ID: 1112142974

View in Genome Browser
Species Human (GRCh38)
Location 13:96666287-96666309
Sequence TGATGACATGGGGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2170
Summary {0: 1, 1: 2, 2: 45, 3: 516, 4: 1606}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112142960_1112142974 13 Left 1112142960 13:96666251-96666273 CCCACCATGATTCAATTACCTTC 0: 1
1: 13
2: 153
3: 345
4: 580
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606
1112142965_1112142974 -9 Left 1112142965 13:96666273-96666295 CCACCAGGTCCCTCTGATGACAT 0: 1
1: 17
2: 266
3: 1091
4: 3059
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606
1112142959_1112142974 14 Left 1112142959 13:96666250-96666272 CCCCACCATGATTCAATTACCTT 0: 1
1: 13
2: 178
3: 404
4: 734
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606
1112142962_1112142974 9 Left 1112142962 13:96666255-96666277 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606
1112142964_1112142974 -5 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606
1112142961_1112142974 12 Left 1112142961 13:96666252-96666274 CCACCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 1112142974 13:96666287-96666309 TGATGACATGGGGGGATTATAGG 0: 1
1: 2
2: 45
3: 516
4: 1606

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112142974 Original CRISPR TGATGACATGGGGGGATTAT AGG Intronic
Too many off-targets to display for this crispr