ID: 1112127292

View in Genome Browser
Species Human (GRCh38)
Location 13:96481997-96482019
Sequence TGGAGTTAATGAAGCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112127292_1112127295 -2 Left 1112127292 13:96481997-96482019 CCTTCTGTGCTTCATTAACTCCA 0: 1
1: 0
2: 2
3: 22
4: 279
Right 1112127295 13:96482018-96482040 CAAAAATAAAAGAATAAAAAGGG 0: 2
1: 2
2: 185
3: 4445
4: 36592
1112127292_1112127294 -3 Left 1112127292 13:96481997-96482019 CCTTCTGTGCTTCATTAACTCCA 0: 1
1: 0
2: 2
3: 22
4: 279
Right 1112127294 13:96482017-96482039 CCAAAAATAAAAGAATAAAAAGG 0: 1
1: 1
2: 45
3: 930
4: 11216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112127292 Original CRISPR TGGAGTTAATGAAGCACAGA AGG (reversed) Intronic
901531746 1:9858052-9858074 TGGAGTTTATGTATGACAGAGGG - Intronic
901722339 1:11209591-11209613 TGGACAAAATGAACCACAGATGG + Intronic
902193539 1:14780954-14780976 TGGAGTTACAGGAGCCCAGAGGG + Intronic
904267800 1:29327587-29327609 TGGAGAAACTGAGGCACAGAGGG - Intergenic
904804776 1:33123046-33123068 TGGAGTGTTTGAAGAACAGAGGG - Intergenic
906480188 1:46194529-46194551 TGGAGTTAGTGGAGCATGGATGG - Intronic
907737603 1:57129904-57129926 TGGATAGAATGAAACACAGAAGG - Intronic
909432947 1:75611048-75611070 TGGAGTTATTGAAGAAATGATGG - Exonic
910573098 1:88728163-88728185 TGGACTTAATACAGCAGAGAAGG - Intronic
911723994 1:101222253-101222275 TGTAATGAAGGAAGCACAGAAGG + Intergenic
912842063 1:113047626-113047648 TGAAGAAAATGAGGCACAGAGGG + Intergenic
915270802 1:154751919-154751941 TGGAGTTGAGCAACCACAGAAGG + Intronic
916516929 1:165527083-165527105 GGAAATAAATGAAGCACAGACGG - Intergenic
916666843 1:166974824-166974846 TGGAATAAAGGAAGCTCAGAGGG - Intronic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
918921718 1:190720525-190720547 AGGAGCTAAGGAAGCAGAGATGG - Intergenic
919187565 1:194172627-194172649 TGAAGCCACTGAAGCACAGATGG + Intergenic
921384225 1:214552536-214552558 TGGAGTTAATGAGACGCAGCTGG + Intergenic
923485954 1:234431714-234431736 TGCAGTAAATGAGACACAGAGGG + Intronic
924215516 1:241817571-241817593 TGTAGCTAATCAACCACAGAAGG + Intergenic
924860518 1:247915858-247915880 TGGCATTAATGAAGCAAAGTTGG - Intergenic
1063425206 10:5945368-5945390 TGGAGTTAATGCCACCCAGAGGG - Intronic
1065201100 10:23313914-23313936 TGGACTTAATGAAGACCAAAAGG + Intronic
1066229739 10:33420781-33420803 TGGAGTAAATGACACCCAGATGG + Intergenic
1067553650 10:47252985-47253007 TGGGGAAAATGAGGCACAGAAGG + Intergenic
1071865328 10:89723635-89723657 TGGATTAAATGAAGCAAATATGG + Intronic
1073906966 10:108293016-108293038 TGGAATAAATGAAGAAAAGAAGG - Intergenic
1074680796 10:115905003-115905025 TGTAATTTATGAAGCACTGAAGG - Intronic
1074786541 10:116847217-116847239 TGGAGTTGGGGAAGCAAAGATGG - Intergenic
1075664546 10:124221261-124221283 TGGGGAGAATGAAGCTCAGAAGG - Intergenic
1076797664 10:132806004-132806026 TGGAGATAATGGGGGACAGAGGG - Intergenic
1078752978 11:14182524-14182546 TGGAGGAACTGAAGCAGAGATGG - Intronic
1078865683 11:15295302-15295324 TTGCCTTAATGAAGAACAGAGGG + Intergenic
1079746818 11:24142822-24142844 TGGAGTTAAAGAACCACTGCAGG - Intergenic
1079940903 11:26679325-26679347 AGTAGTTAATCAAGCAAAGAGGG + Intronic
1081102884 11:39026881-39026903 GGGAGTTTAAGAAGCAGAGATGG - Intergenic
1081340541 11:41922064-41922086 TGGTGGAAATGAAGCAAAGAAGG - Intergenic
1081482214 11:43500142-43500164 AGGAGCTAATGAAACAGAGAGGG + Intergenic
1085476157 11:76790172-76790194 TGGAGAAACTGAGGCACAGAAGG + Intronic
1086886214 11:92208885-92208907 TTTATTTACTGAAGCACAGAGGG + Intergenic
1087566438 11:99865178-99865200 TGATGCTATTGAAGCACAGAAGG - Intronic
1090560596 11:127928005-127928027 TTGATGGAATGAAGCACAGATGG + Intergenic
1091722972 12:2826772-2826794 GGGAGATAATGAGGCCCAGAAGG + Exonic
1091885432 12:4013751-4013773 TGAAGTCAATGAAGCATAGCAGG + Intergenic
1092295372 12:7193012-7193034 TGGAGTTAAGGTAGAACAGTAGG + Intronic
1092295715 12:7198621-7198643 AGGAGTGAAGGGAGCACAGAAGG - Intronic
1092721874 12:11449225-11449247 TGGAGAAAATGAGGCAAAGAGGG - Intronic
1093176870 12:15922678-15922700 TGCATTCAATGAAGCACAAATGG - Intronic
1093274750 12:17110755-17110777 ATGAGCTAATTAAGCACAGATGG + Intergenic
1093963962 12:25305418-25305440 AGCAGTTAATCAAACACAGAGGG + Intergenic
1093993022 12:25611030-25611052 AGGAGTCAAAGAAGCAGAGAAGG + Intronic
1094108115 12:26833976-26833998 TGGAGTTAACGAAGCGCAGGAGG - Intergenic
1094441761 12:30485632-30485654 TGGAGCTGAGGAACCACAGAGGG - Intergenic
1094767025 12:33608771-33608793 TGCAGATAATGGAGCAGAGATGG - Intergenic
1095924057 12:47560976-47560998 TAGAGATAATGAAGCAGAAAAGG + Intergenic
1096317743 12:50583387-50583409 TGGAGGGACTGAAGCACAGGTGG - Intronic
1099794521 12:87382194-87382216 AGGAGTTAGTGAAGAACAGTTGG + Intergenic
1099876957 12:88419440-88419462 TGGAGAAAATGAAGCAGGGAAGG - Intergenic
1100364284 12:93904878-93904900 TGGAGAAAATAAAACACAGAAGG - Intergenic
1100549624 12:95635216-95635238 ATGAGGTAATGAAGCAGAGAAGG + Intergenic
1100888890 12:99102079-99102101 TGAAGTTAATGAGGAAAAGAGGG + Intronic
1103939003 12:124491882-124491904 TGGAGAGAATGAGGCACAGAGGG + Intronic
1103991778 12:124804239-124804261 TGGAGTGAAGGAAACACAGGTGG + Intronic
1104228621 12:126861762-126861784 TGAAGGTAATGAAGTACGGAGGG + Intergenic
1104312649 12:127667907-127667929 TGGAAGAAATGAAGCATAGAAGG - Intergenic
1104468650 12:129010432-129010454 TGGTCTAAATGAATCACAGAGGG + Intergenic
1104579823 12:130002957-130002979 TAGAGTTAATGAATCCCAGAAGG - Intergenic
1105857118 13:24384339-24384361 TGGAGGTTAAGAAGCATAGACGG - Intergenic
1106015406 13:25864338-25864360 TGGAGTTACTGAAGTACATGTGG - Intronic
1106501285 13:30331414-30331436 TGAAATTGAAGAAGCACAGAAGG - Intergenic
1106678824 13:31988975-31988997 TGAAATAAATCAAGCACAGAAGG - Intergenic
1106725872 13:32485249-32485271 TGAAGTAAATGAAGAACAGTTGG + Intronic
1108533027 13:51345190-51345212 TGGAGAAACTGAGGCACAGAAGG + Intronic
1108767508 13:53650557-53650579 TGGAGGAAAAGAAGCAAAGAAGG - Intergenic
1111525676 13:89465588-89465610 AGGACTCAATGAAGCACAGTGGG + Intergenic
1111568728 13:90049544-90049566 TGAAGTTAATGAATCATAGCTGG + Intergenic
1112127292 13:96481997-96482019 TGGAGTTAATGAAGCACAGAAGG - Intronic
1112435564 13:99389309-99389331 TGCAGTTAATGAACAAAAGAGGG - Intergenic
1112996682 13:105583224-105583246 TGAAGTTAATAAACCACTGAAGG + Intergenic
1113211040 13:107981660-107981682 TGGAGTTAAGGAAAGAAAGAAGG - Intergenic
1115905674 14:38200381-38200403 TGAGGAAAATGAAGCACAGAGGG + Intergenic
1116002047 14:39254312-39254334 TGAAGTTGAAGAAGTACAGAGGG + Intronic
1116366448 14:44071673-44071695 AGTAATTAATGAAGCACACATGG + Intergenic
1117257237 14:53990495-53990517 TGGAATTCATGAAGCCCAAAGGG - Intergenic
1117610883 14:57482201-57482223 TGGAGTTTATGATGCACTGGCGG - Intronic
1117649492 14:57888078-57888100 TGGAGTTAATGAAGCAGAGTGGG - Intronic
1118751012 14:68807985-68808007 TGAAGATGATGAAGGACAGATGG + Intergenic
1118915003 14:70095420-70095442 TGGAGAAACTGAGGCACAGAAGG - Intronic
1119899401 14:78247109-78247131 TGGAGATAATGGACCACAGAAGG - Intronic
1120148155 14:81002392-81002414 TGGGGAAACTGAAGCACAGACGG - Intronic
1121263301 14:92582093-92582115 TGGATTTTAGGAGGCACAGATGG + Intronic
1121408948 14:93736070-93736092 TGGCCTCAAAGAAGCACAGACGG + Intronic
1121467822 14:94127451-94127473 TGCCATTAATGAAGAACAGAGGG + Intergenic
1121620243 14:95341750-95341772 TGGAGTGAATGAGGCGGAGAGGG + Intergenic
1122147297 14:99699265-99699287 TGGGGAAAATGCAGCACAGAGGG - Intronic
1122150469 14:99723039-99723061 TGGAGATGATGAAGAACAGCAGG - Intronic
1122656627 14:103266079-103266101 TGGAGTTCCTGAAGAAGAGATGG - Intergenic
1123891193 15:24781170-24781192 TTGAGCAAATGAAGCATAGAAGG - Intergenic
1125006296 15:34821619-34821641 TGAAGTTTATCAAGCACTGATGG - Intergenic
1125742515 15:41976033-41976055 TGGATTCAATCAACCACAGATGG + Intergenic
1126511595 15:49481394-49481416 TGCAGTAAAGGAAGCACAAAGGG - Intronic
1130674369 15:85939125-85939147 TGGTGTTATTGAAGCAATGAAGG - Intergenic
1130754821 15:86752109-86752131 AGGAGTTAATGTACCACAGGTGG + Intronic
1131417329 15:92272042-92272064 AAGAGTTAAGGAAGGACAGAGGG + Intergenic
1131719416 15:95151122-95151144 TGGATTTAATGAACCAAAGTTGG - Intergenic
1134098386 16:11434759-11434781 TGGAGAAACTGAGGCACAGAAGG + Intronic
1134858319 16:17538998-17539020 TGGAGCCTATGAATCACAGAAGG - Intergenic
1135522067 16:23185231-23185253 TGGAATTATTGAAACACAAAAGG + Intronic
1136029962 16:27495699-27495721 TGCAGAAAATAAAGCACAGATGG + Intronic
1137395148 16:48111821-48111843 AGGAGTTAATGGAGGAGAGAGGG - Exonic
1137856860 16:51803299-51803321 ATGAGTTAATGAAGCATATATGG - Intergenic
1137870507 16:51945825-51945847 TGGAGTTAATGCAACCCCGAAGG + Intergenic
1138618309 16:58190136-58190158 TGGAATAAATGAACCCCAGACGG - Intronic
1139057811 16:63207482-63207504 TGGAGTTGATGAAACACTGAAGG + Intergenic
1139329417 16:66175983-66176005 TGGACTTCATTAAGCACAGAGGG - Intergenic
1140265955 16:73420968-73420990 TGGAGTTAATTTAGTGCAGAAGG - Intergenic
1141342955 16:83220131-83220153 TGAAGTGCATGAAGCACGGAGGG - Intronic
1145025604 17:19465855-19465877 TGGGGTTAATGAGACTCAGAAGG - Intergenic
1145962549 17:28896066-28896088 TGGAGTCAGGGAAGCAGAGAAGG - Intronic
1146468535 17:33106404-33106426 TGGAGTGCATGAAGGATAGAAGG + Intronic
1149485404 17:57038813-57038835 TGGAGAACATGAAGCAAAGAAGG + Intergenic
1149555098 17:57567969-57567991 TGGAGATATTGAGGCACAGCGGG + Intronic
1149623219 17:58061437-58061459 TGAAGTAACTGAGGCACAGAGGG + Intergenic
1150570398 17:66381357-66381379 TGGAGTTCAAGGAGCAAAGACGG + Intronic
1150914963 17:69427585-69427607 TGGAGTTATTGAGGGAAAGAAGG - Intronic
1151996987 17:77616017-77616039 AGTATTTAATGATGCACAGAGGG + Intergenic
1152547244 17:81007210-81007232 TGGACTTAATGTAGCGGAGACGG - Intronic
1155979350 18:32164506-32164528 TGGATTTTATGAAGGACAGAGGG - Intronic
1156226776 18:35117339-35117361 TGGTGTTAATGGAGCACAACAGG + Intronic
1156809633 18:41231757-41231779 TAGAGTTGAAGAAACACAGAAGG + Intergenic
1156880805 18:42076813-42076835 AGCAGTTAATGAAGCAAACATGG - Intronic
1158250986 18:55487135-55487157 TGGTGTGATTGAGGCACAGAAGG - Intronic
1158367660 18:56756890-56756912 AGGAGATAATGAGGCAGAGAAGG + Exonic
1158712343 18:59848726-59848748 TGGGGATATTGAAGCACAGAGGG - Intergenic
1160332269 18:78005112-78005134 AAGATTTAATGAAGAACAGAAGG - Intergenic
1162060011 19:8089381-8089403 ATGAGTGAATGAAGCACAGAGGG + Intronic
1162223232 19:9197451-9197473 TGAAGTAAATAAATCACAGAAGG + Intergenic
1163506311 19:17709106-17709128 TGGAGTGAGAGTAGCACAGAGGG + Intergenic
1163583604 19:18152748-18152770 GGGAATTACTGAAGCATAGATGG - Intergenic
1163901317 19:20102755-20102777 TAGAGCTAATGGAACACAGATGG - Intronic
1165987002 19:39778166-39778188 TGGAGTAAATGAGTAACAGAGGG + Intronic
1166165148 19:40982514-40982536 TGGAGAAAGTGAAACACAGAGGG - Intergenic
1167742218 19:51330387-51330409 TAGAGTTAATGAAGGGCAAAGGG + Intergenic
1167968981 19:53174192-53174214 TTGATTGAATCAAGCACAGAAGG + Intronic
1168184355 19:54689022-54689044 TGTAGTTACTGAAGGACATATGG + Intronic
926373561 2:12204483-12204505 TGGAGAGAATGAAGCAGAGGCGG + Intergenic
926692271 2:15745754-15745776 TGGAGAAACTGAGGCACAGAGGG + Intergenic
926896779 2:17699854-17699876 TTGAGTTATTGAAGCAAAGCTGG + Intronic
926969160 2:18449724-18449746 TGGGGTAAGTGAGGCACAGATGG - Intergenic
927917579 2:26946886-26946908 TGCAGGGAAGGAAGCACAGAGGG - Intronic
928801635 2:35101221-35101243 TGTATTTCAGGAAGCACAGAAGG - Intergenic
930899837 2:56491653-56491675 TGGAGAAAATTAAGCACAGGCGG + Intergenic
932566611 2:72915091-72915113 TGGAGTTAATGACAGACAGCTGG + Intergenic
936629743 2:114189394-114189416 TTGTGAGAATGAAGCACAGATGG + Intergenic
936974676 2:118207242-118207264 TGGACCTAATGCAGCCCAGATGG - Intergenic
937049979 2:118880705-118880727 TGGAGTTAAAGAATGACACATGG + Intergenic
937107425 2:119330662-119330684 TGGAGATAGTGAAGGAGAGAGGG - Intronic
938923792 2:136020099-136020121 AGGATCTAACGAAGCACAGAAGG - Intergenic
939419139 2:141943576-141943598 AGGAGTTAATGCAACACTGAAGG - Intronic
941624254 2:167813020-167813042 TGGAGATAATAAAAAACAGAGGG - Intergenic
941630977 2:167883996-167884018 TGGAGTTAACTAATCAAAGATGG - Intergenic
942665800 2:178315758-178315780 ATGAGTTAATGAAGCCCAGAGGG + Intronic
944319189 2:198316848-198316870 TAGCGTTAATGTAGCACAGAGGG - Intronic
944513226 2:200484838-200484860 TGGAGAAACTGAAGCACAGAGGG - Intergenic
945370411 2:209009401-209009423 TTGAATTAATTAAGCACAGAAGG + Intergenic
945831186 2:214787948-214787970 AGGCGTTAATGTTGCACAGATGG - Intronic
946178175 2:217934584-217934606 TGGAGCCAATGAAGCAAAGGAGG - Intronic
947349328 2:229226028-229226050 AGGAGATAATGAAGCACTGAAGG - Intronic
948225818 2:236308616-236308638 TGGAATTAGCCAAGCACAGAAGG - Intergenic
948568880 2:238904901-238904923 TGGAGGGAATGAAGGACAGGTGG + Intronic
1169151067 20:3289812-3289834 TGGAGAAAATAAAGCAGAGAAGG - Intronic
1171115698 20:22523127-22523149 TGCAGTAAGTGAAGCACAGAGGG - Intergenic
1173445762 20:43116639-43116661 GTGAGTTACTGAAACACAGAGGG - Intronic
1173840798 20:46155655-46155677 TGGAGTTGACCAAGCAAAGAAGG - Intergenic
1174396049 20:50247473-50247495 TGGGGAAACTGAAGCACAGAGGG + Intergenic
1174404224 20:50293279-50293301 TGGAGAAACTGAGGCACAGAGGG + Intergenic
1174493326 20:50919937-50919959 TGCAGGTAACGAAGTACAGAAGG + Intronic
1175042978 20:56073421-56073443 TGGAGTTAATGAGGTAAATAAGG - Intergenic
1175659682 20:60801957-60801979 TGGAGTTGCTTAAGCAAAGAAGG - Intergenic
1176662427 21:9650898-9650920 AGGAGTTTATCCAGCACAGAAGG - Intergenic
1176882064 21:14207719-14207741 GGTAGTTCATGAAGCACACACGG + Intronic
1177204515 21:17995456-17995478 GGGAGTGCTTGAAGCACAGAAGG - Intronic
1178272859 21:31209179-31209201 TGGAGGAAGTGAAGCTCAGAGGG - Intronic
1178510441 21:33200889-33200911 TGGGGTTGATGAAGCACATCTGG - Intergenic
1178901195 21:36600536-36600558 TGGAACAAAGGAAGCACAGAGGG - Intergenic
1178917462 21:36715229-36715251 TGGAGTTAATCATGAACAGGGGG - Intronic
1179144516 21:38755788-38755810 TGGAGTCAATGACTCATAGAAGG + Intergenic
1179260827 21:39757014-39757036 TGCAGTTCATCAAGCACAGCAGG + Intronic
1179530343 21:42014145-42014167 TGGAATCACTGAAGCGCAGAGGG - Intergenic
1182463669 22:30500891-30500913 TGAAGTTAAGGAAAAACAGAGGG + Intronic
1183130505 22:35830310-35830332 GAATGTTAATGAAGCACAGAGGG + Intronic
950116805 3:10456110-10456132 TGGAGTTAATTTAACAAAGAAGG + Intronic
950851521 3:16066613-16066635 TGGATTCAATCAACCACAGATGG - Intergenic
951227831 3:20141876-20141898 AAGAGTTAATAAAGCACAGCGGG + Intronic
954850948 3:53600037-53600059 TGCAGATACTGAAGTACAGATGG + Intronic
956466031 3:69521548-69521570 TGGAGTTTCTTAAGCAGAGAGGG - Intronic
956650501 3:71500513-71500535 TGGAGTTTCTTCAGCACAGAAGG - Intronic
958999302 3:100943272-100943294 TGGAATGAATGATGGACAGAGGG - Intronic
959324603 3:104920639-104920661 TGGAATTAATGTAGCAGTGATGG + Intergenic
963375489 3:144458436-144458458 TGGTGTCAATGAAGGACAGCTGG + Intergenic
963437876 3:145294740-145294762 TGCAGATAAAGAAACACAGATGG - Intergenic
964047167 3:152342787-152342809 TGTAGTTAACGAACCTCAGAGGG - Intronic
964503523 3:157374073-157374095 TGGAGTAAATGAATAACAGCTGG + Intronic
964529697 3:157654125-157654147 TGAAGAAACTGAAGCACAGAAGG - Intronic
964644655 3:158946244-158946266 TGGAGTAAATCCAGCATAGAGGG - Intergenic
964790820 3:160452243-160452265 TTGAGGTAAGAAAGCACAGAGGG - Intronic
965574616 3:170205593-170205615 TTGTTTTAATGAACCACAGATGG - Intergenic
967767173 3:193293825-193293847 AGGAGTCATTGAAACACAGATGG + Intronic
968293083 3:197554230-197554252 TGCAGTTACAGAGGCACAGAAGG - Intronic
968300183 3:197606944-197606966 TGGATTTATGGAAGGACAGATGG + Intergenic
968637217 4:1686811-1686833 TGGCGTTGATGAAGCCCTGAAGG + Intergenic
970005528 4:11407357-11407379 AGGATTCAAGGAAGCACAGAAGG - Intronic
970860677 4:20699580-20699602 TGGAGCTACAGGAGCACAGAAGG + Intronic
973033558 4:45375693-45375715 TTGAGTTAATTAATCACATATGG + Intergenic
974574943 4:63706507-63706529 TTGAGTTATAGAAGCAGAGAAGG - Intergenic
975021550 4:69496922-69496944 TTGAATTAATGAAGGACAAAGGG + Intronic
975558293 4:75685937-75685959 TGGAGTTAAGGAAGGAGAGAAGG + Intronic
975823990 4:78300774-78300796 TGGAGTTGGTGAGGCACAGTGGG - Intronic
976419628 4:84826138-84826160 TGGATTCAATCAATCACAGATGG + Intronic
978411192 4:108427811-108427833 AGGACATATTGAAGCACAGAGGG + Intergenic
981875115 4:149532912-149532934 TTAAGGTAATGAAGCAAAGATGG + Intergenic
981963900 4:150579006-150579028 TTGAGTTAATGAGGCAAAGGAGG - Intronic
982466005 4:155733294-155733316 TAGAGTTCATCAAGCAGAGAAGG + Intergenic
982709031 4:158741470-158741492 TTCAGTTAGTGAAGCACAGATGG + Intergenic
984428341 4:179616359-179616381 TAGAATTAATGAAGAGCAGAAGG + Intergenic
985220716 4:187701367-187701389 AGAAGATAATAAAGCACAGAAGG + Intergenic
986115838 5:4773506-4773528 TTGTGTTAATGAAGCATAAATGG - Intergenic
987824475 5:23011023-23011045 AGGAGTTCCTGAATCACAGAAGG - Intergenic
990252745 5:53933160-53933182 TGGAGAGCATGAAGCACAGTTGG - Intronic
992417055 5:76561878-76561900 TGGAATTAAGGAAGCAGACAAGG - Intronic
992953253 5:81881573-81881595 TGGAGAAAATGAAGCAGGGAGGG + Intergenic
993103380 5:83569380-83569402 TAGAGACAATGAACCACAGAGGG - Intronic
993216399 5:85028006-85028028 TCCAGTCAATGAAGCACATAGGG - Intergenic
993490127 5:88536830-88536852 TGGAGTTACTAGAGCAAAGAGGG + Intergenic
993797650 5:92287800-92287822 TGGAGATTAGGATGCACAGAGGG - Intergenic
999653438 5:153790006-153790028 TGGAGACACTGAAGCTCAGATGG + Intronic
999691261 5:154147840-154147862 GGGAGTGTATGATGCACAGAGGG - Intronic
1001133446 5:169082866-169082888 TGGTGTTATTGAGGCAGAGAAGG - Intronic
1001242474 5:170081034-170081056 TGGAGTAAATGAAATAAAGAAGG - Intronic
1001490742 5:172153428-172153450 TAGTGATAAGGAAGCACAGACGG + Intronic
1002274294 5:178094420-178094442 TGGAAACAATGAAGCAGAGAAGG + Intergenic
1005845450 6:29773399-29773421 AGGAGTGAAGGAAGCAAAGAAGG - Intergenic
1008323059 6:50141884-50141906 CTGAGTTATTAAAGCACAGAAGG + Intergenic
1009027641 6:58018854-58018876 TGAAGTTTATCAAGCAAAGATGG - Intergenic
1009203174 6:60770331-60770353 TGAAGTTTATCAAGCAAAGATGG - Intergenic
1009701181 6:67183625-67183647 TGGAGATAATGGTGCAAAGAAGG - Intergenic
1011972543 6:93245762-93245784 GGGAGTAAATGATGCACATATGG + Intronic
1012909935 6:105106766-105106788 TTGAGTTAAAGAACCACAGAAGG + Intronic
1012937963 6:105388003-105388025 AGGAGGAAATGAAGCACATATGG + Intronic
1013937314 6:115613420-115613442 TGTAGTTATTGAACTACAGATGG - Intergenic
1014479868 6:121922458-121922480 TGAAGTTACTCAAGCACAGAGGG + Intergenic
1014799413 6:125760804-125760826 TGGAGGTGATGAAGCAAGGAGGG + Exonic
1015123060 6:129722250-129722272 GGGAGATGATGAAGCAGAGATGG - Intergenic
1015822781 6:137281341-137281363 TGCAGTGAATGAAGTAGAGAAGG + Intergenic
1016092124 6:139992823-139992845 TGGGCTAAATGAAGCACAGAGGG + Intergenic
1017964835 6:159255191-159255213 TGAAGTTGAAGCAGCACAGATGG - Intronic
1019850910 7:3556284-3556306 TGGAGTAGGTCAAGCACAGAAGG + Intronic
1020482706 7:8681880-8681902 TGCAGTAAATGACGCACATATGG - Intronic
1021563549 7:21993111-21993133 TGGAGTTCATGGAGAACAGAAGG - Intergenic
1022943509 7:35260777-35260799 TGCAGAAAATGAAGCTCAGAAGG + Intergenic
1026258196 7:68731250-68731272 TTGAGTAAATGAGGCACAGGAGG + Intergenic
1027647032 7:80814499-80814521 TGGATTTAATTATGCAGAGAGGG - Intronic
1027875904 7:83767732-83767754 TGGAAAAACTGAAGCACAGAAGG + Intergenic
1029606910 7:101604767-101604789 TGGAGCTGAAGAAGCACAGTGGG - Intergenic
1029790190 7:102835304-102835326 TGGAGATAATCAAGCATAGTGGG + Intronic
1029980328 7:104872562-104872584 TGGAATCCAGGAAGCACAGATGG + Intronic
1030361469 7:108599625-108599647 TGGAAGGAATGAAGCAGAGAAGG - Intergenic
1030950815 7:115789151-115789173 TTGAGTTCATGAAGCACTGCAGG + Intergenic
1032751614 7:134847025-134847047 TGAAATTAATGAAACACAGTCGG - Intronic
1036691467 8:10947405-10947427 TGGAGTTGAGGAAGCACAGATGG + Intronic
1038854892 8:31320325-31320347 TGGAGGTAATTTATCACAGATGG - Intergenic
1041389214 8:57334156-57334178 TGGCTGTAAGGAAGCACAGACGG - Intergenic
1042578305 8:70247727-70247749 TGTAGTTAATAAAGGACACATGG - Intronic
1048749538 8:137656132-137656154 TAGAGTTAATGTATCAGAGAAGG + Intergenic
1050196299 9:3087660-3087682 TGGAGTTAATTAAAGAGAGATGG - Intergenic
1050307487 9:4320229-4320251 TGGAGTGAATGAAGCATGCAGGG - Intronic
1050620692 9:7449220-7449242 TGGACTGAAGGATGCACAGAAGG + Intergenic
1051538906 9:18192192-18192214 TTGATTTATTGAAGCATAGAAGG - Intergenic
1052174607 9:25443182-25443204 TGAAATAAATGAAGCACATATGG + Intergenic
1052319958 9:27157280-27157302 TGGAGTAAATGAGGCCCTGAGGG + Intronic
1052750704 9:32486741-32486763 TGGAGGTGATGAAGCTCAGAGGG + Intronic
1054764727 9:69034022-69034044 TAGAATTAATTAAACACAGAAGG + Intergenic
1054797155 9:69313199-69313221 TGGAGCTACAGATGCACAGAAGG - Intergenic
1056057211 9:82838454-82838476 TAGAGTTACGGAAACACAGAAGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1059727882 9:117027365-117027387 GGGAGTTATGGAAGCACTGAAGG - Intronic
1061216193 9:129223413-129223435 AGGAGTTAAAGAAGCAGAGCGGG - Intergenic
1185735339 X:2491546-2491568 TGCAGTGAATGAAGCTCAGGTGG - Intronic
1185941519 X:4325684-4325706 TGATGTTAACGAAACACAGAAGG - Intergenic
1186391890 X:9169195-9169217 TGCTGTTACAGAAGCACAGATGG - Intergenic
1187953711 X:24495294-24495316 TGGAGCAAATGAAGCAAAGGAGG - Intronic
1188574631 X:31632009-31632031 TGAAGGTAAAGAATCACAGAAGG + Intronic
1189113461 X:38318940-38318962 TGGAAATAATGAAGGACAGTTGG - Exonic
1189605289 X:42671488-42671510 TTGAATTAATGAATAACAGAAGG - Intergenic
1190331869 X:49241055-49241077 TGAAGAAAGTGAAGCACAGAGGG + Intronic
1190759675 X:53428916-53428938 TGAAGAAACTGAAGCACAGAAGG - Intronic
1192164701 X:68820696-68820718 TGGAGTCAATGGTGCCCAGATGG - Intergenic
1192706853 X:73535161-73535183 TGAACTTAATTAAGCTCAGATGG + Intergenic
1195720692 X:107865040-107865062 TGGGGTAACTGAAGCACACAGGG + Intronic
1196209574 X:112980923-112980945 TGGAGTGGTTGAAGCAGAGATGG - Intergenic
1196890377 X:120285465-120285487 TGGAGAGAAGGAAGGACAGATGG + Intronic
1198197805 X:134382371-134382393 TGGAGTTAAGTAAGAATAGATGG - Intronic
1201625666 Y:16012049-16012071 TGGAGGGAATGAAGGAAAGATGG + Intergenic