ID: 1112142964

View in Genome Browser
Species Human (GRCh38)
Location 13:96666269-96666291
Sequence CATCAGAGGGACCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2957
Summary {0: 1, 1: 4, 2: 91, 3: 647, 4: 2214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112142964_1112142975 -4 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488
1112142964_1112142974 -5 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606
1112142964_1112142976 10 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142964_1112142978 21 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142978 13:96666313-96666335 TACAATTCAAGGCGAGATTTGGG 0: 8
1: 1395
2: 9326
3: 10269
4: 8311
1112142964_1112142977 20 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142977 13:96666312-96666334 CTACAATTCAAGGCGAGATTTGG 0: 2
1: 324
2: 5701
3: 9152
4: 8704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112142964 Original CRISPR CATCAGAGGGACCTGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr