ID: 1112133870

View in Genome Browser
Species Human (GRCh38)
Location 13:96553646-96553668
Sequence TGCACAGATGTGCCCACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112133870 Original CRISPR TGCACAGATGTGCCCACATT TGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901032172 1:6313584-6313606 CCCACAGATGTGGCCACATGAGG + Intronic
901672295 1:10862958-10862980 TGACCAAATGTTCCCACATTGGG + Intergenic
901759151 1:11459405-11459427 GGCACAGCTGTGCCCAGATAGGG - Intergenic
901843128 1:11966075-11966097 TGCACAGGTGTGCCCATAGGAGG - Intronic
902818944 1:18931895-18931917 TGCACAGATGTGTACACATGGGG + Intronic
904533951 1:31186884-31186906 TCCCCAGAGGTGGCCACATTCGG - Intronic
909260116 1:73477199-73477221 TGGAAATATTTGCCCACATTTGG + Intergenic
909861854 1:80616431-80616453 TGCAAAGATGTTTCTACATTTGG + Intergenic
910431149 1:87160863-87160885 TGCACACCTGTGGCCACATGGGG + Intronic
915873861 1:159591439-159591461 TCCACAGAAGCCCCCACATTAGG + Intergenic
916784697 1:168077984-168078006 GGCACATATGTATCCACATTAGG + Intergenic
918218410 1:182413930-182413952 TGTACATAGGTGGCCACATTAGG + Intergenic
923226224 1:231941141-231941163 TGCACAGATATCCCTACATTGGG + Intronic
923511848 1:234659819-234659841 CGCACTGATCTGCCCACAATGGG + Intergenic
1063820186 10:9825641-9825663 TGCTCAGATACGCCCACATGGGG + Intergenic
1065035517 10:21634822-21634844 TGCTCAGATTGTCCCACATTTGG + Intronic
1067165709 10:43864887-43864909 TGTCCAGATGTGCCCACAGCAGG + Intergenic
1067720243 10:48722633-48722655 TGCACACATGTGAACACCTTTGG - Intronic
1069806825 10:71131577-71131599 TGCTCAGATGAGCCCACAGATGG + Intergenic
1070491144 10:76977690-76977712 TGCACAGATCTGGGGACATTGGG + Intronic
1071279929 10:84091841-84091863 TGCATAAATGTGCCCATCTTTGG - Intergenic
1075446456 10:122516806-122516828 GGCACTGCTGAGCCCACATTTGG - Intergenic
1075799317 10:125143021-125143043 TGGGCAGAGGTGGCCACATTAGG - Intronic
1076378778 10:130011099-130011121 TGCTGAGATGGGCCCACAGTTGG + Intergenic
1082723288 11:56705451-56705473 TGAACAGATGAGTCCACATGGGG - Intergenic
1087280108 11:96200504-96200526 AGCACAAAAGTTCCCACATTTGG + Intronic
1088655053 11:111991024-111991046 TGCACAGATATACTCCCATTTGG - Intronic
1089561210 11:119344131-119344153 TACCCAGATGTTCCCACACTGGG - Intronic
1089635050 11:119806734-119806756 TGCACTCATGAGCCCACACTGGG - Intergenic
1091074346 11:132601178-132601200 TTCACAGCTGTGCCCACATGGGG - Intronic
1096844359 12:54397471-54397493 TGCACAGCTGTGGCCACCTGGGG + Exonic
1098043269 12:66373615-66373637 TGCACATGTGTGCCAACACTTGG - Intronic
1099437899 12:82665652-82665674 TGCACAGCTTTGCCCATAATAGG - Intergenic
1099788964 12:87305777-87305799 TGACCAGATGTGCCTATATTGGG + Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1108078893 13:46712052-46712074 TGTAAAGATGTTCCTACATTCGG - Intronic
1108935354 13:55875065-55875087 TTCACAGAAATGCCCACAGTAGG - Intergenic
1110042696 13:70785018-70785040 TGCACAAATGTTCCAACATGTGG + Intergenic
1111980762 13:95013026-95013048 TGCACAGAGGAGCCAGCATTCGG + Intergenic
1112133870 13:96553646-96553668 TGCACAGATGTGCCCACATTTGG + Intronic
1112310219 13:98311582-98311604 TGCACACACGTGCACACGTTGGG + Intronic
1112868644 13:103940528-103940550 TGCAAGGATGTGCACAAATTGGG + Intergenic
1114128028 14:19753706-19753728 TGCACAGATGTGAACAGAGTGGG - Intronic
1114777786 14:25504813-25504835 TGTAGAGATTTGCCCACATTGGG + Intergenic
1116944148 14:50820300-50820322 TGCACATCTTTGCCCTCATTTGG - Intronic
1117451372 14:55853261-55853283 TTCCAAGATGTGCCAACATTTGG - Intergenic
1119924901 14:78484360-78484382 TGCAGAGATGTGCCCAGCTGGGG + Intronic
1120489116 14:85154122-85154144 TTCACAGATCTGCACACAATGGG + Intergenic
1121000892 14:90451463-90451485 CGCACTTATGTGTCCACATTTGG + Intergenic
1121735052 14:96212664-96212686 TGCACTGCTGTGCCCAACTTTGG - Intronic
1123062127 14:105599187-105599209 GGCACAGCTGTGCACACACTAGG - Intergenic
1123086874 14:105720915-105720937 GGCACAGCTGTGCACACACTAGG - Intergenic
1124186117 15:27531041-27531063 AGAAGAGATGTGTCCACATTAGG + Intronic
1124363159 15:29053720-29053742 TGAACAGATGTGCCCTCACATGG + Intronic
1124956897 15:34366110-34366132 TGCACAGATCTTTCCACTTTGGG + Intronic
1126037807 15:44563773-44563795 TGCACCACTGTGCCCACCTTAGG + Intronic
1126066460 15:44829834-44829856 TGCTCAGATTTGTCCATATTTGG + Intergenic
1126093420 15:45071035-45071057 TGCTCAGATTTGTCCATATTTGG - Intronic
1126592213 15:50351889-50351911 AGCTCTGATGTGCCTACATTGGG - Intronic
1129231813 15:74201274-74201296 AGAACAGATGTGCACACATCTGG + Intronic
1134102775 16:11463890-11463912 TGTACAGATATGTCCACATGTGG + Intronic
1141618876 16:85226018-85226040 TGCTGAAATGTCCCCACATTAGG + Intergenic
1142008678 16:87702463-87702485 TGCTCTGATGTGGCTACATTTGG - Intronic
1144865531 17:18333039-18333061 TGCAATGATGGGCCCACCTTGGG - Intronic
1144941577 17:18945992-18946014 TGGGGAGATGTCCCCACATTTGG - Intergenic
1147872369 17:43596627-43596649 TGCCCAGAAGTAGCCACATTTGG - Intergenic
1149450863 17:56748964-56748986 TGCACAGATGGGTCCCCAGTCGG + Intergenic
1151253048 17:72852679-72852701 TGCACTTCTGTGCACACATTGGG + Intronic
1151490309 17:74429067-74429089 GGCACAGGTGTTCCCACCTTTGG + Intronic
1152856444 17:82667422-82667444 TGCACAGGTGTGCTCAGATCAGG - Intronic
1153859740 18:9189705-9189727 TGAACAGATGTGCTGTCATTAGG - Intronic
1155017689 18:21861798-21861820 TGCACAGATGTGTCTACTTTTGG + Intronic
1156844086 18:41643545-41643567 TACACACATGTGCTCACATATGG + Intergenic
1157229597 18:45902320-45902342 TGCACAGATGTAACCAAGTTAGG + Intronic
1160919864 19:1514270-1514292 TTCACAGCTGTGCACACAGTAGG - Intergenic
1161614752 19:5263882-5263904 TGCACACCTGTGCCCACAGGCGG + Intronic
1163724220 19:18913420-18913442 GGCACAGATGTCACCACACTGGG - Intronic
1164538464 19:29104447-29104469 GGGACAGCTGTGCCTACATTTGG - Intergenic
1165894778 19:39135076-39135098 TACACAGATTTGACCACCTTGGG - Intronic
925579461 2:5395913-5395935 TGCTGAGATGTGGGCACATTTGG + Intergenic
926391366 2:12396873-12396895 TGGAAAGGTGTGCCCTCATTTGG + Intergenic
926484587 2:13438754-13438776 TTCACAGATCAGCCCACAGTGGG - Intergenic
927747899 2:25639515-25639537 TGCACATAAGTGTCCTCATTTGG + Intronic
928116407 2:28548228-28548250 TGCGCAGATTTACCTACATTTGG + Intronic
928617765 2:33056517-33056539 TGCAAAAATGTGTCCAGATTTGG + Intronic
929098334 2:38285432-38285454 TCAACAGATTTGGCCACATTGGG + Intergenic
932813873 2:74845975-74845997 GGCACAGGTGTGCCCACCCTGGG - Intronic
936832491 2:116664890-116664912 TGTATAGATGTGTTCACATTGGG + Intergenic
938077553 2:128347768-128347790 TGCACATGTGTGTGCACATTTGG - Intergenic
939829299 2:147053472-147053494 GGCACAGATGTGGCCACAAGAGG - Intergenic
940790480 2:158025731-158025753 TACACAGATGTGTACACATATGG - Intronic
948948319 2:241233129-241233151 AGCACAGCTTTGCCCACAGTGGG - Intronic
1169574386 20:6941968-6941990 TGCACTGATGTGAACACCTTGGG + Intergenic
1170004100 20:11646870-11646892 TGATCAGATGTGCACACATTTGG + Intergenic
1171405481 20:24909729-24909751 AGCAGTGATGTGCCCACATGGGG + Intergenic
1172882358 20:38210267-38210289 TGCCCAAATATGCCCACAGTAGG - Intergenic
1173314881 20:41934098-41934120 TGCACAGAGGGACCCACACTTGG - Intergenic
1175325515 20:58124973-58124995 TGCCCAGATCTTCCCACATCTGG - Intergenic
1179137744 21:38695606-38695628 TGAACAGCTGTGCTCTCATTAGG - Intergenic
1180013538 21:45067743-45067765 TTCACAGCTGTGTCCACTTTGGG + Intergenic
1182855227 22:33511135-33511157 TGGACAGATGTTTCCACATGTGG + Intronic
1184869259 22:47224891-47224913 CGCACAGATGTTTCAACATTAGG - Intergenic
949232382 3:1766557-1766579 TAAACAGATGTCCTCACATTAGG - Intergenic
952928830 3:38343939-38343961 TGGACAGATGAACCCACATAGGG - Intergenic
955804936 3:62723978-62724000 GACACAGAAGTGCCCACATAAGG - Intronic
955955862 3:64289133-64289155 TGCAGAGATGTGCCCTCCTTAGG + Intronic
956291498 3:67665163-67665185 TCCACAATTGTACCCACATTGGG - Intergenic
956475893 3:69619914-69619936 TTCCCAGATGTGACCAAATTAGG + Intergenic
957351807 3:79033235-79033257 TCCACAAATGTGCCAACAATTGG - Intronic
957862238 3:85969037-85969059 TGGAGAGAAGTGCCCACTTTGGG - Intronic
961005844 3:123404825-123404847 TGCCCAGATGTGTCCACATTTGG - Intronic
966139923 3:176745378-176745400 CCCACAGCTGTGCCCACATCTGG + Intergenic
968632552 4:1659522-1659544 TGCATAGAGGTGGTCACATTTGG - Intronic
969895419 4:10299465-10299487 GGCACACATGTTCCCTCATTTGG - Intergenic
973644803 4:52939826-52939848 TGTCCAGATTTGCACACATTTGG + Intronic
973977778 4:56280437-56280459 TGCACAAATGTGCCTTCCTTAGG + Intronic
975905256 4:79203325-79203347 TGCACACATGCACACACATTAGG + Intergenic
978378999 4:108106549-108106571 TGCACTGATGTACACACATTAGG + Intronic
980207112 4:129733790-129733812 TGCATAGATCTTCCTACATTTGG - Intergenic
983178750 4:164622957-164622979 TGCCCTGCTGTGGCCACATTAGG - Intergenic
986630351 5:9766661-9766683 TGCACTGTTTGGCCCACATTCGG - Intergenic
993219258 5:85069750-85069772 TACACTGTTGTGCCCACCTTTGG + Intergenic
996335076 5:122375083-122375105 TGTACAGATGTGCAAATATTTGG + Intronic
1000713863 5:164615337-164615359 TGCACAGAATTGCCTACATTTGG + Intergenic
1007843642 6:44736589-44736611 TGGACAACTGTGCCCACCTTTGG - Intergenic
1008292551 6:49735540-49735562 TGCACTGGTTTGCCCACTTTTGG + Exonic
1010441362 6:75898773-75898795 CGCACAGTGGTGCCCAAATTAGG - Intronic
1011197617 6:84798319-84798341 TCCACAGATGTGTCCACAGAAGG - Intergenic
1017095400 6:150800373-150800395 TGCACAGAGATACCCAGATTGGG + Intronic
1018786043 6:167108734-167108756 GGCCCAGATGTGCCCACTTTGGG + Intergenic
1019198298 6:170295304-170295326 TGCACAGATGTGTTCACACTCGG + Intronic
1019451257 7:1099748-1099770 TGCACAGATGTGGCCAGGTGAGG + Intronic
1019616342 7:1964416-1964438 TGCACAAATGAGCCCGCATGTGG - Intronic
1021603728 7:22390276-22390298 TTCATAAATGTGCCAACATTCGG + Intergenic
1023149171 7:37183612-37183634 AGCACAGATGTGCTCACAGCAGG + Intronic
1025618200 7:63142851-63142873 TACATAGTTGTGCCCACCTTTGG + Intergenic
1025962413 7:66234567-66234589 TGCCAAGATGTGTCCAGATTGGG + Intronic
1027188594 7:75985586-75985608 CGCACAGATGTGCACAGAGTTGG - Exonic
1031954147 7:127924849-127924871 TAGATAGATGTACCCACATTTGG + Intronic
1031981755 7:128131646-128131668 TGCTCAAATATTCCCACATTTGG - Intergenic
1033198054 7:139343980-139344002 TGCCCAGATTTATCCACATTTGG + Intronic
1033278465 7:139989729-139989751 TGCAGAGATGGGCCCGCATGGGG - Intronic
1034211605 7:149368429-149368451 TGTACAGATGGGCACAGATTGGG - Intergenic
1034746221 7:153526148-153526170 TGCACAGATATATGCACATTTGG + Intergenic
1034749646 7:153556790-153556812 TTCATAGATGTGCCCATTTTAGG - Intergenic
1036333269 8:7848531-7848553 TGCACAAATGTGCACACACACGG + Intronic
1037965153 8:23128217-23128239 AGGACAGAAGTTCCCACATTAGG - Intergenic
1038978744 8:32732483-32732505 TGGACAGATGTGCCTTCATCTGG + Intronic
1040802646 8:51360247-51360269 TGCATAGATGTGTACACATATGG - Intronic
1044850178 8:96419891-96419913 TTCACAGAAGTGCCCATATTTGG - Intergenic
1048305234 8:133279479-133279501 TGCACAGGTGTCCCCAGTTTGGG - Intronic
1052170182 9:25384793-25384815 TGCAGTTATGTGCCCTCATTGGG - Intergenic
1052340888 9:27363177-27363199 TACACAGATCAGCCCTCATTTGG - Intronic
1056231010 9:84544093-84544115 TACACACATGCGCACACATTAGG - Intergenic
1056825589 9:89874358-89874380 TGCCCAGAGGTGCCCAGTTTGGG + Intergenic
1056826543 9:89879965-89879987 TGCACAGTTGTACGCTCATTGGG - Intergenic
1058664114 9:107294084-107294106 TGCACGGTAGTGCTCACATTAGG + Intronic
1059576140 9:115490805-115490827 TGTACAGAAGTGTTCACATTGGG - Intergenic
1059812389 9:117870015-117870037 TGCACAGTTGGGCCTACATTGGG + Intergenic
1059957699 9:119535440-119535462 TGGATAGATTTGTCCACATTTGG + Intergenic
1061232854 9:129325020-129325042 TGCACAGACCTGCCCACAAGTGG - Intergenic
1061374907 9:130218175-130218197 TGCACACATGTGCATGCATTTGG - Intronic
1061944792 9:133902550-133902572 TGCAGACAGGTTCCCACATTTGG + Intronic
1186563480 X:10637839-10637861 TGGACAAATGTGCCACCATTAGG + Intronic
1188981643 X:36732185-36732207 TGCACAGAAGAGCCCAGACTAGG - Intergenic
1191605414 X:63057334-63057356 TGCACCAAAGAGCCCACATTGGG + Intergenic
1194970878 X:100342247-100342269 TGCACAGAGGTTCCCACTATTGG + Intronic
1197275185 X:124469968-124469990 TGCTCAGATGGGCATACATTAGG + Intronic
1199369707 X:147033266-147033288 TAAACAGATGTGCTCTCATTCGG - Intergenic
1199715075 X:150502175-150502197 TGCAAAGACTTGCCCACAATAGG + Intronic