCTGG - Intronic
1129060560 15:72857384-72857406 ACAAACATGCACACGTGCTCTGG + Intergenic
1129449791 15:75644775-75644797 ACAAAAATACAAAAGTTGGCTGG + Intronic
1130401854 15:83563798-83563820 ACAAAAATGCAAAAATTAGCCGG - Intronic
1133068506 16:3228654-3228676 AAAAATATACAAAAGTTAGCTGG - Intronic
1135084521 16:19464260-19464282 ACAAAAATGCAAAAATTAGCAGG + Intronic
1135651067 16:24207090-24207112 ACAAAAATTTAAAACTTCTCAGG - Intronic
1135962609 16:27010273-27010295 ACAAAAATACAAAAATTATCCGG + Intergenic
1137038155 16:35585006-35585028 ACAAACATGCACATGTACTCTGG + Intergenic
1138447870 16:57076073-57076095 AAAAATATACAAAAATTATCTGG - Intronic
1138623742 16:58232558-58232580 ACAAAAATGCAAAATTTAGCTGG + Intronic
1139151266 16:64384756-64384778 AGTAGCATGCAAAAGTTCTCTGG + Intergenic
1139156461 16:64448868-64448890 ACAAATATGAACCAGTTTTCTGG + Intergenic
1140911346 16:79455854-79455876 ACAAAAATACAAAAGTTAGCCGG + Intergenic
1141192803 16:81836577-81836599 ACAAAAATACAAAAGTTAGCCGG + Intronic
1141369775 16:83476182-83476204 ACAAATATGAAAATGTTCAAAGG - Intronic
1141452636 16:84116145-84116167 ACAAATAGGCCAAGATTCTCAGG + Intronic
1141539403 16:84707914-84707936 ACAAAAATACAAAAATTCACTGG + Intronic
1141731497 16:85825817-85825839 TCAAATAAGCAAAAGTTCCAGGG - Intergenic
1142336542 16:89492940-89492962 AAAAATATGCAAAAATTAGCTGG + Intronic
1142689638 17:1597635-1597657 ACAAAAATGCAAAAATTAGCTGG + Intronic
1144192693 17:12861016-12861038 ACAAAAATACAAAAGTTAGCTGG - Intronic
1144499474 17:15772448-15772470 ACATATATGAAAATGGTCTCAGG + Intergenic
1144872331 17:18378916-18378938 AAAAATATACAAAAATTATCTGG + Intronic
1144873539 17:18384568-18384590 AAAAATATACAAAAATTATCTGG + Intronic
1145162856 17:20587466-20587488 ACATATATGAAAATGGTCTCAGG + Intergenic
1146033527 17:29386985-29387007 ACACACATGCTAGAGTTCTCTGG - Intergenic
1147112041 17:38270348-38270370 AAAAATATGCAATAGTTTGCCGG + Intergenic
1147361802 17:39935489-39935511 ACAAAAATACAAAAGTTAGCTGG + Intergenic
1148417534 17:47518453-47518475 AAAAATATGCAATAGTTTGCCGG - Intergenic
1148989592 17:51653936-51653958 ACATATTTGCAAATGTTTTCTGG + Intronic
1149412317 17:56421069-56421091 ACAAAAATGAAAATGGTCTCAGG + Intronic
1149763917 17:59259018-59259040 AAAAATAGGCACATGTTCTCAGG - Intronic
1151442980 17:74145625-74145647 ACACAAATGCAAAGGTTCCCAGG - Intergenic
1151748935 17:76026101-76026123 AAAAATATACAAAAATTATCTGG - Intronic
1152644831 17:81463929-81463951 GCAAATATGCAAAAGCCCACAGG + Exonic
1152982128 18:288674-288696 AAACATATGCAAAAGTTATTAGG - Intergenic
1153399769 18:4670660-4670682 ACACAAATGCAAAAATACTCAGG + Intergenic
1153652462 18:7253205-7253227 AAAAATATGAAAAAATTATCCGG + Intergenic
1153678960 18:7481997-7482019 ACACAAATGCAAATGTTCTAAGG + Intergenic
1153762359 18:8344059-8344081 ACAACTATGTAAAAGTTTCCTGG - Intronic
1154521861 18:15238712-15238734 AGAAATATGCAGCAGTGCTCTGG - Intergenic
1154989086 18:21583027-21583049 ACAAATATACAAAAATTAGCGGG + Intronic
1156212784 18:34964599-34964621 ACAAAAATACAAAAATTATCTGG + Intergenic
1156266247 18:35490920-35490942 ACAAAAATACAAAAGTTAGCTGG - Intronic
1157481849 18:48060266-48060288 ACAAATATGCTACAGTTCTCTGG + Intronic
1157834829 18:50891067-50891089 ACAAATATTAAAAATATCTCAGG + Intronic
1158233511 18:55285945-55285967 AGAAATATGCAATAGTACTCAGG - Intronic
1158758807 18:60359492-60359514 ACAAAAATGGTACAGTTCTCTGG - Intergenic
1158773585 18:60551648-60551670 AGAAATCTGCATAAATTCTCTGG + Intergenic
1158970842 18:62665020-62665042 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1159042461 18:63337498-63337520 GTAAATAAACAAAAGTTCTCTGG + Intronic
1159068861 18:63600194-63600216 ACAAAAATACAAAAATTATCTGG - Intronic
1159522024 18:69538541-69538563 CCAAAAATGCAAAAGTTAGCTGG - Intronic
1159700233 18:71617327-71617349 AAAAAAATGCAAAAGTTAGCCGG - Intergenic
1161952290 19:7474538-7474560 ACAAAAATGCAAAAATTAGCCGG - Intergenic
1162203861 19:9041067-9041089 ACAAAAATACAAAAATTATCTGG + Intergenic
1162559481 19:11407846-11407868 ACAAAAATACAAAAGTTAGCTGG - Intronic
1163088724 19:15003138-15003160 ACAAAAATGCAAAAATTAGCTGG - Intronic
1163608272 19:18287665-18287687 ACAAAAATAAAAAAGTTCGCTGG + Intergenic
1164030088 19:21396077-21396099 ACAAAAATACAAAAATTATCTGG - Intergenic
1164651869 19:29896417-29896439 ACAAAAATACAAAAGTTAGCTGG + Intergenic
1164745297 19:30608059-30608081 ACAAATACGCAAAAGATATTTGG - Intronic
1165416874 19:35699895-35699917 CCAAAAATACAAAAGTTATCTGG - Intergenic
1165525410 19:36350437-36350459 AAAAAAATACAAAAGTTCACTGG + Intronic
1166627872 19:44376809-44376831 ACAAAAATGCAAAAATTAGCTGG + Intronic
1167657103 19:50772012-50772034 AAAAATATACAAAAATTATCTGG - Intergenic
1167657486 19:50774845-50774867 ACAAAAATACAAAAGTTAGCTGG - Intergenic
1167759323 19:51434992-51435014 CCAAAAATGCAAAAGTTAGCTGG - Intergenic
1168040809 19:53757147-53757169 ATAAAAATGCAAAAGTTAGCTGG - Intergenic
925653823 2:6123249-6123271 ACACATCTGTTAAAGTTCTCAGG - Intergenic
926770425 2:16368191-16368213 AGAAATAACCAAAAGGTCTCAGG + Intergenic
926846381 2:17145612-17145634 AAACATATGCAAAGGTTCTGGGG + Intergenic
927010577 2:18899516-18899538 ACAAATATACAAGGGTTTTCTGG + Intergenic
927013890 2:18935459-18935481 ACAAATACACAAAATTTCTTAGG - Intergenic
927178424 2:20426559-20426581 AAAAATATACAAAAATTATCTGG - Intergenic
927690542 2:25204842-25204864 CCAAGTGAGCAAAAGTTCTCTGG - Intergenic
927690783 2:25206704-25206726 AAAAATATACAAAAATTCTCTGG + Intergenic
928774170 2:34738644-34738666 AAAAATATGCAAAAGATCAGTGG + Intergenic
929051497 2:37840695-37840717 ACCAATATGCAAAAGGAGTCAGG - Intergenic
929581398 2:43083718-43083740 ACAGATATGCACAAGGTCCCTGG - Intergenic
929768803 2:44874101-44874123 GCAGATATGCATGAGTTCTCTGG + Intergenic
929971391 2:46580269-46580291 ACAAAAGTACAAAGGTTCTCAGG - Intronic
931146747 2:59527579-59527601 ACAAAGATGCAAAAGATCACAGG - Intergenic
931238386 2:60431342-60431364 TCAATTATGAAAAAGTTTTCAGG + Intergenic
932001041 2:67885165-67885187 ATATATATGAGAAAGTTCTCTGG + Intergenic
932038326 2:68271103-68271125 AAAAAAATGCAAAAGTTAGCTGG - Intergenic
932082664 2:68729698-68729720 ACAAACATGAAAAAGTTCTACGG - Intronic
932333119 2:70911692-70911714 ATAAATATGAAAAAATACTCGGG - Intronic
932550820 2:72767466-72767488 ACACATACACAAAAGTTCTTGGG - Intronic
932766835 2:74475820-74475842 ACAACTATGCAACAATTCTGGGG - Intronic
933024183 2:77233957-77233979 ACAAAAATGCAAAAATTTGCGGG - Intronic
933164356 2:79059516-79059538 AGTAATATGCAAAAGATCCCAGG - Intergenic
935411589 2:102770287-102770309 CCAATGATGCAAAAGTTCTTGGG + Intronic
935555599 2:104506625-104506647 ACAAATATACAAAAATTAGCTGG - Intergenic
937358892 2:121215336-121215358 ACAAAAATACAAAAGTTAGCCGG + Intergenic
937551461 2:123097522-123097544 ACAAATAAACAAAAACTCTCTGG - Intergenic
937944725 2:127322564-127322586 ACAAAGATGCAGAAGTTCACAGG + Intronic
938521227 2:132072442-132072464 AGAAATATGCAGCAGTGCTCTGG - Intergenic
938656518 2:133440264-133440286 ACAAATGTGGAAACGTACTCAGG - Intronic
939726233 2:145724750-145724772 AAAAAAATGCAAAAATTCACTGG - Intergenic
940690039 2:156905131-156905153 AGAAATACGCAAAAGTTTCCTGG + Intergenic
940931479 2:159437304-159437326 ACAAAGATGAGAAAATTCTCTGG + Intronic
941575537 2:167225542-167225564 AAAAAAAAGCAACAGTTCTCTGG - Intronic
941723180 2:168833987-168834009 AAAAGTATGCAGGAGTTCTCCGG + Intronic
941814184 2:169784142-169784164 ACAAATATGTAAGAGTTCCCTGG + Intergenic
943023225 2:182599525-182599547 AAACATATCCACAAGTTCTCTGG - Intergenic
943059855 2:183030480-183030502 AAAAATATGAACAAGATCTCAGG + Intronic
943835030 2:192507511-192507533 AAAAATAGGCAAATGGTCTCAGG + Intergenic
944703960 2:202270319-202270341 ACAAATGTGAAAAAGCTCTTCGG - Intronic
945219832 2:207472295-207472317 ACAAAAATGCAAAAATTAGCCGG - Intergenic
946288055 2:218720510-218720532 ACAAAAATACAAAAATTATCCGG + Intronic
946303040 2:218836397-218836419 TCAAATATGCACTATTTCTCAGG - Intergenic
947272005 2:228347020-228347042 ACAAAAATACAAAAATTATCGGG + Intergenic
947434953 2:230065415-230065437 ACAAAAATACAAAAATTATCTGG - Intronic
1169536014 20:6541307-6541329 ACAAATAAGCAAAAATCCTTGGG + Intergenic
1169698673 20:8421671-8421693 ACAAGTATGCAAAGGTTTTAGGG - Intronic
1169923883 20:10762816-10762838 ACATATATGTAACAGTTCTTGGG + Intergenic
1170929695 20:20757924-20757946 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1171980675 20:31626358-31626380 ACTAAAATGCAAAAGTTAGCTGG + Intergenic
1172248789 20:33464431-33464453 CCAAAAATACAAAAGTTATCTGG + Intergenic
1172424741 20:34847927-34847949 ACAAAAATGCAAAAATTAGCTGG + Intronic
1172714515 20:36952780-36952802 ACAAATATTGTAAAGTTCTAAGG + Intergenic
1173019747 20:39257254-39257276 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1173019762 20:39257377-39257399 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1173191830 20:40882755-40882777 ACAAAAATGCAAAAATTAGCAGG - Intergenic
1173528869 20:43753179-43753201 ACTAAAATGCAAAAGTTAGCTGG - Intergenic
1173960120 20:47064435-47064457 ACTTGTATGCAAAAGTTCACAGG - Intronic
1174043300 20:47715078-47715100 AAAAAAATACAAAAGTTATCTGG - Intronic
1174511046 20:51052837-51052859 CTAAATATGCAAAAGTTAGCTGG - Intergenic
1175046528 20:56111618-56111640 TCATATAGGCAAAAGTTCTTTGG + Intergenic
1175155759 20:56970361-56970383 ACAAAGATACAAAAGTTAGCCGG - Intergenic
1175610860 20:60349997-60350019 ACAAATATACAAAAATTTCCTGG - Intergenic
1175662015 20:60821538-60821560 ACACAGATGCAAAAGTGCACAGG + Intergenic
1176274156 20:64254465-64254487 ACAAATAACCACAAGCTCTCAGG + Intergenic
1176335100 21:5589409-5589431 AGAAGTATGAAAAAATTCTCAGG - Intergenic
1176392657 21:6231539-6231561 AGAAGTATGAAAAAATTCTCAGG + Intergenic
1176468762 21:7084635-7084657 AGAAGTATGAAAAAATTCTCAGG - Intronic
1176492323 21:7466413-7466435 AGAAGTATGAAAAAATTCTCAGG - Intergenic
1176508319 21:7671970-7671992 AGAAGTATGAAAAAATTCTCAGG + Intergenic
1177483176 21:21720445-21720467 ACAAAAATGCAAAAATTTGCTGG - Intergenic
1177968117 21:27754803-27754825 ACAGAAATGCAAAAGATCACTGG - Intergenic
1178155956 21:29854401-29854423 ACAAATATCCAAATGATATCAGG + Intronic
1178301071 21:31453529-31453551 ACAAAAATGCAAAAATTAGCCGG + Intronic
1178319436 21:31594094-31594116 ACAAAAATACAAAAGTTAGCCGG - Intergenic
1179018629 21:37617378-37617400 AAAAATATGAAAAAGTTAGCTGG - Exonic
1180441981 22:15375151-15375173 ACAAACATTCAGAAGTTCTTAGG + Intergenic
1180443375 22:15389227-15389249 AGAAATCTGCAACAGTGCTCTGG + Intergenic
1180523086 22:16228458-16228480 AGAAATATGCAGCAGTGCTCTGG + Intergenic
1180688659 22:17691284-17691306 ACAAAAATGTAAAAGTTATCTGG + Intronic
1181554695 22:23662054-23662076 ACAAAAATACAAAAGTTATCTGG + Intergenic
1182337141 22:29591579-29591601 ACAAAAATGCAAAAATTGCCGGG + Intergenic
1184038720 22:41930996-41931018 ACTAAAATGCAAAAGTTAGCTGG - Intergenic
1184079146 22:42205931-42205953 AAAAATATGCAAAAATTAGCTGG - Intronic
1184216873 22:43073516-43073538 ACAAAAATACAAAAATTATCTGG - Intronic
1184546668 22:45174337-45174359 ACAAAAATGCAAAAATTAGCTGG - Intronic
950022581 3:9798424-9798446 AAAAATATGCAAAAATAGTCAGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950651897 3:14412515-14412537 AAAAAAATGCAAAAATTCGCCGG + Intronic
950681215 3:14586263-14586285 ACAAATAAGTAAGAGTTCACTGG - Intergenic
951333490 3:21393471-21393493 AGAAAGAGGAAAAAGTTCTCAGG - Intergenic
951390608 3:22098863-22098885 ACAATTAGGCAAAAGCTCCCTGG + Intronic
951870046 3:27351623-27351645 ATAAAAATGCTATAGTTCTCTGG + Intronic
952832905 3:37579941-37579963 ATAATTATGTAAAAGCTCTCTGG - Intronic
953220386 3:40965434-40965456 ACATATATGCAAAAATTCTCAGG - Intergenic
953649199 3:44784891-44784913 ACAAATATTCAAAACTTCGTGGG - Exonic
954182746 3:48894420-48894442 AAAAAAATGCAAAAGTTACCTGG - Intronic
954318630 3:49815539-49815561 ACAAAAATACAAAAGTTAGCCGG - Intergenic
954343384 3:49974213-49974235 ATAAATATTTAAAAATTCTCAGG - Intronic
954844361 3:53542608-53542630 ATAAATATTCAAGAATTCTCAGG + Intronic
955490101 3:59473233-59473255 CCAAAAATGCAAAAATTCACCGG - Intergenic
955725202 3:61925579-61925601 ACAAAAATGCAAAAATTAGCCGG + Intronic
957235376 3:77582261-77582283 ACAAAGATACAAAAGTTAGCCGG - Intronic
957508007 3:81150878-81150900 ACAAGCATGCCAAAGTTTTCAGG + Intergenic
957673550 3:83337698-83337720 ACAAAAATACAAAAGTTAGCTGG + Intergenic
958656945 3:97014482-97014504 ATAAATATGCAAAACTTATTTGG + Intronic
958725737 3:97904012-97904034 ACAAATATACAAAACAACTCAGG - Intronic
959348271 3:105227228-105227250 ACAAAGAAGCAAAAGTTTTCTGG + Intergenic
959424737 3:106172825-106172847 ACATTTATGCAAGAGTACTCTGG + Intergenic
959515577 3:107263079-107263101 ACAGAAATGCAAAAGATCTGTGG + Intergenic
960373399 3:116868750-116868772 ACTAATATACAAAAGTTAGCTGG + Intronic
962632082 3:137288220-137288242 ACAAATAAGCTAAATTGCTCTGG - Intergenic
963657845 3:148081734-148081756 ACAAATATGTAAAAGTAGTTTGG - Intergenic
964223828 3:154374334-154374356 ACAAAAATACAAAAATTATCTGG - Intronic
966310212 3:178585720-178585742 ATAAAAATGCAAAACTACTCAGG - Intronic
966491690 3:180534423-180534445 ACAAATATACAAAAATTAGCAGG + Intergenic
966511144 3:180765042-180765064 ACAAATATGCAAAAATTGTCAGG + Intronic
967424554 3:189311646-189311668 AGAATTATGCAAATGTCCTCAGG + Intronic
968618883 4:1594678-1594700 GCAAAAATGCAAAAGTTAGCCGG + Intergenic
968874729 4:3260103-3260125 TCACATAAGCAAAAGTTCTTTGG - Intronic
969354144 4:6615237-6615259 ATAAAAATAGAAAAGTTCTCTGG + Intronic
969595462 4:8146889-8146911 GCACATAAGCAAAAGCTCTCTGG + Intronic
970635103 4:18000971-18000993 ACAAATATGCAAAAGCCCACAGG + Intronic
970997380 4:22282909-22282931 AGAAATTTGCATAAGTTATCAGG + Intergenic
971089330 4:23322133-23322155 ACATATATTCAAAAGTTCACAGG + Intergenic
973077445 4:45947215-45947237 CTAAATATACAAAACTTCTCCGG + Intergenic
973745720 4:53961272-53961294 CGAAAAATGCAAATGTTCTCAGG + Intronic
974492984 4:62590602-62590624 AAAAATATGCAAAAATAATCAGG + Intergenic
974887799 4:67841901-67841923 AATAATATGCAATAGTTCTTTGG - Intronic
975080694 4:70276438-70276460 AAAAATATACAAAAGTTTACTGG - Intergenic
975541806 4:75520403-75520425 ATAAATTTGCAAAAGTACTTTGG - Intronic
975551066 4:75612961-75612983 AAAAATATAAAAAAATTCTCCGG + Intronic
975880976 4:78907542-78907564 CCAACTATGCAAAAGTACTTTGG - Intronic
976196252 4:82535049-82535071 AAAAAGATGCAGCAGTTCTCTGG - Intronic
977504171 4:97880717-97880739 GCAAAAATGCAAAAATGCTCAGG - Intronic
977602468 4:98948972-98948994 ACAAAAATGCAAAAATTAGCCGG + Intergenic
979361248 4:119767357-119767379 ACACATAAGCAAAAGCTCTTTGG - Intergenic
979792963 4:124809254-124809276 ACAATTATGTAAAATTTATCAGG - Intergenic
979912540 4:126386770-126386792 ACAAAAATGCAAAAATTAGCTGG + Intergenic
980221881 4:129928536-129928558 ACAAAAATGCAAAAATTAGCCGG - Intergenic
981232649 4:142375713-142375735 AGATAAATGCAAAAGTTCTAAGG - Intronic
982343996 4:154335745-154335767 GCAAATATGCAGAAGGTCTTTGG - Intronic
982706463 4:158715296-158715318 AAAAATATGCAGAAGTTTTAAGG - Exonic
983454779 4:167949721-167949743 ATAAATATGTAAAATTTATCAGG + Intergenic
984452445 4:179919885-179919907 AAAAAGCTGCAAAAGTTGTCAGG - Intergenic
984515844 4:180737957-180737979 GCAAATATATAAAGGTTCTCTGG - Intergenic
984784884 4:183558417-183558439 ACAAAAATGCAAAAATTAACCGG + Intergenic
985003651 4:185511224-185511246 ACAAATATGTAAAATTTTTAAGG - Intronic
986849063 5:11789431-11789453 AAAAATATGCAAAACTTTTTAGG - Intronic
986877382 5:12127933-12127955 AAAAACATGCAAAAATTATCCGG + Intergenic
987311669 5:16686960-16686982 ATAAAGATGGAAGAGTTCTCTGG - Intronic
987366850 5:17156494-17156516 ACAAAAATACAAAAGTTAGCCGG - Intronic
987386282 5:17332639-17332661 TCAGATATGCAAAATTTATCAGG + Intergenic
988085126 5:26465648-26465670 ACAAAAATGCAACAGTTCCCAGG + Intergenic
989080890 5:37619601-37619623 AAAAATGTGAAACAGTTCTCTGG + Intronic
989487007 5:42002585-42002607 ACACATATGCAAAAGTAAACAGG - Intergenic
989603251 5:43219575-43219597 ACAAATATCCAAATGATATCAGG + Intronic
990379068 5:55203962-55203984 CCAAAAATGCAAAAGTTAACCGG + Intergenic
990383555 5:55237615-55237637 ACAAAAATACAAAAATTCGCTGG + Intergenic
991629107 5:68636207-68636229 TCAAATATCCAAAAGTGCTAGGG + Intergenic
992487899 5:77212943-77212965 ACAAAAATTCACAATTTCTCTGG - Intronic
993693317 5:91029455-91029477 ACATATGTGCAAAGTTTCTCTGG + Intronic
994638730 5:102377831-102377853 AAAAATATGCAAAAATTAGCTGG - Intronic
994855073 5:105109937-105109959 ACATATATGCATATGTACTCTGG + Intergenic
996250466 5:121323323-121323345 ACAAATATGAATAATTTCTATGG - Intergenic
996354794 5:122583737-122583759 ACAAAAATACAAAAATTATCTGG + Intergenic
996659732 5:125988091-125988113 ACAAATCTGCAAAAGTTACTGGG - Intergenic
996740460 5:126794094-126794116 ACAAAAATACAAAAGTTGGCTGG - Intronic
997637012 5:135418750-135418772 ACAAAAATGAAAAAATTCACTGG - Intergenic
997910192 5:137863970-137863992 AAAAATATGCAAAAATTAGCTGG + Intergenic
998054995 5:139066864-139066886 ACAAAAATACAAAAATTATCTGG - Intronic
999277316 5:150339801-150339823 ACAAAAATACAAAAGTTAGCTGG + Intergenic
999645194 5:153710993-153711015 AGCCATATGCAAAGGTTCTCAGG + Intronic
999793152 5:154961995-154962017 AGAAATGTGCAAAAGAACTCTGG - Intronic
1000229678 5:159303730-159303752 ACAAATATGCAAACCATATCAGG + Intergenic
1002768661 6:267816-267838 ATAAATATGCACAATTCCTCAGG + Intergenic
1003301219 6:4884534-4884556 ACAGAAATGCAAAAGATCCCTGG - Intronic
1004002729 6:11610187-11610209 AAAAATATTCAAAAGCTATCAGG + Intergenic
1005015474 6:21371220-21371242 ATAAATATGAAAAGGTTCTTTGG - Intergenic
1009843219 6:69103520-69103542 ATAAATATCCAAAGGTTCACTGG - Intronic
1010218485 6:73427010-73427032 ACAAAAATGCAAAAATTAGCCGG - Intronic
1010566681 6:77423865-77423887 ACAAATAGGCCAGAGTTGTCAGG - Intergenic
1011359372 6:86506471-86506493 ACATTGATGCAAAAGTCCTCAGG - Intergenic
1011515764 6:88150887-88150909 AGAAATGTGAAAAAGTTCTCAGG - Intronic
1011724003 6:90189812-90189834 ACACATATGAGAAGGTTCTCTGG + Intronic
1011914867 6:92490737-92490759 ACTAATATACAAAAATTATCCGG - Intergenic
1012876631 6:104736444-104736466 ACAAAAATACAAAAATTATCTGG - Intronic
1013531008 6:111018913-111018935 ACTAATATAAAAAAGTACTCAGG + Intronic
1013546122 6:111159375-111159397 GCACATGTGCAAAATTTCTCTGG + Intronic
1013612633 6:111809285-111809307 ACTAACCTGAAAAAGTTCTCAGG + Intronic
1014327099 6:120012157-120012179 ACAAATATGTAACAATACTCTGG + Intergenic
1015480742 6:133705651-133705673 ACAAATAAACAAAAGGTCTTTGG + Intergenic
1015883711 6:137894836-137894858 ACATATAAACAAAAGCTCTCTGG - Intergenic
1016125839 6:140402040-140402062 ACAAATGTTCAATAGCTCTCTGG + Intergenic
1016128684 6:140437969-140437991 AAAAATATGCAAAAGTACCAGGG + Intergenic
1016810438 6:148255802-148255824 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1017105089 6:150879789-150879811 ACAAAAATGCAAAAATTAGCTGG - Intronic
1018645153 6:165941459-165941481 ACAAATATCCAAATGATGTCAGG - Intronic
1018671843 6:166185054-166185076 ACAAAAATACAAAAATTATCTGG + Intergenic
1021180877 7:17504371-17504393 ACAAAAATACAAAAATTATCTGG - Intergenic
1021317327 7:19164714-19164736 AAAAATATGAAAAACTTCTCAGG + Intergenic
1022856333 7:34318558-34318580 ACAAATATGCAAATGTTCTTGGG + Intergenic
1023371703 7:39518438-39518460 AAAAATATGCAAAAATTATCTGG - Intergenic
1024414435 7:49087256-49087278 ACAAATCAGTAAAAGTTCTGAGG - Intergenic
1024725114 7:52185402-52185424 GCAAAGATGAAAAAGTTCTGTGG - Intergenic
1025074833 7:55933864-55933886 AAAAAGATGCAAAAATTATCTGG - Intronic
1025899511 7:65732417-65732439 ACAAAAATGCAAAAATTAGCGGG + Intergenic
1026477654 7:70750560-70750582 AAAAAAATACAAAAGTTATCCGG - Intronic
1027152580 7:75742971-75742993 AAAAATATACAAAAGTTAGCCGG - Intergenic
1029981024 7:104879252-104879274 CAAAATATGCAAAAGTTAGCTGG + Intronic
1030610938 7:111687958-111687980 CTAAATATACAAAAGTTATCTGG + Intergenic
1030687922 7:112505718-112505740 ACAAACATGCATGAGCTCTCAGG + Intergenic
1030729212 7:112964942-112964964 CAAAATATGCGAAAGATCTCAGG - Intergenic
1031148609 7:118026484-118026506 AAGAATATCCAAAAGGTCTCTGG - Intergenic
1034221761 7:149451967-149451989 AAAAAGATGCACAAGTTCACTGG + Intronic
1037318697 8:17623710-17623732 ACAAAAATACAAAAGTTAGCTGG + Intronic
1038017372 8:23527288-23527310 ACAAAGATGTAAATGTGCTCAGG - Intergenic
1038311083 8:26446670-26446692 ACAAAAATGCAAAAATTAGCCGG + Intronic
1038802316 8:30760221-30760243 ACAAAAATACAAAAATTATCAGG - Intronic
1039302624 8:36225583-36225605 CTAAAAATGCAAAAGTTATCTGG + Intergenic
1039336229 8:36592901-36592923 AAAAATATGCAAAAATCTTCAGG - Intergenic
1039974357 8:42348513-42348535 AAGAATATGCCTAAGTTCTCAGG - Intronic
1040042072 8:42926446-42926468 ACAAAAATGCAAAAATTAGCTGG - Intronic
1040624778 8:49134709-49134731 CTAAAAATGCAAAAGTTATCTGG - Intergenic
1040813352 8:51481490-51481512 AGAAATATGCAAAAGTCATGAGG + Intronic
1040980789 8:53244411-53244433 ACAAAACTGCAAAAGTACTATGG - Intronic
1041231919 8:55761310-55761332 ACAAAGGTGGAAAAGTACTCTGG - Intronic
1042345402 8:67721713-67721735 TCAAACATGCAAAATTTCTGGGG - Intronic
1043001948 8:74770559-74770581 ACAAATCTGCTAAATTTCTCTGG - Intronic
1043824344 8:84907056-84907078 TCAAATATGCATAAGGTTTCCGG - Intronic
1043927257 8:86051248-86051270 ACAAAAATGCAAAAATTAGCTGG - Intronic
1044014517 8:87034770-87034792 ACAAATATACTAAATTTGTCTGG - Intronic
1044081625 8:87892364-87892386 ACAAAAATACAAAAGTTAGCTGG - Intergenic
1046507539 8:115155299-115155321 AAAAATATGGTAAATTTCTCTGG - Intergenic
1048086682 8:131188572-131188594 CCAAATTTGCTAAAGTTCTATGG + Intergenic
1050002094 9:1088111-1088133 ACAAAAATCCAAAAGTTAGCCGG - Intergenic
1050009949 9:1175176-1175198 ACAAAAATACAAAAGTTAGCTGG + Intergenic
1050124708 9:2344664-2344686 AAAAATATGCAAAAGGAATCTGG - Intergenic
1050416413 9:5421931-5421953 ACAAATAAACAAAAGTTATTTGG + Intronic
1051494441 9:17703533-17703555 ACATAGATGCAAAAATCCTCAGG + Intronic
1052520030 9:29534911-29534933 ACATAGATGCAAAAATCCTCAGG + Intergenic
1054761670 9:69010553-69010575 ACACATATGTAAAAATTCACTGG - Intergenic
1055322333 9:75094882-75094904 ACAAATATGAAAAAATTAGCTGG + Intronic
1055666009 9:78553801-78553823 ACAAATAAACAAGAATTCTCTGG - Intergenic
1055796632 9:79981559-79981581 ACAAGAATGCAAACATTCTCTGG - Intergenic
1055835553 9:80436773-80436795 ACAAAAATGCAGAAGTTATGGGG - Intergenic
1056151586 9:83795710-83795732 AAAAAAATGCAAAAATTCACTGG - Intronic
1056321718 9:85441449-85441471 ACAAAAATGCAAAAATTAGCGGG + Intergenic
1056809429 9:89752816-89752838 ATAATTATGCAAAAATTCTGTGG - Intergenic
1057335066 9:94149058-94149080 ACAAATATCCAAAGGGTCTGGGG - Intergenic
1057615493 9:96586075-96586097 ACAACTACGCTAAAGTTCCCTGG - Intronic
1057617294 9:96603190-96603212 ACAAATACACAAAACATCTCTGG + Intronic
1057814254 9:98282723-98282745 ACAAAAATGCAAAAATTAGCTGG - Intergenic
1058792282 9:108461130-108461152 TCATAGATGCAAAAGTCCTCAGG + Intergenic
1060653156 9:125348215-125348237 AAAAATATACAAAAGTTAGCTGG - Intronic
1061436889 9:130569384-130569406 AAAAATATACAAAAGTTAGCTGG + Intergenic
1061791086 9:133059354-133059376 ACAAAAATTCAAAAATTATCTGG - Intergenic
1061991403 9:134160894-134160916 AAAAATATTCAAAAATTCGCTGG - Intergenic
1062177406 9:135171414-135171436 ACAAAAATACAAAAATTATCTGG + Intergenic
1062700829 9:137901597-137901619 ACAAATTGGCAAAATGTCTCAGG - Intronic
1186406602 X:9309809-9309831 AAAAAAATACAAAAGTTATCTGG - Intergenic
1186946571 X:14575360-14575382 ACAAAAATACAAAAGTTAGCTGG - Intronic
1187380311 X:18795591-18795613 ACAAATGAGCAAGAGTACTCAGG - Intronic
1188238581 X:27758161-27758183 ACAAATATTCAAAAGTTTTTTGG - Intergenic
1189114844 X:38331742-38331764 ACAAAAATACAAAAATTATCTGG - Intronic
1189296821 X:39924252-39924274 ACAAAAATACAAAAGTTAGCAGG + Intergenic
1189444068 X:41064602-41064624 ACAAATATGCAGAACTCCTTAGG + Intergenic
1189455278 X:41182211-41182233 AAAAATATGCAAAAATTAGCTGG + Intronic
1189498942 X:41536268-41536290 ACAAAAATACAAAAATTGTCTGG - Intronic
1189644195 X:43108896-43108918 ACAAATATCCAGAATTACTCTGG - Intergenic
1189803623 X:44714518-44714540 ACAAAAATACAAAAATTATCTGG - Intergenic
1190412147 X:50147292-50147314 AAAAAAATGCAAAAATTCACTGG - Intergenic
1191878099 X:65816813-65816835 ACAAAAATACAAAAATTCGCCGG + Intergenic
1193414817 X:81209167-81209189 CCAAAAATACAAAAGTTATCTGG - Intronic
1193671010 X:84386265-84386287 AGATAGATGCAAAAGTTCACAGG - Intronic
1194076648 X:89402287-89402309 ACAGATTTGCAAAAGTTCTGTGG - Intergenic
1194235771 X:91381555-91381577 CCAAATATTCAAAAGTACTTGGG - Intergenic
1194292929 X:92097422-92097444 AAAAAATTGAAAAAGTTCTCAGG + Intronic
1196752079 X:119127084-119127106 AAAAATATTCAAAAGCTCTTAGG + Intronic
1196797545 X:119514437-119514459 ACAAATATACAAAAATTAGCCGG + Intergenic
1197278595 X:124508930-124508952 ACAAATATGCAATATTTCATGGG + Intronic
1197877110 X:131121991-131122013 ACAAATAAGCATAAGAACTCTGG - Intergenic
1197920544 X:131588955-131588977 ACAAATATGGAAAAGTGTTCAGG - Intergenic
1197998876 X:132411335-132411357 ATCAAAATGTAAAAGTTCTCTGG - Intronic
1198159565 X:133993775-133993797 ACAAAAATACAAAAATTATCTGG + Intergenic
1198419118 X:136451432-136451454 ACAAAAATACAAAAATTATCTGG - Intergenic
1198754699 X:139970590-139970612 ACATATATGCATGAGCTCTCAGG + Intergenic
1199101537 X:143806710-143806732 AAAAATAAGCAAAAGCTCCCAGG + Intergenic
1199183703 X:144889906-144889928 AGAAATAAGAAAAAGTTTTCTGG - Intergenic
1199311627 X:146327845-146327867 ACATATATGTAAACGTGCTCAGG + Intergenic
1200305301 X:155019630-155019652 AAAAATATACAAAAATTTTCCGG + Intronic
1200429290 Y:3057810-3057832 ACAGATTTGCAAAAGTTCTGTGG - Intergenic
1200610435 Y:5321974-5321996 AAAAAATTGAAAAAGTTCTCAGG + Intronic
1200932331 Y:8708375-8708397 AGAAATCTGCAAAATTACTCAGG - Intergenic
1201575782 Y:15460100-15460122 ACAAATATACAAAAATTAGCTGG - Intergenic
1201592719 Y:15633160-15633182 AAAAATATTCAAAAGTTAGCTGG + Intergenic