ID: 1112131380

View in Genome Browser
Species Human (GRCh38)
Location 13:96527595-96527617
Sequence GGTCAGATAAAGCATCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112131375_1112131380 21 Left 1112131375 13:96527551-96527573 CCTGAGGCTCTGCTGGGAAAGAC 0: 1
1: 0
2: 3
3: 22
4: 243
Right 1112131380 13:96527595-96527617 GGTCAGATAAAGCATCTTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 202
1112131378_1112131380 -6 Left 1112131378 13:96527578-96527600 CCTCTTGTAGATAAGTGGGTCAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1112131380 13:96527595-96527617 GGTCAGATAAAGCATCTTGGAGG 0: 1
1: 0
2: 1
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112131380 Original CRISPR GGTCAGATAAAGCATCTTGG AGG Intronic
901584000 1:10271501-10271523 GGTCAGTAAAATCAGCTTGGTGG + Exonic
901847269 1:11991388-11991410 GGTCAGAGAAGGCTTCCTGGGGG + Intronic
902076901 1:13794230-13794252 GGTCAGGAAAGGCTTCTTGGAGG - Intronic
903026995 1:20436478-20436500 GGTCAGAGAAGGCTTCCTGGAGG - Intergenic
903033445 1:20479488-20479510 GGTCAGTGGAGGCATCTTGGGGG - Intergenic
903920469 1:26796485-26796507 GCTCAGATAAAGTATTATGGAGG + Intronic
904470287 1:30731837-30731859 GGCCAGAGAAAGCCTCTTGGAGG - Intergenic
904890425 1:33775483-33775505 GGTCAGGAAAGGCTTCTTGGAGG + Intronic
905363327 1:37435037-37435059 GGTCAGAGAAGGCTTCCTGGAGG - Intergenic
906671626 1:47659333-47659355 GGTCAGCGAAAGCTTCTTGTAGG - Intergenic
907526672 1:55057747-55057769 GGTCAGAGAAGGCATCTTGGAGG + Intronic
907827105 1:58029001-58029023 GATCAAATTAAGCATCTTGAAGG + Intronic
908628087 1:66069761-66069783 GGTCAGAAAAAACTTCCTGGAGG + Intronic
909175008 1:72346416-72346438 GGTCAGCTAAATCTTCTTGTTGG - Intergenic
911055382 1:93704134-93704156 GGTCAGAGAAGGCCTCTTTGTGG + Intronic
911460048 1:98178100-98178122 GGTCAGAAAAGGCTTCTTTGAGG - Intergenic
914950128 1:152106479-152106501 GATCACATAGAGCATGTTGGGGG - Exonic
916003712 1:160640030-160640052 GGTCAGAGGAGGCCTCTTGGAGG - Intronic
917512981 1:175683521-175683543 GGGCAGATGAAGCAGCTTAGAGG - Intronic
919754442 1:201058115-201058137 GGTCAGAGAAGGCTTCATGGAGG - Intronic
919885471 1:201930941-201930963 GTTCAGATAAAGCAACAAGGAGG + Intronic
920254003 1:204642049-204642071 GACCAGGTAAAGCAGCTTGGAGG + Intronic
921354066 1:214268647-214268669 AGACAGATTAAGCATCTTTGAGG - Intergenic
923221075 1:231893699-231893721 GGGCATATAAAGCCTCTGGGTGG + Intronic
1063024265 10:2162530-2162552 AGTGAGAGAAAGCATCTCGGAGG - Intergenic
1063550503 10:7028468-7028490 AGTCAGATAAAGGATCATTGAGG + Intergenic
1066104582 10:32145414-32145436 TGTCAGATGTAGCATCCTGGAGG - Intergenic
1068022595 10:51603821-51603843 GATCAGAGAAGGCCTCTTGGAGG + Intronic
1068964391 10:62896931-62896953 GGTCAGAGAAAGCTGCTTTGTGG - Intronic
1069551349 10:69366602-69366624 GGTCAGACAGAACATCTCGGAGG - Intronic
1069932388 10:71891508-71891530 GGTCAGAGAGAGCTTCCTGGAGG + Intergenic
1071745398 10:88413095-88413117 GGTCATATAATGCATCGAGGTGG + Intronic
1072296689 10:94015273-94015295 GCTAAGATAAAGCAGCTTTGAGG - Intronic
1073867558 10:107822369-107822391 GGTCAGAAAATGCATCCTGGAGG + Intergenic
1074928875 10:118103284-118103306 GGTCAGATAGAGCACCTGGGAGG - Intergenic
1076104776 10:127812948-127812970 GGTTAGAGAAAGCTTCATGGAGG - Intergenic
1078085115 11:8229315-8229337 GGTCAGTCAAAGGATCTTTGGGG + Intronic
1078401779 11:11034714-11034736 GGTCAGATGAGGGATCCTGGTGG + Intergenic
1078846803 11:15125880-15125902 GGTCAGAGTAAGCTTCTGGGTGG + Intronic
1083149286 11:60781803-60781825 GGCCAGATAAGGCTTCCTGGAGG - Intergenic
1083455715 11:62777468-62777490 GGTTAGAGAAAGCTTTTTGGAGG + Intronic
1085298298 11:75443319-75443341 GGGCAGGTAAAGGATCTGGGGGG - Intronic
1085721401 11:78915245-78915267 GGTCAGAGAAGGCTTCCTGGAGG - Intronic
1089839194 11:121399732-121399754 GCTCAGTGAAGGCATCTTGGAGG - Intergenic
1090210626 11:124918885-124918907 TGTCAGCAAAGGCATCTTGGAGG - Intergenic
1095045445 12:37499122-37499144 AGTCAGATAAAGGATTTGGGTGG - Intergenic
1096141297 12:49244875-49244897 GGTCTGAGCAAGCATCTGGGAGG - Intronic
1098093918 12:66934339-66934361 GGTCAGGGAAAGTTTCTTGGAGG - Intergenic
1100111816 12:91254560-91254582 GATCAAATAAAGCATCTGAGAGG - Intergenic
1101083962 12:101216223-101216245 GGTCAGAGAGGGCCTCTTGGAGG - Intergenic
1101254378 12:102963358-102963380 GGTCAGGAAAAGCTTCTTGGAGG - Intergenic
1103162303 12:118739667-118739689 GGTCAGGGAAGGCATCCTGGAGG + Intergenic
1104057119 12:125239092-125239114 GGTCAGGGAAAGCTTCCTGGAGG + Intronic
1104763932 12:131314338-131314360 GGTCAGAGAAGCCTTCTTGGAGG - Intergenic
1106844938 13:33728464-33728486 GGACAGAGAAAGCATGATGGTGG + Intergenic
1107762479 13:43695341-43695363 GGTCAGTTAAAGCACTTTGATGG - Intronic
1107788565 13:43978155-43978177 GGTCAGAGAATGAACCTTGGTGG - Intergenic
1108278957 13:48841600-48841622 GGTCAGATAAATAATTTTGGGGG - Intergenic
1109638715 13:65158305-65158327 GGTCAGATATTGCAATTTGGAGG + Intergenic
1110577472 13:77075538-77075560 GGTCAGAGAAGGCTTCTTAGGGG - Intronic
1112131380 13:96527595-96527617 GGTCAGATAAAGCATCTTGGAGG + Intronic
1112809365 13:103199745-103199767 GGTCAGATAACCCTTCTTAGTGG - Intergenic
1114234816 14:20814545-20814567 GCTCACATAAAGCCTGTTGGTGG - Intergenic
1116773325 14:49151981-49152003 GGTCAGAGAAAGCTTCTTTGAGG - Intergenic
1117619586 14:57570901-57570923 GGTCACATCAGACATCTTGGTGG + Intronic
1117826041 14:59704718-59704740 TGGCAGTGAAAGCATCTTGGGGG + Intronic
1117982857 14:61358926-61358948 GGTCAGAGAAGGCTTCCTGGAGG - Intronic
1120762823 14:88301552-88301574 GGTTAGAGAAAGATTCTTGGAGG + Intronic
1125728635 15:41880812-41880834 GGTCAGGGAAGGCACCTTGGAGG - Intronic
1126289678 15:47059372-47059394 AGTCAGATAAAGGATTTGGGTGG + Intergenic
1127213250 15:56797123-56797145 GGTGATATAAAATATCTTGGAGG + Intronic
1129242444 15:74259546-74259568 GTGCAGATAAAGCAACTGGGTGG - Intronic
1130513112 15:84605391-84605413 GGTCAGAGAAGGCTTCCTGGAGG + Intronic
1132923750 16:2416003-2416025 GGTAAGATCAAGCTTTTTGGAGG + Intergenic
1133500765 16:6364615-6364637 GGTCATATAGAGGATCTTTGTGG + Intronic
1134046299 16:11103603-11103625 GGTCAGAGAAGGCTTCTTGCAGG - Intronic
1134805284 16:17118944-17118966 GGTCAGATAAAGACTCTGTGAGG - Intronic
1135925420 16:26689643-26689665 GGTCAGGAAAAGCATTTAGGAGG - Intergenic
1136459672 16:30401814-30401836 GGTCAGAGTAGGCTTCTTGGAGG - Intergenic
1138172647 16:54867222-54867244 GGTCAGAGGAAGCACGTTGGTGG - Intergenic
1139364108 16:66423037-66423059 GGTCAGAAAAGGCCTCTTTGAGG - Intergenic
1141833789 16:86524945-86524967 CTTCAGATAATTCATCTTGGTGG + Intergenic
1143874387 17:9980840-9980862 GGTCAGGGAAGGCTTCTTGGAGG + Intronic
1144183824 17:12777465-12777487 TGTCATATAATGCATTTTGGTGG - Intergenic
1145831803 17:27922266-27922288 AGTCAGAAAAGGCTTCTTGGAGG - Intergenic
1149206784 17:54257016-54257038 GTTCTGATAAATCATCATGGTGG - Intergenic
1151058892 17:71067844-71067866 GGAAAGATAAAGAATCTTGTAGG - Intergenic
1153881033 18:9422017-9422039 GCTCATACAAAGCCTCTTGGTGG - Intergenic
1155799311 18:30081412-30081434 GTCCAGATAAAGCATTTTTGGGG + Intergenic
1155909389 18:31490660-31490682 GGTTAGAAAAGGCTTCTTGGAGG - Intergenic
1156665786 18:39405101-39405123 AGTCAGTTAAAACATTTTGGTGG + Intergenic
1157841993 18:50967666-50967688 GGTCAGGCAAAGGATCTTAGTGG + Intergenic
1157889938 18:51406071-51406093 GATCAGATAAAGCAGTGTGGAGG + Intergenic
1158072190 18:53485551-53485573 TTTCAGATAAAGCATTTTGATGG - Intronic
1158925454 18:62253152-62253174 GGTCAGAGAAAGAATCTCTGAGG + Intronic
1161809255 19:6462335-6462357 GGTAAGAGAAAGCACCTTGTAGG - Intronic
1162766536 19:12923207-12923229 GGTCAGTGAAGGCATCATGGAGG - Intronic
1165472218 19:36010235-36010257 GGGCAGATAGAGCATCTGGGAGG + Intronic
1166423014 19:42653035-42653057 GGTCAGATAGCCCATCTGGGAGG - Intronic
1166751433 19:45165587-45165609 GGTCACCTGGAGCATCTTGGTGG - Intronic
1167533208 19:50031886-50031908 GGTCAGGGAAAGCTTCCTGGAGG - Intronic
926219353 2:10924829-10924851 GGTCAGAGAAGGCTTCCTGGGGG - Intergenic
927152121 2:20202331-20202353 GGTAGGACCAAGCATCTTGGGGG - Exonic
928511201 2:32005606-32005628 GTATAGATGAAGCATCTTGGTGG - Intronic
931258464 2:60596042-60596064 GGTCACATAGACCTTCTTGGAGG - Intergenic
935066665 2:99654370-99654392 AGTCAGTAAAAACATCTTGGTGG - Intronic
936824618 2:116566241-116566263 GGTTATACAAAGTATCTTGGGGG - Intergenic
937900302 2:127014641-127014663 GATCAGAGAAAGCTTCCTGGAGG - Intergenic
939041269 2:137191690-137191712 GGTCAGAGAGAGCTTCTTGGAGG - Intronic
939983810 2:148811477-148811499 GGTCAGAGAAGGCCTCTTGAAGG - Intergenic
944624718 2:201559186-201559208 GGCCAGAGAAACCATCTTGCAGG + Intronic
948438255 2:237967958-237967980 AGCCAGAGAAAGCTTCTTGGAGG + Intronic
1169557404 20:6766245-6766267 GGTCAAATAAGGTATTTTGGAGG - Intergenic
1170474771 20:16703951-16703973 GGTCAGAGAAAGGCTCTCGGAGG + Intergenic
1171540000 20:25942719-25942741 AGTCAGATAAAGGATTTGGGTGG - Intergenic
1172306549 20:33884801-33884823 GGTCAGGGAAGGCCTCTTGGAGG - Intergenic
1172880191 20:38194849-38194871 GGTCAGGGAAGGCATCTAGGAGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1180223472 21:46374951-46374973 GCTCAGATAAAGCATCGCCGCGG - Intronic
1184940013 22:47757219-47757241 TGTCAGGTAAAGAATGTTGGTGG - Intergenic
949369628 3:3320060-3320082 GGTCAGAGAAAGCTTCTGTGAGG - Intergenic
950043399 3:9934124-9934146 GGTCTGATAAAGAATATTAGGGG - Intronic
951355620 3:21663440-21663462 GGCCAGAAAAAGCACCTTGATGG + Intronic
951578894 3:24141392-24141414 GGTCAGAAGAAGCATCTCTGAGG - Intronic
952717231 3:36492304-36492326 GGTGTGCTAAAGCATCTTTGTGG - Intronic
953303224 3:41800110-41800132 GGTAAGATGAAGCATCTTTTGGG - Exonic
955783679 3:62513250-62513272 TGTCAGATAAAGGATATTTGGGG - Intronic
955869674 3:63424301-63424323 GTTCAAAGAAAACATCTTGGTGG + Intronic
957351333 3:79025257-79025279 GGACAGATAAAGCCTCTCTGAGG - Intronic
959635613 3:108564494-108564516 GGTCTGCTAAAGCATAGTGGAGG - Intronic
960864717 3:122187624-122187646 GGTCAGGGAAAGGTTCTTGGAGG + Intronic
960942597 3:122944344-122944366 AGTCAGAGAAGGCTTCTTGGAGG - Intronic
962103036 3:132362642-132362664 GGTCAGAGAAGGCTTCTTGGAGG + Intronic
962312314 3:134335344-134335366 GGTCAGAGACAGGATTTTGGAGG - Intergenic
963595902 3:147324461-147324483 GGTTAGGTAAAGCATCCTGAAGG + Intergenic
963821397 3:149898872-149898894 GGTCAGAGAAAGCTTCTGTGAGG + Intronic
965167352 3:165212061-165212083 GGTCAGGCAAAGCTACTTGGAGG - Intergenic
966135805 3:176696974-176696996 GGTCAATTAAAGTATCTTGTTGG - Intergenic
967033969 3:185633741-185633763 GGGCAGAGAAATCAACTTGGTGG - Intergenic
967140600 3:186555436-186555458 GATAAAGTAAAGCATCTTGGAGG - Intronic
967886970 3:194340072-194340094 GTTAAGATAAAGGATCGTGGAGG + Exonic
969185385 4:5470600-5470622 GGTCGGCTGATGCATCTTGGGGG - Intronic
970226990 4:13869516-13869538 GGTCTGAAAAAGCATCTTCAAGG - Intergenic
975358220 4:73433293-73433315 GGTCAGATAAGGCTTCCTGGAGG - Intronic
976947656 4:90790558-90790580 AGTCAGAGAAAGCATTCTGGGGG - Intronic
982427316 4:155280351-155280373 GATCTGATAAATCATCTAGGAGG - Intergenic
986723692 5:10578520-10578542 GGACAGATAGATCTTCTTGGGGG + Intronic
993682349 5:90895362-90895384 GGTCAGAAAAAGCATCACTGTGG + Intronic
997405869 5:133646187-133646209 GGTCAGGGAAAGCATCTTTGAGG + Intergenic
998920370 5:147061314-147061336 GGTCAGGGAAGGCTTCTTGGAGG + Intronic
999125240 5:149241426-149241448 GGTCAGGAAGAGCTTCTTGGAGG + Intronic
999507569 5:152214024-152214046 CTTCAGATAAAGAATCTTGAGGG + Intergenic
1000845973 5:166280604-166280626 GATCAAAGAAAGCATCTAGGAGG + Intergenic
1000978642 5:167792685-167792707 GGTCAGATAAATCTGCATGGGGG + Intronic
1001557011 5:172643449-172643471 GGTCAGGGAAAGCTTCCTGGAGG - Intronic
1005018830 6:21398724-21398746 GGTTAGATAAAGCTTCATGGAGG + Intergenic
1006397880 6:33798818-33798840 GGTCAGGGAAGGCCTCTTGGAGG - Intronic
1008681704 6:53879142-53879164 AGTCAGGTTAACCATCTTGGAGG + Intronic
1008746968 6:54683718-54683740 GGTCAGATAAAGAATATTTCAGG - Intergenic
1012418627 6:99037245-99037267 GGTCAGCAAATGCATCTTGCAGG - Intergenic
1013415490 6:109920906-109920928 GGTCTGGTAAAGCTTCATGGTGG - Intergenic
1016380747 6:143476103-143476125 GGTCAGAAAAGGCCTCTTTGAGG + Intronic
1017947756 6:159109580-159109602 GGTCAGGGAAAGCTTCTTGGAGG + Intergenic
1018209164 6:161463547-161463569 GGTCAAAGAAAGCATCTGGTAGG - Intronic
1018276056 6:162132824-162132846 GGGCAGAGAAACCATCTTAGAGG + Intronic
1022493777 7:30840353-30840375 GGTCAGGAAAGGCTTCTTGGAGG + Intronic
1023767801 7:43528259-43528281 GGTCAATGAAAGCATCTTTGAGG + Intronic
1025291436 7:57728960-57728982 AGTCAGATAAAGGATTTGGGTGG - Intergenic
1026929328 7:74215243-74215265 GGTCAGGGAAGGCTTCTTGGAGG - Intronic
1028701588 7:93787057-93787079 GGACATATAATTCATCTTGGAGG - Intronic
1029964839 7:104728605-104728627 GGTCAGGTAAGGCCTCTTGAGGG - Intronic
1030065016 7:105652757-105652779 GCTCAGAAAAAGCTTCTTGAAGG - Intronic
1030228695 7:107181673-107181695 GGGAAGAAAAAGCATCTTGAAGG - Intronic
1030453492 7:109743666-109743688 GATCATATACAGTATCTTGGAGG + Intergenic
1031555483 7:123170408-123170430 GATCAGATAAAGCTTCTGGATGG + Intronic
1032753802 7:134869136-134869158 AGTCAGAGAAAGTTTCTTGGTGG + Intronic
1033588872 7:142794258-142794280 GGCCAGAGAAAGCTTTTTGGAGG - Intergenic
1035684794 8:1515281-1515303 GGCCAGAGAAACCATCATGGAGG + Intronic
1037826258 8:22162411-22162433 GATCAGAGAAGGCTTCTTGGAGG - Intronic
1038835830 8:31121671-31121693 GGTCAGATAAGGCTTCCTTGTGG + Intronic
1040569886 8:48598819-48598841 GGTCAGAACAAGGATCTTTGAGG - Intergenic
1041023545 8:53661172-53661194 GGTCAGAGAAGGCCTCTGGGAGG + Intergenic
1041336388 8:56789324-56789346 GGACAGATCAAGGATGTTGGTGG - Intergenic
1044899939 8:96933641-96933663 GGTCAGCAAAAGCTTCCTGGGGG + Intronic
1045657844 8:104405543-104405565 CCTGAAATAAAGCATCTTGGAGG + Intronic
1047693368 8:127379153-127379175 GTTCAGAAAAGGCTTCTTGGAGG - Intergenic
1047721577 8:127644982-127645004 GGTCACAGAAAGCCTCTTGAAGG - Intergenic
1048141885 8:131802835-131802857 AGTCAGATAAAGCTTTCTGGAGG - Intergenic
1048599834 8:135907754-135907776 GTTAAGATAAAGCCTCTTTGAGG - Intergenic
1050715601 9:8521513-8521535 GGTGGGATAGAGAATCTTGGTGG + Exonic
1052850841 9:33377559-33377581 GCTCACACAAAGCATGTTGGTGG - Intergenic
1053554358 9:39119898-39119920 GGTTAGATAAAGCCTATTGATGG - Intronic
1053818452 9:41940049-41940071 GGTTAGATAAAGCCTATTGGTGG - Intronic
1054108716 9:61083696-61083718 GGTTAGATAAAGCCTATTGATGG - Intergenic
1054165063 9:61716728-61716750 AGTCAGATAAAGGATTTGGGTGG + Intergenic
1054612141 9:67247429-67247451 GGTTAGATAAAGCCTATTGATGG + Intergenic
1057802724 9:98199812-98199834 GGTCAGGGAAGGCTTCTTGGAGG + Intronic
1058129090 9:101229001-101229023 GGTCAGATGAATCTCCTTGGGGG - Intronic
1059720884 9:116959192-116959214 GATCAGATAAGGCTTCCTGGAGG + Intronic
1060561495 9:124548731-124548753 GGTCAAGGAAAGCTTCTTGGAGG - Intronic
1187068379 X:15863564-15863586 GGTCAGACAATGTTTCTTGGAGG + Intergenic
1187155981 X:16720712-16720734 GATCACAGAAAGCATCTTTGAGG + Intronic
1188200062 X:27286248-27286270 GCTCACACAAAGCCTCTTGGTGG - Intergenic
1188369486 X:29351167-29351189 GGTCTGATAAGGAATTTTGGGGG + Intronic
1188411392 X:29876230-29876252 TGTTTGATAAAGCATATTGGTGG - Intronic
1189047297 X:37606679-37606701 GTTCAGGTAAAGCCTCGTGGGGG - Intronic
1191739385 X:64420712-64420734 AGTCAGAGAAAGCTTTTTGGTGG - Intergenic
1192186014 X:68947273-68947295 AGTCAGAGAAAGCTTCCTGGAGG - Intergenic
1192552266 X:72063954-72063976 GCTCAGAGAAAGCTTCATGGGGG + Intergenic
1193714899 X:84926742-84926764 GGTCAGCTGTAGCTTCTTGGAGG + Intergenic
1196324405 X:114385316-114385338 GGTCAGAAAAAGCCTATTTGTGG - Intergenic
1196423818 X:115549682-115549704 GGTCACATAAACCATTTTAGAGG - Intergenic
1196745443 X:119067795-119067817 GGTCAGAGAAGGCCTCTTTGAGG + Intergenic
1197292477 X:124675834-124675856 GGTCAGAGAAGGCCTCTTGGAGG + Intronic
1197706489 X:129638193-129638215 GGTCAGAGAAAGCTTCCTGGAGG - Intergenic
1197823102 X:130561426-130561448 GGACAGAGAAGGCATCCTGGAGG + Intergenic
1199220729 X:145312901-145312923 GGTCAGATAACGTAATTTGGAGG + Intergenic
1200023278 X:153230063-153230085 GAACAGCTAAAGCATGTTGGTGG - Intergenic
1200085725 X:153603749-153603771 GGAGAGCTAAAGCATCTTAGCGG - Intergenic
1200296783 X:154927879-154927901 GGTCATAGAAATCATCTTTGAGG - Intronic