ID: 1112136282

View in Genome Browser
Species Human (GRCh38)
Location 13:96581855-96581877
Sequence CTGAGAGTTTGTACTGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112136277_1112136282 30 Left 1112136277 13:96581802-96581824 CCAAGCCAAGGGGAGCAGGGAAA 0: 1
1: 0
2: 2
3: 87
4: 1071
Right 1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 137
1112136278_1112136282 25 Left 1112136278 13:96581807-96581829 CCAAGGGGAGCAGGGAAAAAAAG 0: 1
1: 0
2: 3
3: 53
4: 462
Right 1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG 0: 1
1: 0
2: 1
3: 17
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112136282 Original CRISPR CTGAGAGTTTGTACTGAAGT GGG Intronic
910600142 1:89022402-89022424 CTGAGAGTTTGAAATGCACTAGG - Intronic
910635967 1:89408035-89408057 CTGAGAGTTTGAAATGCACTAGG + Intergenic
915948539 1:160171995-160172017 CTGAGAGTTTCTAATTAAATCGG - Intronic
918843516 1:189577453-189577475 CTGAGAGTTCGCAGTGAGGTAGG - Intergenic
920531241 1:206704133-206704155 CTGATAGTTTTTCCTGGAGTTGG + Intronic
922400604 1:225250414-225250436 CTTACAGTCTGTACAGAAGTAGG - Intronic
922462191 1:225822364-225822386 CTGAGAGTTTGTGCAGGAGGGGG - Intronic
923487451 1:234447614-234447636 CAAAGATTTTGTACCGAAGTTGG - Intronic
924328226 1:242917022-242917044 CTGAGCCTATGTCCTGAAGTAGG - Intergenic
1064051647 10:12065000-12065022 CTGAGATTTTGTATGGAAGGTGG - Intergenic
1066605271 10:37160207-37160229 CACAGAGCTTTTACTGAAGTGGG + Intronic
1066605986 10:37171312-37171334 CACAGAGCTTTTACTGAAGTGGG + Intronic
1066606769 10:37183104-37183126 CACAGAGCTTTTACTGAAGTGGG + Intronic
1066607537 10:37194853-37194875 CACAGAGCTTTTACTGAAGTGGG + Intronic
1069935516 10:71913041-71913063 CTCAGTGTGTGTACTGAAGTTGG + Intergenic
1072573626 10:96679763-96679785 TTGAGAATTTGTGCTGAAGATGG - Intronic
1074261126 10:111854562-111854584 CTGAGAGCTTATAGAGAAGTGGG - Intergenic
1077980699 11:7297637-7297659 ATGAGAAACTGTACTGAAGTTGG - Intronic
1082258115 11:50054757-50054779 CTTGGAGTTTGCAATGAAGTTGG + Intergenic
1084181412 11:67448421-67448443 CTCAGAGTGTGGACTGCAGTGGG + Intergenic
1086047980 11:82555325-82555347 ATGAGAATTAGTAATGAAGTAGG + Intergenic
1088624666 11:111721107-111721129 GTGTGAGTTTGTCCTGAAGATGG + Intronic
1089092330 11:115888310-115888332 CTGTGAGTTTGGAGTGGAGTTGG - Intergenic
1090419637 11:126565567-126565589 CTGAGACTTTGTAGAGAAGTGGG + Intronic
1091693452 12:2612191-2612213 CTGAGAGTGTTTCCTGGAGTTGG - Intronic
1093754814 12:22840957-22840979 CTGAGAGTTTATAATCTAGTAGG + Intergenic
1096687616 12:53299342-53299364 CTGAGAGTTTTTGCAGAAATGGG + Exonic
1096755125 12:53793084-53793106 CTGAGATTATACACTGAAGTTGG + Intergenic
1097455116 12:59790674-59790696 CTGAGATGTCCTACTGAAGTAGG - Intergenic
1097624870 12:61987863-61987885 CTGAGAGCTTGAATTTAAGTTGG - Intronic
1106727860 13:32504695-32504717 CTTAGAGTTGATACTGAAATGGG - Intronic
1107955936 13:45511390-45511412 CTGAGGGTTTGTTTTAAAGTTGG + Intronic
1108163430 13:47666744-47666766 TATAGAGGTTGTACTGAAGTGGG - Intergenic
1112136282 13:96581855-96581877 CTGAGAGTTTGTACTGAAGTGGG + Intronic
1112865166 13:103886396-103886418 ATGAGAGTTTGAACTAAAGTAGG - Intergenic
1113891310 13:113737016-113737038 CTGAGAGTCAGTGCTGCAGTGGG + Exonic
1114027182 14:18538574-18538596 CTGAGTGTTTGTCCTCACGTAGG + Intergenic
1114027265 14:18539389-18539411 CTGAGTGTTTGTCCTCACGTAGG + Intergenic
1114932200 14:27486840-27486862 CTGCCAGTTTGAACTGAAGAGGG - Intergenic
1117012705 14:51487047-51487069 CTGAGAGTTTCTGATGCAGTAGG - Intergenic
1117808926 14:59524651-59524673 CTGGTAGTATGTACTAAAGTTGG + Intronic
1118000287 14:61516825-61516847 CTTAGAGTTTGTAATCCAGTTGG + Intronic
1119872816 14:78031545-78031567 CTGAGAATGTGTCCTGAAGTTGG + Intergenic
1119978003 14:79046724-79046746 CTGATAGTATGTACTAAAGAGGG + Intronic
1120243313 14:81975361-81975383 GGGAGAATTTGTAGTGAAGTAGG - Intergenic
1121125717 14:91405410-91405432 CTGAGGGCTTGGAATGAAGTGGG - Intronic
1126738895 15:51758308-51758330 CTGGGAGTTTGTAGTGTAGCTGG + Intronic
1128221930 15:65975413-65975435 TTGAGACTTTTTAGTGAAGTGGG + Intronic
1130633739 15:85596670-85596692 TTCAGTGTTTGTACTGAAGATGG + Intronic
1131153964 15:90063501-90063523 CTGAGGGTTTGTGCCTAAGTGGG - Intronic
1133423566 16:5667840-5667862 ATGAGACTTTATAGTGAAGTGGG + Intergenic
1141275485 16:82583961-82583983 CTAAGTGTTTGTAATCAAGTGGG - Intergenic
1142675014 17:1508250-1508272 CTGAGGATTTGTGATGAAGTCGG + Intronic
1142720202 17:1770849-1770871 CTTAGAGATTTTCCTGAAGTAGG - Intronic
1147027687 17:37602486-37602508 CTGAGAGTTATAACTGAAGAAGG + Intronic
1151310227 17:73288231-73288253 CTAGAAGTTTGTACTGCAGTGGG - Intronic
1152942158 17:83178393-83178415 CTCCGAGTTTGTCCTCAAGTGGG - Intergenic
1153812552 18:8764766-8764788 CTGAGACTTTGTAAGGATGTTGG + Intronic
1154480970 18:14824265-14824287 CAGAGAGCTTTTATTGAAGTGGG + Intronic
1156053911 18:32974577-32974599 CTGAGAGTCTGTCTGGAAGTTGG + Exonic
1156765933 18:40655039-40655061 ATGAGTGTTTTCACTGAAGTGGG + Intergenic
1157265798 18:46220308-46220330 CTGAGATTTTGTCTTGAAGTGGG - Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159856098 18:73590171-73590193 CTGAGAGTTTGCACATAAATAGG - Intergenic
1160287348 18:77556646-77556668 CTTAGAGTTGGTGCTGAAGTGGG + Intergenic
1166189849 19:41169117-41169139 CTGAGAGCATGTACTGAAAATGG - Intergenic
1166878263 19:45911481-45911503 CAGGGAGTCTGGACTGAAGTAGG - Intergenic
928265646 2:29809343-29809365 CTGAGAGTTTGAAATCAAGATGG + Intronic
929003787 2:37375548-37375570 CTAAGAGTTTGCACTGATATAGG + Intergenic
929317324 2:40495407-40495429 CTAAGAGTTTGTCCTGAACTCGG - Intronic
929730518 2:44486534-44486556 CTCATAGTGTGTACTGATGTTGG + Intronic
932762188 2:74445475-74445497 CTGAGAGTTTGTACTCAATGTGG + Intergenic
933206240 2:79512189-79512211 CTGAGAGGTTATACTGTAGTTGG - Intronic
933389144 2:81649177-81649199 CTGAGACTTTGAACTAAAATGGG - Intergenic
936117223 2:109711862-109711884 TTAAGAGCTTGCACTGAAGTGGG - Intergenic
937237665 2:120440611-120440633 GTGAGATCTTGTACTGAAGTGGG - Intergenic
937688189 2:124722254-124722276 CTTAGAGTTGGTGCTGAAATGGG - Intronic
938169895 2:129066010-129066032 CTGGAAGTTTGTAGTGAAGAAGG - Intergenic
941306717 2:163878604-163878626 CTTTGAGTTTGTTCTGAAGGTGG + Intergenic
942432461 2:175927226-175927248 CTGAGAGTTTTCACTGGATTTGG + Exonic
946966090 2:225039973-225039995 CTATGAGTCTGTACTGAAGTCGG + Intronic
1170295491 20:14820109-14820131 GGGAGAGTTTGCACTGAAGAAGG + Intronic
1173611694 20:44372909-44372931 CTGAGAATTTGTGCTGCAGTCGG + Intronic
1174753588 20:53136535-53136557 TTAAGAGTGTCTACTGAAGTGGG - Intronic
1176799635 21:13412350-13412372 CAGAGAGCTTTTATTGAAGTGGG - Intergenic
1177919467 21:27132864-27132886 CTGAGTGTTTTTACTGAGCTGGG - Intergenic
1178253168 21:31024087-31024109 TTGAGAGTTTATCCTGAGGTTGG + Intergenic
1180451317 22:15465769-15465791 CTGAGTGTTTGTCCTCACGTAGG + Intergenic
1180451412 22:15466679-15466701 CTGAGTGTTTGTCCTCACGTAGG + Intergenic
1180930164 22:19584755-19584777 CTAAGTGTTTGTAATGAGGTAGG + Intergenic
1181424710 22:22826858-22826880 CTGAGAGCTTGTGCTCAAGGAGG - Intronic
1183049569 22:35249957-35249979 CTGAGGGTTTGTACTTAACCTGG - Intergenic
1184839075 22:47042073-47042095 CTGAGAGTTTTTATAGAAGATGG + Intronic
1185307295 22:50127022-50127044 CAGAGATTTTGTAATGAATTAGG + Intronic
949698757 3:6730738-6730760 CTGAAATTTTATGCTGAAGTAGG - Intergenic
951151491 3:19295701-19295723 CTGTGGGTTTGTACTTCAGTGGG + Intronic
955467522 3:59252552-59252574 CTGACAGGTTGTCCTGAAATGGG + Intergenic
957164998 3:76661449-76661471 CTGAGAGTATGTACTCAAGATGG + Intronic
957305265 3:78449680-78449702 CTGAGAATATGTACTCAAGGTGG - Intergenic
962098949 3:132321518-132321540 CTGAGAGTTGGTACTGAGCCAGG + Intronic
963291745 3:143497316-143497338 CTGAGAGTAGGGAATGAAGTGGG - Intronic
966046846 3:175562020-175562042 CTGAGACTTTGTGTTGAATTTGG - Intronic
966300851 3:178478372-178478394 ATGAGAGTTTATTCTGAACTAGG + Intronic
969070555 4:4534940-4534962 GGGTGAGGTTGTACTGAAGTAGG - Intronic
969644864 4:8421901-8421923 CTTAGAGATTGTATTGCAGTGGG - Intronic
970616975 4:17776901-17776923 CTAGGAGATTGTGCTGAAGTAGG + Intronic
974667554 4:64984607-64984629 CTGAGAGTATATACTGAATATGG - Intergenic
978281247 4:107017912-107017934 CTAAAAATTTGTACTGAAATGGG - Intronic
980715106 4:136617496-136617518 GTGAGAGGGTGTACTGAAGGAGG - Intergenic
981026155 4:140078806-140078828 CTGGGAGTTTGTGCTGAGCTGGG - Intronic
984362858 4:178758830-178758852 CTGAAGGTTTGTACTGCTGTAGG + Intergenic
987870204 5:23607253-23607275 CTCAGAAATTGTACTAAAGTTGG + Intergenic
988814213 5:34816561-34816583 CTGAGAAATTGTACTCAAGGGGG + Intronic
989643020 5:43602081-43602103 CTGTGAGTTTGGACTGCAGTGGG + Intergenic
993983304 5:94568576-94568598 CTGTGAGTTTTAAGTGAAGTGGG - Intronic
1005218285 6:23556845-23556867 TTTAGAGTTTGTTCTGAAGATGG - Intergenic
1008037029 6:46756324-46756346 CTTTGAGTTTGTACTAAATTTGG + Intronic
1011452436 6:87508882-87508904 CTGAGAGTTTGTACTAAAATTGG - Intronic
1012121492 6:95372982-95373004 CTGAGAGTATATACATAAGTTGG + Intergenic
1012345464 6:98179999-98180021 CTGAGAGTGGGTACTCAAGTGGG - Intergenic
1013108028 6:107042637-107042659 CTGCCAGTTTGTACTGAGGCTGG - Intronic
1013329440 6:109084751-109084773 CTGATAGATTGTAATGAAATAGG - Intronic
1013577385 6:111497791-111497813 CTGAGTTTTTGTATTGATGTTGG + Intergenic
1014446843 6:121537793-121537815 CTGAGAGTTTGTCTTAAAATAGG - Intergenic
1015473629 6:133634840-133634862 CTCAGAGTTTATAATGTAGTTGG + Intergenic
1020334879 7:7055460-7055482 CTGAGAATTTGCAATGAAGCTGG + Intergenic
1020334881 7:7055556-7055578 CTGAGAATTTGCAATGAAGCTGG + Intergenic
1021951208 7:25776746-25776768 CTAAGAGTTTACACTGAATTTGG - Intergenic
1029811535 7:103054038-103054060 CTTGGAGTTGCTACTGAAGTTGG - Intronic
1030695894 7:112584782-112584804 CTGGGAGTTTATACAGAAGAGGG - Intergenic
1033243542 7:139700480-139700502 ATAAGAGTTTGTATTGAAGCAGG - Intronic
1033736130 7:144223539-144223561 CAGAATGTTTGTACTGAAATGGG + Intergenic
1033746923 7:144327413-144327435 CAGAATGTTTGTACTGAAATGGG - Intergenic
1036656243 8:10679233-10679255 CTGAAAGTGTGCACTGGAGTCGG + Intronic
1037122656 8:15307818-15307840 CTGAGAGTTTCCACTGATGAAGG + Intergenic
1038559737 8:28562770-28562792 ATGAGAGTTTATTTTGAAGTGGG - Intronic
1046404064 8:113749487-113749509 TTTGGAGTTTATACTGAAGTTGG + Intergenic
1047467078 8:125127301-125127323 CTGAGAATGTGTGCTGAGGTTGG + Intronic
1047721224 8:127641788-127641810 ATGAGAGTATGTTCTGAATTGGG + Intergenic
1048336244 8:133504490-133504512 CTGAAAGTGGGTAGTGAAGTGGG + Intronic
1048718531 8:137296742-137296764 CTTAGAGTTTGTATTCAAGATGG + Intergenic
1051888983 9:21924281-21924303 CAAAGGGTTTGTACTGTAGTAGG - Intronic
1055361084 9:75490985-75491007 CTGTGAGTTTATGCTAAAGTAGG + Intergenic
1058637445 9:107050100-107050122 CTGAGACTTTGTGCCAAAGTTGG - Intergenic
1060870208 9:127033920-127033942 CTCAGATTCTGTCCTGAAGTTGG - Intronic
1062373149 9:136250619-136250641 CTCAAAGTTTGTTCTGAAATTGG + Intergenic
1186246010 X:7617805-7617827 CTGAGATTATCTACTGAAGCGGG - Intergenic
1188520277 X:31030642-31030664 CTGAGAGGTTCTAGTGAAGTGGG + Intergenic
1188543843 X:31279843-31279865 CTGAGAGGCTGTACAGAAGCAGG - Intronic
1196116776 X:112007173-112007195 CTCAGAGTTTTCACTGAAGTTGG - Intronic
1197614832 X:128679456-128679478 CTGAGAGTGTGTTCTGAGCTAGG - Intergenic
1197855750 X:130912125-130912147 CTGAGAGAGTGTACAGAAGGGGG + Intergenic
1198063938 X:133077047-133077069 TTGAGACTTTGTAGTGAAGAAGG - Intronic
1199697713 X:150354867-150354889 CTGAGAGTTGGTGCTGGAATGGG + Intergenic
1201225614 Y:11815950-11815972 CTGAGTCTATGTCCTGAAGTAGG - Intergenic
1201464489 Y:14265615-14265637 CTGAGATTATCTATTGAAGTGGG - Intergenic