ID: 1112142964 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:96666269-96666291 |
Sequence | CATCAGAGGGACCTGGTGGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2957 | |||
Summary | {0: 1, 1: 4, 2: 91, 3: 647, 4: 2214} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1112142964_1112142975 | -4 | Left | 1112142964 | 13:96666269-96666291 | CCTTCCACCAGGTCCCTCTGATG | 0: 1 1: 4 2: 91 3: 647 4: 2214 |
||
Right | 1112142975 | 13:96666288-96666310 | GATGACATGGGGGGATTATAGGG | 0: 1 1: 0 2: 2 3: 62 4: 488 |
||||
1112142964_1112142974 | -5 | Left | 1112142964 | 13:96666269-96666291 | CCTTCCACCAGGTCCCTCTGATG | 0: 1 1: 4 2: 91 3: 647 4: 2214 |
||
Right | 1112142974 | 13:96666287-96666309 | TGATGACATGGGGGGATTATAGG | 0: 1 1: 2 2: 45 3: 516 4: 1606 |
||||
1112142964_1112142976 | 10 | Left | 1112142964 | 13:96666269-96666291 | CCTTCCACCAGGTCCCTCTGATG | 0: 1 1: 4 2: 91 3: 647 4: 2214 |
||
Right | 1112142976 | 13:96666302-96666324 | ATTATAGGGACTACAATTCAAGG | 0: 2 1: 18 2: 225 3: 432 4: 469 |
||||
1112142964_1112142978 | 21 | Left | 1112142964 | 13:96666269-96666291 | CCTTCCACCAGGTCCCTCTGATG | 0: 1 1: 4 2: 91 3: 647 4: 2214 |
||
Right | 1112142978 | 13:96666313-96666335 | TACAATTCAAGGCGAGATTTGGG | 0: 8 1: 1395 2: 9326 3: 10269 4: 8311 |
||||
1112142964_1112142977 | 20 | Left | 1112142964 | 13:96666269-96666291 | CCTTCCACCAGGTCCCTCTGATG | 0: 1 1: 4 2: 91 3: 647 4: 2214 |
||
Right | 1112142977 | 13:96666312-96666334 | CTACAATTCAAGGCGAGATTTGG | 0: 2 1: 324 2: 5701 3: 9152 4: 8704 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1112142964 | Original CRISPR | CATCAGAGGGACCTGGTGGA AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |