ID: 1112140783

View in Genome Browser
Species Human (GRCh38)
Location 13:96639591-96639613
Sequence TGTTATTTGGATATATTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 8, 3: 78, 4: 471}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112140783 Original CRISPR TGTTATTTGGATATATTGTG TGG Intronic
901283062 1:8054707-8054729 TTTTATTTGGATATGTTTTCTGG + Intergenic
903076418 1:20770694-20770716 TCTTAATTGGATATTTTTTGGGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904178765 1:28650826-28650848 TGTTATTTTGAATTATTGTCTGG - Intergenic
904516947 1:31063598-31063620 TTTTATTTGTATAATTTGTGAGG - Intronic
904856951 1:33505745-33505767 TGTTACATGGATATAGTGTGTGG + Intergenic
904894406 1:33803367-33803389 TGTCATTTGGATATACTGGATGG - Intronic
906360783 1:45156387-45156409 TGTTACATGGGTATATTGTGTGG - Intronic
906395503 1:45460152-45460174 TGTTACAAGGGTATATTGTGTGG - Intronic
906762688 1:48390644-48390666 TGATATTTTGTTACATTGTGTGG - Intronic
906892869 1:49737628-49737650 TGTTATCTGGGAATATTGTATGG - Intronic
906964525 1:50443438-50443460 TGTTGTATGGATATGTTGTCTGG - Intronic
907034120 1:51201139-51201161 TGTGCTTTGTAGATATTGTGTGG - Intergenic
907196914 1:52694497-52694519 TGTTACATGGATATATTGCCTGG - Intronic
907838675 1:58135585-58135607 TGTTACCTGGGTATGTTGTGTGG + Intronic
908716638 1:67077755-67077777 AGTCATTTGCATATATTCTGTGG + Intergenic
908729008 1:67207248-67207270 TGTTACCTGGATATATTGCATGG + Intronic
909428949 1:75563744-75563766 TGTTATTTGCACTTATTATGTGG - Intronic
911343251 1:96665737-96665759 TGTTAGTTGCATATATGGTAAGG + Intergenic
911754368 1:101535994-101536016 TTTTATTTGGTTTTATTTTGGGG - Intergenic
913137010 1:115901145-115901167 GTTTATTTTGATATATAGTGTGG + Intergenic
913292639 1:117288313-117288335 TGATTTTTGTATATAATGTGAGG - Intergenic
914260010 1:145991010-145991032 TGTTATTTGGAATTAGTTTGTGG + Intergenic
916218953 1:162423804-162423826 TGATATTTGAATATAGTGTGAGG - Intergenic
916833387 1:168515870-168515892 TGTTATTTGTATATATTCATGGG + Intergenic
918233281 1:182555027-182555049 TGTTACATGGATATATTGGGAGG + Intronic
918678852 1:187325892-187325914 TGTTATTTTTATATATTTAGGGG - Intergenic
918785805 1:188761426-188761448 AGTTATTTTTACATATTGTGTGG + Intergenic
919214309 1:194532939-194532961 TGCTATTTTGATGTATTTTGGGG + Intergenic
919552019 1:199002559-199002581 TATTTCTTGGATGTATTGTGGGG - Intergenic
921233647 1:213100475-213100497 TGTTACCTGGTTATATTGTGTGG + Intronic
921696851 1:218221560-218221582 TGTTATGTGGATAAGTTATGGGG - Intergenic
921770400 1:219031107-219031129 AGTTTTTTGTATACATTGTGAGG - Intergenic
921774825 1:219085074-219085096 TGTTCTTTGAAGAAATTGTGAGG - Intergenic
921958336 1:221007452-221007474 TATTTTTTGGAGATATTTTGAGG + Intergenic
921971747 1:221156602-221156624 TGTTATACGCATAGATTGTGTGG - Intergenic
922637815 1:227193404-227193426 TGTTACATGGACATATTGTGTGG + Intronic
923076325 1:230611969-230611991 TGTTATCTGCAGACATTGTGTGG - Intergenic
924022249 1:239796738-239796760 TGTTACATGGATATATTGCATGG + Intronic
924713257 1:246548891-246548913 TGTGATATGGAAATATTGAGTGG - Intronic
1063843894 10:10103627-10103649 TGGTTTTTGGATATACTTTGGGG + Intergenic
1064668367 10:17681679-17681701 TGTTATCTGAATTTATTGGGAGG + Intronic
1065460524 10:25958257-25958279 TGATATTTGTATATAGTGTAAGG + Intronic
1066354556 10:34669536-34669558 CGTTACATGGATATATTGTGTGG - Intronic
1066594335 10:37032871-37032893 TGTTTATGGGATATAATGTGAGG - Intergenic
1068100897 10:52551692-52551714 TGTTATTTGTATAGATTTAGGGG + Intergenic
1068180285 10:53509538-53509560 TGTTACATGGATATATTGCACGG + Intergenic
1068257797 10:54536544-54536566 TGTTATCTGGGTATACTGTAAGG + Intronic
1069177255 10:65308041-65308063 TGTTTTTTGTATAGATTATGTGG + Intergenic
1069195828 10:65550179-65550201 TGATATCTGGATATAATGTAAGG - Intergenic
1069458119 10:68570014-68570036 TGTTACATGGGCATATTGTGTGG + Intronic
1071238612 10:83678739-83678761 TGTTATTTGCAAACACTGTGGGG + Intergenic
1071686490 10:87763349-87763371 TGTTATTTTGATATGTTTTAAGG + Intronic
1072116184 10:92372460-92372482 TTTTAATTGGATATTTTGTCTGG - Intergenic
1072419947 10:95281810-95281832 AGTTATTTAGATATCTTGTTTGG - Intronic
1072510554 10:96119447-96119469 TGTTTTTGAGATATATTCTGAGG + Intergenic
1072823199 10:98579021-98579043 TTTTAATTGTATATAATGTGGGG + Intronic
1073406557 10:103303181-103303203 TTTTATTTGGGTACATAGTGTGG - Exonic
1073528515 10:104209417-104209439 TGCTATGTGGATATATTGTCTGG - Intronic
1073998680 10:109345344-109345366 TAGCATTTGGATATATTGTTTGG + Intergenic
1074388915 10:113040237-113040259 TTTTCTTTGGAAATATTGTTGGG + Intronic
1074548891 10:114425051-114425073 TGTTACATGGGAATATTGTGTGG + Intergenic
1075757171 10:124822104-124822126 TGTTGTTTGGTTATTTTGTAGGG + Intronic
1076144836 10:128109602-128109624 TGTTATTTGGTGCTATAGTGGGG + Intronic
1077902815 11:6503448-6503470 TGTGATTTGGATCTAATGAGAGG - Intronic
1078010151 11:7566725-7566747 TTTTATTTGTACAAATTGTGGGG + Intronic
1079740266 11:24050022-24050044 TGTTCCATGGGTATATTGTGTGG - Intergenic
1080333363 11:31168402-31168424 TGATATTTGTATATTTTCTGTGG + Intronic
1080338528 11:31228987-31229009 TGTTATATGGCTATATTCTGTGG - Intronic
1080987054 11:37481685-37481707 TATTATGTGGATATATTTGGGGG - Intergenic
1081024225 11:37989022-37989044 TGTTTTTTCAGTATATTGTGAGG - Intergenic
1081208592 11:40304169-40304191 TGTAATTTGGGGATATTGAGGGG + Intronic
1081287501 11:41289042-41289064 TGTGATTAGGTTATATTATGAGG - Intronic
1082238421 11:49848645-49848667 TGTTTTTGGGAAATATTCTGAGG + Intergenic
1082611704 11:55307161-55307183 TGTTTTTGGGAAATATTCTGAGG + Intergenic
1082630983 11:55541684-55541706 TCTTACATGGATATATTATGAGG - Intergenic
1082658208 11:55876505-55876527 TGTTTTTGGGAAATATTCTGAGG - Intergenic
1082686717 11:56246917-56246939 TGATCTTTGCAGATATTGTGGGG - Intergenic
1082712004 11:56564217-56564239 TGGTTTTTGGATGTATTTTGGGG - Intergenic
1084230194 11:67746620-67746642 TGTTATTTGGTTTTATTGAGGGG - Intergenic
1085894128 11:80617002-80617024 TGTTTATGGGATATAATGTGAGG + Intergenic
1086486658 11:87310558-87310580 TGTTACAGGGGTATATTGTGTGG - Intronic
1086698154 11:89867506-89867528 TGTTTTTGGGAAATATTCTGAGG - Intergenic
1086708011 11:89976982-89977004 TGTTTTTGGGAAATATTCTGAGG + Intergenic
1086812849 11:91332292-91332314 TGCCATTTGTATATATTTTGGGG - Intergenic
1086979773 11:93181605-93181627 TTTTATTTATATATATTGTTAGG + Intronic
1087351563 11:97040043-97040065 TCTTACAAGGATATATTGTGTGG - Intergenic
1087480641 11:98695717-98695739 TGTTATTTAAATGTTTTGTGTGG - Intergenic
1088352182 11:108902220-108902242 TGCTGTTTAGATATATTCTGTGG - Intronic
1088563447 11:111140196-111140218 TGTTTATTGGATATATTCTTAGG - Intergenic
1092150497 12:6244960-6244982 TATTATTTTGAAATATTTTGGGG - Intergenic
1093170113 12:15850934-15850956 TGTTATGTGCACATATTTTGGGG + Intronic
1094280809 12:28735708-28735730 TGGTATTTGGTTACATTTTGGGG - Intergenic
1094390871 12:29949194-29949216 TGCTATTTGGGAATATTGTTTGG + Intergenic
1094583057 12:31752058-31752080 AGTTATTTAGATATATTTTCTGG - Intergenic
1095371904 12:41477729-41477751 TTTTATTTGGCTGTTTTGTGCGG - Intronic
1095382198 12:41608642-41608664 TGTTACATGGATATATTGCGTGG - Intergenic
1095694285 12:45126948-45126970 TATGATTTGGATGTGTTGTGTGG + Intergenic
1100872847 12:98930145-98930167 GGTTATTTGCATATATTTTTTGG - Intronic
1101180664 12:102213336-102213358 TTTTATTTGTGTATATTTTGGGG + Intergenic
1101689609 12:107064657-107064679 AGTTATTTGGCGATATTGTGTGG - Intronic
1101903467 12:108808392-108808414 TGCTCTTTGGAAATAATGTGGGG - Intronic
1103029105 12:117597995-117598017 TTTTATTTCAATATATTTTGGGG + Intronic
1103628317 12:122238031-122238053 TGTTATCTCAATATTTTGTGGGG - Intronic
1104231351 12:126887431-126887453 TGGTATTAGGATATAATCTGTGG - Intergenic
1105230573 13:18491554-18491576 TGTTAATTGGTTATATTGAAAGG + Intergenic
1105896037 13:24718195-24718217 TGTTACTTGGATCTATTTTGTGG - Intergenic
1105984861 13:25555674-25555696 TGTTTTGTGGGTATATTATGTGG + Intronic
1106099837 13:26684612-26684634 TGTGATTTTGATATTTTGGGTGG + Intronic
1106453643 13:29907936-29907958 CCTTATTTGGATATTTTTTGTGG + Intergenic
1106648962 13:31668014-31668036 TCTTTTTTGTATATAGTGTGAGG - Intergenic
1107233239 13:38136907-38136929 TGTTACATGGGTATGTTGTGTGG + Intergenic
1107364708 13:39657635-39657657 TGTTATTTTGAAATATTGGCTGG - Intronic
1109287842 13:60432870-60432892 TGGTATTTGGATATCATGTGCGG + Intronic
1109423255 13:62141022-62141044 TGTTCATTGGCTATATTCTGGGG - Intergenic
1109471399 13:62810235-62810257 TGCTACATGGATATACTGTGTGG + Intergenic
1109894788 13:68671218-68671240 TGTTATTTGGATATGTTATTTGG + Intergenic
1109925032 13:69126121-69126143 TGTAATTTAAATATATTGCGAGG - Intergenic
1109985656 13:69980721-69980743 TGTTACATGAGTATATTGTGTGG + Intronic
1110688539 13:78403832-78403854 TGTTCTTTGGTTATATAATGAGG + Intergenic
1110740965 13:78996102-78996124 TGTTTTTTTGATATACTTTGAGG - Intergenic
1111273716 13:85919857-85919879 TGTTAATTCTATATATTGTCAGG + Intergenic
1111702275 13:91705698-91705720 TGTCATTTGGAAATATGGGGGGG - Intronic
1111862582 13:93727373-93727395 TGAAATGTGGATAGATTGTGGGG - Intronic
1112140783 13:96639591-96639613 TGTTATTTGGATATATTGTGTGG + Intronic
1112606818 13:100914470-100914492 TTTTACATGGATATGTTGTGTGG + Intergenic
1112839500 13:103558984-103559006 TGTGATTAGGATATATCCTGTGG + Intergenic
1113648675 13:112017012-112017034 TTATATTTGGATTTATTTTGGGG + Intergenic
1114014824 14:18418366-18418388 TGTTAATTGGTTATATTGAAAGG + Intergenic
1114161282 14:20170523-20170545 TATTTTTTGCACATATTGTGAGG - Intergenic
1114195655 14:20473912-20473934 TGTTATATGGATATACTGCGTGG + Intronic
1114274598 14:21131244-21131266 TGATTTTTGTATATAGTGTGAGG - Intergenic
1114845998 14:26322794-26322816 TTTTATCTGGATGTATTGTGAGG - Intergenic
1115133099 14:30076768-30076790 TGTTATGTAGGTAAATTGTGGGG - Intronic
1115468060 14:33737815-33737837 TTTTATTTGTGTTTATTGTGTGG - Intronic
1116177226 14:41487642-41487664 TGTCATTTGCATTTATTGTCTGG + Intergenic
1116180999 14:41535516-41535538 TGTTATTTGTCTATATTGCATGG + Intergenic
1116371456 14:44138932-44138954 TGTTAAATAGATATATTGTATGG + Intergenic
1118550959 14:66949669-66949691 TGTTATTTGAATTTAATGTTGGG - Intronic
1120093347 14:80359526-80359548 TGTTATGTGGATATATTGCGTGG + Intronic
1120267987 14:82275567-82275589 TGTCATTAAGATATATTTTGGGG + Intergenic
1120433292 14:84446781-84446803 ATTTATTTGAATATATTTTGTGG - Intergenic
1120945365 14:89990020-89990042 TTTTATTTGGCTATCTTGTCTGG - Intronic
1122005704 14:98701803-98701825 TGTTACATGGATATATTGCATGG + Intergenic
1122436410 14:101704095-101704117 TGTTAATTGGATATATATTTGGG + Intergenic
1125001931 15:34780195-34780217 TGCTACTTTGGTATATTGTGTGG + Intergenic
1125979422 15:43986772-43986794 TGTGCTTTGTAGATATTGTGGGG + Intronic
1126485590 15:49176560-49176582 TCTTATTTGGATTTTTTGAGAGG + Intronic
1127026197 15:54809649-54809671 TATTACTTGGCTAAATTGTGTGG - Intergenic
1127079962 15:55367870-55367892 TGTAATCTGGATATTTGGTGAGG - Intronic
1129646050 15:77434197-77434219 TGATTTTTGTATATGTTGTGAGG - Intronic
1130701610 15:86188847-86188869 TGTAATTTGGAAATATGTTGAGG + Intronic
1130753917 15:86742930-86742952 TGTTATATGGATAAATTCTGTGG + Intronic
1131446030 15:92498869-92498891 TTCTATTCTGATATATTGTGGGG - Intronic
1132326076 15:100971605-100971627 TGTTATGTGTATATAGTATGTGG + Intronic
1132647569 16:1006289-1006311 TGTTTTTTGGAAATGGTGTGGGG + Intergenic
1133003367 16:2862907-2862929 TGTTACCTGGATATACTGTGTGG - Intergenic
1134294240 16:12931325-12931347 TGTTACATGGGTATATTGTGTGG + Intronic
1135677777 16:24431700-24431722 TGTTAAATGGGTATATTGCGTGG - Intergenic
1136018279 16:27420587-27420609 TGTTGTTTGGATATCTTCTTTGG + Intronic
1137357670 16:47782272-47782294 TGTTATGTGGATAAATTGCATGG + Intergenic
1137736064 16:50724669-50724691 TGTTATAAGGATATGTTGTTAGG + Intronic
1138221777 16:55257848-55257870 TGATATTTTGATATGTTATGTGG - Intergenic
1138259540 16:55605326-55605348 TGTTATTTTGATGTGTTTTGGGG - Intergenic
1139062129 16:63264821-63264843 TGTTACATGTATATAATGTGCGG - Intergenic
1140653140 16:77110291-77110313 TATTATTTTTATATATTATGGGG - Intergenic
1140888841 16:79268090-79268112 TTTTCTTGGGATTTATTGTGTGG - Intergenic
1141225972 16:82115132-82115154 TTTTATTTGGATAGTTTTTGGGG + Intergenic
1141337280 16:83168140-83168162 TGTTACCTAGGTATATTGTGTGG - Intronic
1141863732 16:86735541-86735563 TGTTATTTGGGTATGTTATTTGG - Intergenic
1142832288 17:2558147-2558169 TGTTATTTGGAGTTTTTCTGTGG + Intergenic
1144333212 17:14243305-14243327 TGTTAGACGGGTATATTGTGTGG - Intergenic
1145715946 17:27021363-27021385 TATTTTTTGCACATATTGTGAGG - Intergenic
1146317952 17:31823344-31823366 AGTTAATAGTATATATTGTGTGG - Intergenic
1146817600 17:35955714-35955736 TGTCACATGGATACATTGTGTGG + Intergenic
1147531332 17:41280880-41280902 TGTTATATTGTTAAATTGTGAGG + Intergenic
1147630580 17:41928193-41928215 TGATTTTTGTATATAGTGTGAGG + Intronic
1148961647 17:51398120-51398142 TGTTCTTTGGTAATATTGTTGGG + Intergenic
1150533335 17:66009331-66009353 TGTTATTTGTATATCTTCTTTGG + Intronic
1151097534 17:71515788-71515810 AGTTAATTGGATATATTCCGAGG + Intergenic
1152087651 17:78230535-78230557 TGTTATATTGCTTTATTGTGGGG + Intergenic
1154075499 18:11196596-11196618 TAATATTTGGATAAAGTGTGAGG + Intergenic
1154099041 18:11451709-11451731 TGTTATGTGGAGATGTGGTGTGG + Intergenic
1154298053 18:13167547-13167569 TGTTATTTTGGTGTATTTTGAGG - Intergenic
1154471706 18:14709449-14709471 TATTTTTTGCACATATTGTGAGG + Intergenic
1154522832 18:15248314-15248336 TGTTAATTGGTTATATTGAAAGG - Intergenic
1155230472 18:23769088-23769110 TGTTAGCTGGATATATTGCATGG - Intronic
1155460128 18:26070102-26070124 TGTTACGTGGATTTCTTGTGTGG - Intronic
1156618920 18:38825477-38825499 TGTCACATGGATATATTGTGTGG + Intergenic
1158702080 18:59757235-59757257 TGTAATTTGTATATATTTAGGGG + Intergenic
1158816982 18:61112789-61112811 TGTTATTTGAATGTATTTTTAGG - Intergenic
1159319115 18:66823391-66823413 GGTTATTTGGAAATATAGTCAGG - Intergenic
1159407314 18:68020958-68020980 TGTTTATTGTATATAGTGTGAGG - Intergenic
1159667401 18:71178774-71178796 TGTTATTTGTATATGTTTAGGGG + Intergenic
1159965661 18:74593469-74593491 TGTTATTTCGATAGTTTCTGTGG + Intergenic
1161784709 19:6316853-6316875 TGTTACATGTATGTATTGTGTGG - Intronic
1164109276 19:22139683-22139705 TTTTATTTGGGTACATAGTGTGG + Intergenic
1164543901 19:29143217-29143239 TGTTACTTGGGTATATTCTGTGG - Intergenic
1164543921 19:29143447-29143469 TGTTACTTGGGTATATTGCATGG - Intergenic
1165584914 19:36906062-36906084 TGGTATTTGTATGTGTTGTGAGG - Intronic
1168376199 19:55881910-55881932 TGTTACATGTATATATTGTGTGG + Intergenic
925033236 2:667891-667913 TGTTATTTGGACTTAATATGGGG - Exonic
925193045 2:1900674-1900696 TGTTACACGGATGTATTGTGTGG - Intronic
925422160 2:3721452-3721474 TTTTAGTTGGATATTTTGTGTGG + Intronic
925486793 2:4343374-4343396 TGTTATTTTTATATATGGAGAGG + Intergenic
925548700 2:5045135-5045157 TGTTATTTTGATAGATTTAGAGG + Intergenic
925727440 2:6887402-6887424 TTTCCTTTGGAAATATTGTGAGG + Intronic
926613181 2:14968326-14968348 TGTTATTTGTATACATTCTTTGG - Intergenic
926757622 2:16249043-16249065 TGTAAATTGGATAAATGGTGAGG - Intergenic
926759625 2:16266536-16266558 TGTTACCTGGGTATATTGTATGG - Intergenic
926823085 2:16875069-16875091 TGTTACATTGATATATTGTGTGG - Intergenic
928240861 2:29584528-29584550 TATTTTTTGGATATCTTGTTTGG - Intronic
928536701 2:32248089-32248111 TGTTATATCGATATATTTCGTGG - Intronic
928720010 2:34109421-34109443 TGTCATTTGTATATCTTTTGTGG + Intergenic
928867882 2:35939588-35939610 TTTTTTTTAAATATATTGTGTGG - Intergenic
928901823 2:36326550-36326572 TGTTATTTGGGAATTTTATGGGG - Intergenic
929048188 2:37811211-37811233 TGTTATGTGGATATGTTGCATGG + Intergenic
931021446 2:58048657-58048679 TCTAATTTGAATATAATGTGTGG + Intronic
931294892 2:60912915-60912937 TGATATTTGTATATGATGTGAGG - Intronic
932630311 2:73336329-73336351 TGATTTTTGTATATATTGTGAGG - Intergenic
933226732 2:79758488-79758510 TGTTACCTGGTTATATTGTGTGG + Intronic
933249064 2:80008157-80008179 TCTTATTTTGACATACTGTGTGG + Intronic
933608432 2:84408638-84408660 TGTTATTAGGATATACTGCAGGG + Intergenic
934588074 2:95523214-95523236 TGTTTTTGGGAAATATTCTGAGG + Intergenic
936688927 2:114862926-114862948 TATTTTATGGATTTATTGTGTGG + Intronic
937508654 2:122567993-122568015 TAATTTTTGGATATATTGAGAGG - Intergenic
937670754 2:124535078-124535100 TTTTATATGTATAGATTGTGAGG - Intronic
938522119 2:132081165-132081187 TGTTAATTGGTTATATTGAAAGG - Intergenic
939373953 2:141339824-141339846 TGTTACATGGACATATTGTGTGG + Intronic
939417385 2:141916867-141916889 TGTTACCTGGGTATATTGTGTGG - Intronic
939472346 2:142639568-142639590 TCTTACATGCATATATTGTGTGG + Intergenic
939481959 2:142760326-142760348 TGTTATGAGGGCATATTGTGTGG - Intergenic
940234282 2:151492941-151492963 CCTTCTTTGGATATATTTTGGGG - Intronic
940528491 2:154847564-154847586 TGTTATTTGGTTAAATTTTCAGG + Intronic
940807214 2:158201360-158201382 CATTATTTGGATATATTCTTAGG - Intronic
940882060 2:158956708-158956730 TGTTATTTGGAAATGTTATTTGG + Intergenic
941258467 2:163264732-163264754 TGTTACTTTGATTTATTTTGAGG - Intergenic
941737019 2:168989291-168989313 TGATATTTGTGTATAGTGTGAGG + Intronic
942382831 2:175410422-175410444 TGCTATTTGGAATAATTGTGGGG + Intergenic
942428781 2:175887205-175887227 TGTTACATGGATATATTGTCTGG - Intergenic
942445335 2:176073752-176073774 TGTTACTTTCATATATTATGTGG - Intergenic
942570511 2:177309610-177309632 TGATATTTGGATATATCATTTGG - Intronic
942614503 2:177776421-177776443 TGTCATTGGGAGATGTTGTGAGG - Intronic
942720399 2:178945823-178945845 TGTCATGTGCATTTATTGTGTGG - Intronic
943045642 2:182858586-182858608 TTTTATTTGGACATATAGTTTGG - Intronic
943274900 2:185854173-185854195 TGGCTTTTGAATATATTGTGTGG - Intergenic
943754146 2:191540737-191540759 TGTGTTTTGGATATAATCTGAGG + Intergenic
943910077 2:193552874-193552896 TGTTACATGGATATATTTTGTGG - Intergenic
944470126 2:200044425-200044447 TGATTTTTGTATATAGTGTGAGG - Intergenic
944969871 2:204979810-204979832 TGATTTTTGTATATAGTGTGAGG - Intronic
946075240 2:217068513-217068535 TGTTACCTGGGTATGTTGTGTGG - Intergenic
946461693 2:219874490-219874512 TGTTCTTTGGAGCTTTTGTGAGG - Intergenic
946829253 2:223711341-223711363 GGTTACATGGATATATTGCGTGG + Intergenic
947151117 2:227116500-227116522 TGTTATTTGGGTTTATTGCTGGG - Intronic
947942064 2:234065861-234065883 TGATTTTTGCATATGTTGTGAGG + Intronic
948532999 2:238625087-238625109 TGTTACATGGATACATTGTGTGG - Intergenic
1169246267 20:4027648-4027670 TGTTACATGGATATATTGCATGG + Intergenic
1169402146 20:5291482-5291504 TGTTTTTTGTATATACTGTTGGG - Intergenic
1169696039 20:8387683-8387705 TGTGCTTTGCAGATATTGTGGGG - Intronic
1169715382 20:8610872-8610894 TGATTTTTGCATATAGTGTGAGG + Intronic
1169993732 20:11533321-11533343 TGTTATCTGGGTATATTGCGTGG - Intergenic
1170374989 20:15690473-15690495 TGGCATTTGGATATAGGGTGAGG + Intronic
1170419197 20:16175754-16175776 TGTTTTTCGGATCTTTTGTGTGG - Intergenic
1171727383 20:28637525-28637547 TCTTTCTTAGATATATTGTGAGG + Intergenic
1173825660 20:46046161-46046183 TGTTATTAGGGTGTGTTGTGAGG + Intronic
1175042340 20:56065852-56065874 TATTTTTTGGGTGTATTGTGAGG - Intergenic
1176452011 21:6871594-6871616 TGTTACATGGATAAATTGTGTGG + Intergenic
1176774566 21:13119901-13119923 TGTTAATTGGTTATATTGAAAGG + Intergenic
1176802782 21:13448463-13448485 TATTTTTTGCACATATTGTGAGG - Intergenic
1176830183 21:13736643-13736665 TGTTACATGGATAAATTGTGTGG + Intergenic
1177075577 21:16568058-16568080 TGTTATTTTATTTTATTGTGAGG + Intergenic
1177138842 21:17336409-17336431 TATTAGTTGTATATATTTTGGGG + Intergenic
1177574316 21:22931131-22931153 TATTACATGGGTATATTGTGTGG + Intergenic
1177777184 21:25581098-25581120 TGTTTTTTGCATATAGAGTGAGG - Intergenic
1177871449 21:26578086-26578108 TGTTAAATGGGTATATTGTATGG + Intergenic
1178429481 21:32506415-32506437 TGTTATTTGATTTTATTGAGGGG + Intronic
1178784452 21:35639987-35640009 AGTTGTTTTGATATATTTTGTGG + Intronic
1180439323 22:15349139-15349161 TGTCATTTGGTTATATTGAAAGG + Intergenic
1180592393 22:16952108-16952130 TGTTACATGGGTATATTGTATGG - Intergenic
1181525942 22:23487367-23487389 AGTTACCTGGGTATATTGTGTGG + Intergenic
1183065626 22:35360809-35360831 TGTTACATGGATATATTGCCTGG + Intergenic
949819144 3:8096374-8096396 TGATAATTGGATATATTATCTGG - Intergenic
949937435 3:9126872-9126894 TGTTACATGCATAGATTGTGTGG - Intronic
950145166 3:10644134-10644156 GGTTATTTGTATATATTCTTCGG - Intronic
950630190 3:14277021-14277043 TGTTACATGGATAAATTGTATGG + Intergenic
951404797 3:22282707-22282729 TTTTATTTTGGTATATTTTGAGG - Intronic
953502725 3:43453626-43453648 TATTTTTTGCATATAGTGTGGGG + Intronic
956355111 3:68382385-68382407 TGATTTTTGTATATAGTGTGAGG + Intronic
956686306 3:71831494-71831516 TGTTTTTTAGTTATGTTGTGAGG - Intergenic
956857755 3:73292619-73292641 TGATATTTTGATATTTTGTCTGG + Intergenic
957034329 3:75279824-75279846 TTGTATTTGGATATACTATGTGG - Intergenic
957046756 3:75381648-75381670 TGTTATTTGGTTTTATTGAGGGG - Intergenic
957100461 3:75820247-75820269 GGTCATTTGGATATATTCTTTGG - Intergenic
957173060 3:76764951-76764973 TATTATGTGCATATATTGTGTGG + Intronic
957628273 3:82683257-82683279 TGAAATATGTATATATTGTGGGG + Intergenic
958025133 3:88040568-88040590 TGTGATTTGGCTAAATGGTGAGG - Intergenic
958157524 3:89773527-89773549 TGTTACATGGGTCTATTGTGTGG - Intergenic
958175011 3:89986530-89986552 TCTTATTAAGATAAATTGTGAGG - Intergenic
959048890 3:101505292-101505314 TGTTATATGGGTATATTGTGTGG - Intronic
959720013 3:109475833-109475855 TAATATTTGTGTATATTGTGAGG + Intergenic
960162368 3:114364471-114364493 TGTTGTTTGCATAAATTGTTGGG - Intronic
960442057 3:117701031-117701053 TGTTATATGGATATAGTTTGTGG + Intergenic
960490860 3:118314969-118314991 TGTTTGATGGATATTTTGTGGGG - Intergenic
960763695 3:121100780-121100802 TTTTTTGTCGATATATTGTGTGG - Intronic
961146273 3:124596489-124596511 TGATATTTGGAGCTATTGTGGGG - Intronic
961563184 3:127745634-127745656 TGTTACATGGATATATTGCGTGG - Intronic
961878829 3:130045716-130045738 TGTTATTTGGTTTTATTGAGGGG - Intergenic
963193225 3:142496946-142496968 TGGTATTTGGATATTATTTGGGG - Intronic
963289332 3:143471529-143471551 TGTTTTTTGGAAATAATGTTTGG - Intronic
963572728 3:147017371-147017393 TCTTATATGGGTACATTGTGTGG + Intergenic
964022767 3:152034102-152034124 TGTTACCTGGCTATATTGTGTGG - Intergenic
964287439 3:155134180-155134202 TGTTACATGGATATATTGCATGG + Intronic
964429945 3:156594750-156594772 TGGTATATAGATATATGGTGGGG + Intergenic
964457861 3:156887499-156887521 TGTTATGTAGATGTTTTGTGTGG + Intronic
964559192 3:157974778-157974800 TGTCTTTTGGGTATATTCTGAGG - Intergenic
964642547 3:158925557-158925579 TTTTATTTGGCTAGAATGTGGGG - Intergenic
964675332 3:159272057-159272079 TTTTATTTGGATATTTTATTTGG + Intronic
965582963 3:170288753-170288775 TTTTATATGTATATATTTTGAGG - Intronic
965759328 3:172058527-172058549 TGCTATTTTGATATATTATTTGG + Intronic
968991050 4:3912764-3912786 TGTTATTTGGTTTTATTGAGGGG - Intergenic
969824293 4:9744772-9744794 TGTTATTTGGTTTTATTGAGGGG + Intergenic
970622807 4:17842730-17842752 TATAATTTGGGTATATTGTGTGG + Intronic
970877392 4:20886860-20886882 TGTTATTAGGATACATTGTAAGG - Intronic
971005356 4:22368592-22368614 GGTCATTTGGATATTTTGTTCGG - Intronic
972060806 4:34870478-34870500 TCTTATTTCGATATCTTCTGTGG - Intergenic
973594792 4:52476802-52476824 TGTTACATGGATATATTGTGTGG - Intergenic
974471192 4:62319968-62319990 TATTATTTGGAAACCTTGTGGGG + Intergenic
974741858 4:66017180-66017202 TTTGTTTTGGATATATAGTGAGG - Intergenic
975003363 4:69254950-69254972 TGTTCTATGGGTATATTTTGTGG - Intergenic
975011650 4:69362314-69362336 TGTTCTATGGGTATATTTTGTGG - Intronic
975646268 4:76549166-76549188 TGTTTTTAAGATAAATTGTGTGG + Intronic
975902726 4:79171892-79171914 TGCTATTTGGAGATTCTGTGAGG + Intergenic
975909697 4:79252284-79252306 TGTTACATGGATATATTGCTTGG - Intronic
976328553 4:83800792-83800814 TGTTACATGGATATAGTTTGTGG + Intergenic
976362293 4:84194531-84194553 TGTTATATGGATACATTGTGTGG - Intergenic
976434488 4:85001718-85001740 TGTCATTTGTATATTTTGTGAGG - Intergenic
976453996 4:85224318-85224340 TGTTACATGGGTATATTGTGTGG + Intergenic
976971226 4:91104942-91104964 TGTTACATGCATAGATTGTGTGG + Intronic
977935362 4:102796511-102796533 TGTTTTTTGTATATACTGTTGGG - Intronic
978156344 4:105493265-105493287 TGATTTTTGTATATAATGTGAGG + Intergenic
978241250 4:106519333-106519355 TGTTGTCTGGATATATTCTCAGG + Intergenic
978523605 4:109641526-109641548 TGATAGTTTGAAATATTGTGAGG + Intronic
978677155 4:111332654-111332676 TGTTATATGGCTATATTGTCTGG - Intergenic
979008183 4:115331648-115331670 TAGTATTTGGATATATTGGAAGG - Intergenic
980593426 4:134922228-134922250 TGTTAACTGGAAATATTTTGAGG + Intergenic
981154094 4:141413580-141413602 TTTTAATTAGATATATTGTGTGG + Intergenic
981560170 4:146039941-146039963 AGTCATTTGTATATTTTGTGAGG + Intergenic
981572646 4:146169355-146169377 TGCTATTTGGAAATAATGTTAGG + Intergenic
981780925 4:148428018-148428040 TGCTATTAGAATATATTTTGTGG - Intronic
982278138 4:153657939-153657961 TGTTACCTGGATATATTGTGTGG + Intergenic
982599857 4:157434801-157434823 TTTTATTTGGAGATATTTTTAGG + Intergenic
982893869 4:160891843-160891865 TGTTACATGGGTATATTGTGTGG - Intergenic
983314274 4:166108528-166108550 TGATAATTGTATATATTTTGAGG - Intergenic
983504653 4:168539855-168539877 TGTTACATGGGTATATTGCGTGG + Intronic
983887776 4:172999782-172999804 TATAATTTGGATATATTATTTGG + Intronic
983917156 4:173304477-173304499 TGATATATGTATACATTGTGGGG + Intronic
984861522 4:184244498-184244520 TGTTACTTGGCTATTTTCTGGGG + Intergenic
986157172 5:5187976-5187998 TGTTTTTTGGATTTTTTGTGGGG + Intronic
986896717 5:12379921-12379943 TTTTTTTTGTATATAGTGTGAGG + Intergenic
987680614 5:21131919-21131941 TATTATATGGTTAAATTGTGTGG - Intergenic
987759367 5:22140387-22140409 TGTTGTTTGAAATTATTGTGTGG - Intronic
988025610 5:25684562-25684584 TGTTATTTGATTTCATTGTGTGG + Intergenic
988036568 5:25834569-25834591 TGTTACATGGATACATTGCGTGG - Intergenic
988408926 5:30860999-30861021 TGATTTTTGAATATAGTGTGAGG - Intergenic
989018956 5:36977649-36977671 TGTTACGTGGGTATATTGTGTGG + Intronic
989053103 5:37340850-37340872 TGTTACTTGCGTATATTGCGTGG + Intronic
989823277 5:45821722-45821744 GGTGATTTTGTTATATTGTGAGG - Intergenic
990100560 5:52180547-52180569 TGTTATTTGAATATTTGTTGGGG - Intergenic
990755158 5:59060732-59060754 TCTGATTTGAATATATTGTGTGG + Intronic
990969350 5:61485974-61485996 TTTTATTTGTATAAATTTTGAGG + Intronic
991131764 5:63130873-63130895 TATTATTTGCATATCATGTGTGG - Intergenic
991145949 5:63304216-63304238 TGTTATAAGGATATACTATGTGG + Intergenic
991894087 5:71373820-71373842 TGTTGTTTGAAATTATTGTGTGG - Intergenic
992784103 5:80153960-80153982 TGTTATTTAGAGATTTTCTGTGG - Intronic
993211469 5:84957801-84957823 TGTTTTTAAGATATATTTTGGGG + Intergenic
993322736 5:86494196-86494218 TGTTACATGGATATATTGCATGG + Intergenic
993421336 5:87704651-87704673 TGTTACATGGATATATTGTGTGG - Intergenic
993956518 5:94241126-94241148 TTTTATTTGGAAATCTTGTTTGG + Intronic
994309529 5:98251902-98251924 TGTTATAAGGGTATATTGTGTGG - Intergenic
994513437 5:100738288-100738310 TAATATTTGTTTATATTGTGAGG + Intergenic
995314079 5:110747738-110747760 TGTTTTCTAGATATATTGTTTGG + Intronic
995403572 5:111768408-111768430 TGTTACCTGGTTATATTGTGTGG + Intronic
995670107 5:114593651-114593673 TGTGATTTGCAGATACTGTGGGG - Intergenic
996733535 5:126738280-126738302 TGCTACATGGATATATTGTCTGG + Intergenic
996733560 5:126738427-126738449 TGCTACATGGATATATTGTCTGG + Intergenic
996973367 5:129399658-129399680 TGTTAGATGGATATTTTGGGTGG + Intergenic
998178373 5:139916234-139916256 TGGTATTTGTAACTATTGTGAGG + Intronic
998223096 5:140304039-140304061 AGTCACTTGGATATTTTGTGGGG + Intergenic
998741393 5:145206470-145206492 GGTTATTTGCATATAGTTTGAGG + Intergenic
998824903 5:146091068-146091090 TGTTAATATGATATATTGTGGGG + Intronic
999317910 5:150596074-150596096 TTTTATTTGCAGAGATTGTGGGG - Intergenic
999846089 5:155481860-155481882 TGTTATTTGTATATATTTTTGGG - Intergenic
999920986 5:156321087-156321109 TGTTTTTTAGAAATATTATGAGG - Intronic
1000097143 5:157981434-157981456 TGATTTTTGGATATAGTGTGAGG + Intergenic
1000966510 5:167664081-167664103 TGATCTGTGGATATTTTGTGAGG + Intronic
1001111820 5:168902957-168902979 TCTTATTTGGATATGATCTGAGG + Intronic
1001510348 5:172316550-172316572 TGTTATATATATATATTTTGAGG + Intergenic
1002699211 5:181110714-181110736 TGTTACCTGGGTATATTGTGTGG - Intergenic
1004800074 6:19136214-19136236 GGTTATTTGCATATCTTCTGTGG - Intergenic
1005088351 6:22030161-22030183 TTTTATTTGCAAATATTGTTTGG - Intergenic
1005316730 6:24609911-24609933 TGATTTTTGTATATGTTGTGTGG - Intronic
1005444571 6:25908531-25908553 TGTTATTTGAACATAATTTGAGG - Intergenic
1005652512 6:27897630-27897652 TGATGTTTTGATATATTGTTGGG + Intergenic
1006494288 6:34410436-34410458 TGTTATATGGATATATTACAGGG - Intronic
1008323750 6:50150822-50150844 TGTTATATAGCTAAATTGTGTGG + Intergenic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009785265 6:68329223-68329245 TGTTATTTATAAATATTATGTGG + Intergenic
1009812924 6:68692787-68692809 TTTTATTTGGTTTTATTGTAAGG + Intronic
1009813310 6:68697944-68697966 TTTTATTTGGTTTTATTGTAAGG + Intronic
1010010823 6:71046267-71046289 TGTTACCTGAATATATTGCGTGG + Intergenic
1010477296 6:76303782-76303804 TGTTACATGGGTAGATTGTGTGG + Intergenic
1010481840 6:76364597-76364619 TTTTATTTTTATATATGGTGAGG + Intergenic
1010610213 6:77945599-77945621 AGTTATTTGGATCTTTTTTGAGG + Intergenic
1010671006 6:78686385-78686407 TGTTCACTGAATATATTGTGGGG - Intergenic
1010880380 6:81161214-81161236 TGTTATGAGGAGATATTTTGAGG + Intergenic
1011495227 6:87930811-87930833 TTTTAGCTGGATATACTGTGGGG + Intergenic
1012152113 6:95767447-95767469 TGTTATCAGGTTATATTGTTTGG - Intergenic
1012648435 6:101719635-101719657 TTTTATTTGGAATTTTTGTGTGG + Intronic
1012819740 6:104070841-104070863 AGGTATTTGGATATATGGTTTGG + Intergenic
1012988841 6:105903992-105904014 TGTTATTCTTATATATTGTTTGG + Intergenic
1013880607 6:114895089-114895111 TTGTATTTGGTTATATTTTGAGG - Intergenic
1014628108 6:123754185-123754207 TGTTATTTGTATATCCTGTTAGG + Intergenic
1014819228 6:125968055-125968077 TATTACGTGGGTATATTGTGTGG + Intronic
1015300512 6:131648383-131648405 TTTTTTTTGTATATGTTGTGAGG + Intronic
1015444092 6:133283717-133283739 TGTTACGTGGATATATTGCATGG + Intronic
1015873366 6:137799232-137799254 TATTTTTTGGATACATTGAGAGG + Intergenic
1017267374 6:152463946-152463968 TGTTACATGCATAGATTGTGTGG + Intronic
1018346270 6:162902586-162902608 TTTTCTTTTGATATATTGTCGGG - Intronic
1020313885 7:6890644-6890666 TGTTATTTGGTTTTATTGAGGGG - Intergenic
1020547930 7:9557213-9557235 TGTTATATGTATACATTATGAGG - Intergenic
1020873257 7:13661299-13661321 TGTTATTTGTATATCTTTTTTGG - Intergenic
1021213547 7:17886781-17886803 GGTTATTTGGATAGATAGAGAGG - Intronic
1021246353 7:18267039-18267061 TGTTATTAATATAAATTGTGAGG + Intronic
1021547110 7:21826113-21826135 TGTCACCTGGATATATTGTGTGG - Intronic
1021611954 7:22466264-22466286 TGTTACATGGATAAATTGTGTGG + Intronic
1021687658 7:23202836-23202858 TGTAATTTGGATATGTTATCTGG - Intergenic
1022430007 7:30309198-30309220 TTTTATTTGGATATCATGAGTGG + Intronic
1022667174 7:32422377-32422399 TGTTACCTGGATATATTGCATGG + Intergenic
1022897479 7:34765984-34766006 TATTACATGGGTATATTGTGTGG - Intronic
1023061404 7:36330654-36330676 TGTTCTTTGGAGATATTATGGGG + Intronic
1024432329 7:49303361-49303383 TGATTTTTGTATATATTGTAAGG + Intergenic
1024456133 7:49609379-49609401 TGATTTTTGTATATAGTGTGAGG + Intergenic
1024473175 7:49784115-49784137 TGTTATTTGTATAAATTGATGGG + Intronic
1024488774 7:49952412-49952434 AGTTCTTTGTATATATTGTGTGG - Intronic
1024571636 7:50727975-50727997 TGTTATGGAGATATTTTGTGAGG - Intronic
1024607052 7:51030355-51030377 TATTATATTGATATATTTTGGGG - Intronic
1026504330 7:70969449-70969471 TGTAAAATGGAGATATTGTGAGG - Intergenic
1027379877 7:77596317-77596339 TCTTATTTGTACATATTGTTTGG + Intronic
1027515972 7:79142239-79142261 TGTTATTTGGATATCTTGATTGG + Intronic
1027527360 7:79286892-79286914 TGTTATATGCATAGATTGCGTGG + Intronic
1028030993 7:85912430-85912452 TGATATTTGTATATAGTGTAAGG - Intergenic
1028124726 7:87099672-87099694 TGATATTTTGATATTTTGTTTGG + Intergenic
1028572088 7:92301470-92301492 GGTTATTTGTATATCTTGTTTGG + Intronic
1029252454 7:99246699-99246721 TTTTATTTATATATATTTTGTGG - Intergenic
1029865741 7:103626283-103626305 TGTTTTTAGGAAATATGGTGTGG - Intronic
1030549371 7:110938682-110938704 TGTTACATGGATATATTGCATGG - Intronic
1030782616 7:113620205-113620227 TTTTATTAGGATGTATTGTTTGG - Intergenic
1031232680 7:119129564-119129586 TGTTTATTAGATCTATTGTGGGG + Intergenic
1031324812 7:120381519-120381541 TTTTAATTTGATATAATGTGAGG + Intronic
1031739165 7:125406844-125406866 TTTTATTTCAATATTTTGTGTGG - Intergenic
1031933865 7:127715374-127715396 TGTTACATGGGTATATTGTTTGG + Intronic
1033225185 7:139556149-139556171 TGGTCTTTGTATATGTTGTGAGG + Intergenic
1033382678 7:140839160-140839182 TAGTTTTTGGATATGTTGTGAGG - Intronic
1033874556 7:145798756-145798778 TGTTATTTTGATGTATTGAATGG - Intergenic
1034783765 7:153906241-153906263 TGTTACGCGGATATAGTGTGTGG + Intronic
1035029308 7:155847128-155847150 TGTGAGTTGGAGATGTTGTGAGG + Intergenic
1036986478 8:13537444-13537466 ACTTTTTTGGATATATTATGTGG - Intergenic
1037443696 8:18943535-18943557 TGTCCTTTGGATGTCTTGTGGGG - Intronic
1037497522 8:19454230-19454252 TCTTAGTTGGCTATATTGTATGG - Intronic
1038133619 8:24761319-24761341 TATTATTTGTATATCTTCTGTGG - Intergenic
1038423419 8:27449037-27449059 TGCTATAGGCATATATTGTGGGG + Intronic
1039332732 8:36556955-36556977 TGTTACCTGGATATATTGTGTGG - Intergenic
1040439830 8:47429518-47429540 TCTTATTTGCTTATATTTTGGGG - Intronic
1040780570 8:51103118-51103140 TGTTATTTGTATATCTTCTGTGG - Intergenic
1040873756 8:52128571-52128593 TATAATATGGATATAGTGTGTGG + Intronic
1041611807 8:59859002-59859024 TGATTTTTGTATATGTTGTGAGG - Intergenic
1041972310 8:63757872-63757894 TGTTATTTTTATTTCTTGTGGGG + Intergenic
1042382958 8:68139859-68139881 TATTATTTGAACAAATTGTGTGG + Intronic
1042719971 8:71816965-71816987 TGTTATTGGGGAAAATTGTGGGG - Intergenic
1042952499 8:74215969-74215991 TGATTTTTGTATATATTGAGAGG + Intergenic
1042972935 8:74430879-74430901 TGTTACATGGATAAATTGTGTGG + Intronic
1043079859 8:75753030-75753052 TTTTATTTGTATATGTTGAGAGG + Intergenic
1043943446 8:86223217-86223239 TATTATGTGGATAGGTTGTGTGG + Intronic
1044167079 8:88999005-88999027 TTTTATTTGGATATAGTTTTTGG - Intergenic
1044424504 8:92035441-92035463 TCTTACATGCATATATTGTGTGG - Intronic
1044497466 8:92904739-92904761 TGTCATTGTGATATACTGTGGGG - Intronic
1045224846 8:100234552-100234574 TGAGATTTGTTTATATTGTGTGG + Intronic
1045672243 8:104568244-104568266 TGTTTTTTGCATATGATGTGAGG - Intronic
1045799808 8:106089104-106089126 TGTTACATGGGTATATTGTGTGG - Intergenic
1046041997 8:108917067-108917089 TTTCATTTGTATGTATTGTGCGG + Intergenic
1046111529 8:109731647-109731669 TGTTACATGGATATATTGCATGG - Intergenic
1046352064 8:113028007-113028029 TGTGCTTTGCAGATATTGTGGGG + Intronic
1047078150 8:121428199-121428221 TTTTATTTGGGTACATAGTGTGG + Intergenic
1047146920 8:122211975-122211997 CTTTCTTTGGATATATTATGTGG - Intergenic
1048102020 8:131362644-131362666 TGTTACATGGATATATTGCATGG - Intergenic
1048761162 8:137796854-137796876 TGTTATTAGAAGATATTTTGCGG + Intergenic
1048940198 8:139393857-139393879 TGTTATATGGATATATTGTGTGG - Intergenic
1049066069 8:140315524-140315546 TTTTATTAGGAAATATTGTTTGG + Intronic
1050380973 9:5029542-5029564 TGTACTTTGCAGATATTGTGGGG - Intronic
1050483111 9:6106335-6106357 TGTTACATGGATATATTGAGTGG - Intergenic
1051192256 9:14525848-14525870 TGTTATTTGTGTGTATTTTGGGG + Intergenic
1051202894 9:14648779-14648801 TTTTATTTTAATAAATTGTGAGG - Intronic
1052405979 9:28061344-28061366 TGTTACATGGGTATATTGTGTGG - Intronic
1052449100 9:28603769-28603791 TGTTATTTGAATTTATTCTTTGG + Intronic
1053264744 9:36703262-36703284 TGTTTTTTGGCTCTAATGTGTGG - Intergenic
1054362177 9:64133926-64133948 AGTTTTTTTGACATATTGTGGGG + Intergenic
1055737308 9:79344982-79345004 TATTATTTGGAAATATTATATGG - Intergenic
1056333999 9:85548021-85548043 TGTTTATTTGATATTTTGTGTGG - Intronic
1056714397 9:89016219-89016241 TGTTCTTGGGATCTGTTGTGGGG - Intronic
1056772057 9:89484786-89484808 TGGTGTGTGGATGTATTGTGTGG + Intronic
1056772062 9:89484817-89484839 TGGTGTGTGGATGTATTGTGTGG + Intronic
1057333422 9:94138076-94138098 TGTTAATTGGATACTGTGTGTGG - Intergenic
1058093784 9:100836511-100836533 AGTTATTTTGAAAAATTGTGTGG - Intergenic
1058382588 9:104394217-104394239 AGTTGTTTGTATATATTATGAGG + Intergenic
1059167087 9:112087909-112087931 TTTTACTTGGATACATTTTGGGG - Intronic
1203517170 Un_GL000213v1:12921-12943 TGTTACATGGATAAATTGTGTGG - Intergenic
1185566778 X:1100688-1100710 TGGTATTTTAAAATATTGTGTGG - Intergenic
1185686832 X:1935975-1935997 TTATATTTGGATATATAATGAGG + Intergenic
1185884030 X:3766103-3766125 TGTTACATGGATATATTGCATGG + Intergenic
1185932865 X:4222259-4222281 TGATATTTGTATACATTGTGGGG - Intergenic
1186315384 X:8364299-8364321 TGTTACATTGATATATTGTGTGG - Intergenic
1186531580 X:10301781-10301803 TGTTACTTGAATATATCTTGTGG + Intergenic
1186781216 X:12914080-12914102 TGTTATTTGGATCTATTTCTAGG - Intronic
1187256099 X:17643878-17643900 TGTTGTTTGGATATGTTGGCAGG + Intronic
1188036675 X:25325806-25325828 TGATTTTTGTATACATTGTGAGG + Intergenic
1188080316 X:25830841-25830863 TGTCACATGGATATATTGTGTGG + Intergenic
1188913201 X:35876323-35876345 TTTTATTTTGATATATTATTTGG + Intergenic
1189720372 X:43909868-43909890 TGTTATGTGGGTATATTGTGTGG + Intergenic
1189871544 X:45388447-45388469 TGATTTTTGCATATAGTGTGAGG + Intergenic
1192005789 X:67210765-67210787 TGTTATTTGGAAATTATGAGTGG - Intergenic
1192258883 X:69491572-69491594 ACTTATATGGATAAATTGTGTGG + Intergenic
1192759602 X:74082750-74082772 TGTTACATGGATATATTATGTGG - Intergenic
1193113066 X:77748964-77748986 TTTTATTTGTATATATTTAGGGG + Intronic
1193354993 X:80508830-80508852 TGTTACATGCATATTTTGTGTGG - Intergenic
1193577409 X:83216849-83216871 TGTTACATGGATATCTTGTATGG - Intergenic
1194088566 X:89558703-89558725 TTTTATTTTAATATATTTTGGGG - Intergenic
1194553664 X:95331739-95331761 TGTTACACGGGTATATTGTGTGG - Intergenic
1194896598 X:99449082-99449104 TGTTATATAGATATATTGAATGG - Intergenic
1195817155 X:108901638-108901660 TGATTTTTGGATATGGTGTGAGG - Intergenic
1196063540 X:111437529-111437551 AGTTATTTGGGTGTCTTGTGTGG + Intergenic
1196170366 X:112580588-112580610 TTTTATTTGGTTTTATTTTGTGG - Intergenic
1196335678 X:114530171-114530193 TTTTGCTTGCATATATTGTGTGG + Intergenic
1196476674 X:116094519-116094541 TGTTCTTTGGATATATACTTAGG + Intergenic
1196529352 X:116766190-116766212 TGTTACATGGATATATTGCATGG + Intergenic
1197492454 X:127135121-127135143 TTTTATTTCAATATATTTTGGGG - Intergenic
1197577459 X:128233621-128233643 TTTTATTTGTATATATTCAGGGG - Intergenic
1197937919 X:131759292-131759314 TTATTTTTGGATATAATGTGAGG + Intergenic
1198499407 X:137228049-137228071 ATTCATTTGGATATATTCTGAGG - Intergenic
1198730657 X:139724216-139724238 TGTGATTATGATATATTTTGGGG - Intergenic
1199322828 X:146461537-146461559 TGTTACATGGATATACTGTGTGG - Intergenic
1199412386 X:147539295-147539317 TGTTATTTTGCTATATTCTAAGG - Intergenic
1199502227 X:148519823-148519845 GGTTATTTGTATATATGGAGTGG - Intronic
1200441242 Y:3214756-3214778 TTTTATTTTAATATATTTTGGGG - Intergenic
1200781339 Y:7218836-7218858 TGTTACATGGATATATTGCATGG - Intergenic
1201351694 Y:13050682-13050704 TGTTATTTGTATATTTTATTTGG - Intergenic
1201538057 Y:15072904-15072926 TATTATTAGAATAAATTGTGTGG - Intergenic
1201713822 Y:17021293-17021315 TGATATTTGTATACATTGTGGGG - Intergenic
1202033192 Y:20600465-20600487 TGTTTTGTGGGTATTTTGTGGGG - Intergenic
1202086764 Y:21146211-21146233 TGTCATTTGTAGATATTTTGGGG - Intergenic