ID: 1112142975

View in Genome Browser
Species Human (GRCh38)
Location 13:96666288-96666310
Sequence GATGACATGGGGGGATTATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 488}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112142964_1112142975 -4 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488
1112142962_1112142975 10 Left 1112142962 13:96666255-96666277 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488
1112142959_1112142975 15 Left 1112142959 13:96666250-96666272 CCCCACCATGATTCAATTACCTT 0: 1
1: 13
2: 178
3: 404
4: 734
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488
1112142965_1112142975 -8 Left 1112142965 13:96666273-96666295 CCACCAGGTCCCTCTGATGACAT 0: 1
1: 17
2: 266
3: 1091
4: 3059
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488
1112142961_1112142975 13 Left 1112142961 13:96666252-96666274 CCACCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488
1112142960_1112142975 14 Left 1112142960 13:96666251-96666273 CCCACCATGATTCAATTACCTTC 0: 1
1: 13
2: 153
3: 345
4: 580
Right 1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG 0: 1
1: 0
2: 2
3: 62
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112142975 Original CRISPR GATGACATGGGGGGATTATA GGG Intronic
900722404 1:4185874-4185896 GGTGAAATGGGGGAATTGTAAGG + Intergenic
901365185 1:8741443-8741465 CTTGACATGTGGGGATTATGAGG - Intronic
902236720 1:15062421-15062443 GTTGAGATGGGGGGATAAAAAGG - Intronic
903220815 1:21868857-21868879 AAGGATTTGGGGGGATTATAGGG - Intronic
905939727 1:41853556-41853578 TTTGACATGTGGGGATTATGGGG + Intronic
908819582 1:68070377-68070399 CTTGACATGTGGGGATTATGGGG - Intergenic
908989498 1:70069427-70069449 CTTGACATGTGGGGATTATATGG + Intronic
909550885 1:76897405-76897427 GATAAAATGGGGGAATTGTAAGG + Intronic
909757199 1:79240967-79240989 CATGACATGTGGAGGTTATAGGG + Intergenic
909880051 1:80864341-80864363 CTTGACATGGGGGGATTATTGGG - Intergenic
909974081 1:82025183-82025205 CATGATATGGTGGTATTATAAGG - Intergenic
910042944 1:82875198-82875220 CTTGACATGTGGGAATTATAGGG + Intergenic
910237930 1:85054831-85054853 GTTGACATGTGGGGATTATGGGG - Intronic
911472702 1:98337672-98337694 CTTGACATGTGGGGATTATGGGG + Intergenic
914351780 1:146846088-146846110 CACAACATGTGGGGATTATAGGG + Intergenic
918613861 1:186522634-186522656 CTTGACATGTGGGGATTATGGGG - Intergenic
918828160 1:189354409-189354431 CTTGACATGTGGGGATTATGGGG - Intergenic
920254595 1:204645905-204645927 CTTGACATGTGGGGATTATAGGG + Intronic
922409583 1:225358733-225358755 CTTGACATGTGGGGATTATGGGG - Intronic
923214055 1:231832842-231832864 GGTAAAATGGGGGAATTATAAGG + Intronic
923446644 1:234077547-234077569 CTTGACATGTGGGGATTATGGGG + Intronic
923778657 1:237001970-237001992 GGTGACATGGGGTGATTGTGAGG - Intergenic
1063056623 10:2511436-2511458 CTTGACATGTGGGGATTATGGGG + Intergenic
1063179498 10:3584978-3585000 GATGACATGAGGTCATTAAAAGG - Intergenic
1063246200 10:4221567-4221589 CTTGACATGTGGGGATTATGGGG + Intergenic
1065442977 10:25771386-25771408 GGTGAAATGGGGGAATTGTAAGG + Intergenic
1066735002 10:38467013-38467035 CTTGACATGTGGGGATTATGGGG - Intergenic
1068128541 10:52869485-52869507 CTTGACATGTGGGGATTATGGGG - Intergenic
1068231118 10:54169830-54169852 GGTGAAATGGGGGAATTGTAAGG - Intronic
1068317359 10:55363976-55363998 GTTGACATATGGGGATTATGAGG - Intronic
1068452541 10:57211192-57211214 CTTGACATGTGGGGATTATGGGG + Intergenic
1069540076 10:69287393-69287415 CTTGACATGTGGGGATTATGGGG + Intronic
1070224428 10:74486071-74486093 TTTGACACGTGGGGATTATAGGG - Intronic
1070319655 10:75344951-75344973 CATGACATGGGTGGCTTAAAGGG - Intergenic
1070577678 10:77691911-77691933 CAGGACATGTGGGGATTATGGGG + Intergenic
1070729322 10:78814359-78814381 GATGACATGGGGCTGTTAAAAGG + Intergenic
1070731361 10:78830892-78830914 GGAGACATGGAGGGATTCTAAGG - Intergenic
1071119465 10:82261139-82261161 CTTGACATGTGGGGATTATGAGG - Intronic
1071597970 10:86941970-86941992 GATGAGATGGGGGGACTTGAAGG + Intronic
1071935945 10:90530808-90530830 CTTGACATGTGGAGATTATAAGG - Intergenic
1072319915 10:94239240-94239262 CTTGACACGTGGGGATTATAGGG - Intronic
1073926222 10:108519522-108519544 CTTGACATGTGGGGATTATGGGG - Intergenic
1075238074 10:120749892-120749914 CATGACATGTGGGGATTATGGGG - Intergenic
1075925995 10:126252196-126252218 GATGAGATGGATGGATTAGATGG + Intronic
1077193227 11:1264707-1264729 CATGACATGTGGGGATCATGGGG + Intergenic
1077823649 11:5779441-5779463 AATGACATTGAAGGATTATAGGG - Intronic
1078946673 11:16075978-16076000 CATGACATGTGGGGATTATGGGG + Intronic
1079257756 11:18847235-18847257 CTTGACATGTGGGGATTATGGGG - Intergenic
1079971286 11:27039158-27039180 CTTGACATGTGGGGATTATGGGG - Intergenic
1080568935 11:33538254-33538276 CTTGACATGTGGGGATTATGAGG + Intergenic
1081000767 11:37667906-37667928 CATGACATGTGGGGATTATGGGG - Intergenic
1081236412 11:40652863-40652885 CTTGACATGTGGGGATTATGGGG - Intronic
1081250890 11:40831869-40831891 CATGACACATGGGGATTATAAGG + Intronic
1081377036 11:42372370-42372392 CTTGACATGTGGGGATTATGAGG - Intergenic
1082116657 11:48336612-48336634 GCTGACATGGGTGGAGTATCAGG + Intergenic
1082257138 11:50043698-50043720 GCTGACATGGGTGGAGTATCAGG - Intergenic
1086134693 11:83434242-83434264 GGTGAAATGGGGGAATTTTAAGG + Intergenic
1086887165 11:92219569-92219591 TTTGACATGTGGGGATTATAGGG - Intergenic
1087255225 11:95945681-95945703 CATGACATGTGGGGATTATTGGG - Intergenic
1087918434 11:103837131-103837153 CTTGACATGTGGGGATTATGAGG + Intergenic
1087927373 11:103934789-103934811 CTTGACATGTGGGGATTATGGGG + Intronic
1087989326 11:104729047-104729069 CATGACATGTGAGGATTATGGGG - Intergenic
1088019360 11:105100819-105100841 GATGACATGAGAGGAATATGAGG - Intronic
1088044685 11:105433898-105433920 CTTGACATGTGGGGATTATGGGG + Intergenic
1088144072 11:106653069-106653091 CATGACATGTGGGAATTATGGGG - Intergenic
1088426731 11:109712899-109712921 CTTGACATATGGGGATTATAGGG + Intergenic
1089481767 11:118811524-118811546 TTTGACACGTGGGGATTATAGGG - Intergenic
1089987813 11:122830190-122830212 GGTAAAATGGGGGAATTATAAGG - Intergenic
1090631377 11:128652077-128652099 TTTGACATGTGGGGATTATGGGG + Intergenic
1090929438 11:131282137-131282159 GCTGACATGGAGAGATTATATGG + Intergenic
1093092401 12:14936598-14936620 CTTGACATGTGGGGATTATGGGG - Intronic
1093765689 12:22959505-22959527 CATGACATGTGGGGATTATGGGG - Intergenic
1095305759 12:40637381-40637403 ATTGACATGTGGGGATTATGGGG + Intergenic
1095485010 12:42675794-42675816 CATGACACGTGGGGATTATGGGG - Intergenic
1095490858 12:42732498-42732520 CATGACATGTGGCGATTATGGGG - Intergenic
1095908378 12:47401280-47401302 CTTGACGTGTGGGGATTATAGGG - Intergenic
1096318891 12:50593636-50593658 GATGAGATGTGGGCATTATTGGG + Intronic
1096344390 12:50832920-50832942 CATGACATGTGGGGATTATGGGG - Intergenic
1096885477 12:54715003-54715025 GTTGAGGTGGGGGGATTATGAGG + Intergenic
1097162547 12:57058518-57058540 GATGACATTGCTGGTTTATAAGG + Exonic
1097474408 12:60035273-60035295 CATGACATGTGGGGATTATGGGG + Intergenic
1097605288 12:61746092-61746114 CTTGACATGTGGGGATTATAGGG - Intronic
1097629936 12:62048425-62048447 TTTGACATGTGGGGATTATCAGG + Intronic
1098069047 12:66652198-66652220 CTCGACATGTGGGGATTATAGGG - Intronic
1098457913 12:70696630-70696652 CATGAAATGGGGGGATTGTATGG - Intronic
1098629207 12:72706428-72706450 GGTAAAATGGGGGAATTATAAGG - Intergenic
1099176285 12:79426818-79426840 CTTGACATGTGGGGATTATGGGG - Intronic
1099363075 12:81730578-81730600 CTTGACATGTGGGGATTATTGGG + Intronic
1099835952 12:87910029-87910051 GGTAAAATGGGGGAATTATAAGG + Intergenic
1099872942 12:88370753-88370775 GGTGAAATGGGGGAATTGTAAGG - Intergenic
1100006405 12:89900633-89900655 CTTGACATGTGGGGATTATGGGG - Intergenic
1100289991 12:93204608-93204630 CTTGACATGTGGGGATTATGGGG - Intergenic
1100729687 12:97450804-97450826 GGTGAGATGGCTGGATTATATGG + Intergenic
1101473638 12:105022822-105022844 AATAACATGAGGGGATTGTAGGG - Exonic
1104266031 12:127233192-127233214 GATCACATGGGAGGATATTATGG - Intergenic
1104310911 12:127653654-127653676 CTTGACATGTGGGGATTATGGGG + Intergenic
1104549654 12:129744894-129744916 CTTGACATGTGGGGATTATGGGG - Intronic
1104746398 12:131213646-131213668 CGTGACATGTGGGGATTATGGGG + Intergenic
1105587622 13:21759522-21759544 GCTGACATGGGGTGAGTATCAGG + Intergenic
1105608085 13:21943856-21943878 ATTGACATGTGGGGATTATGTGG + Intergenic
1105644440 13:22302508-22302530 CATGACACGTGGGGATTATGGGG + Intergenic
1106927778 13:34631361-34631383 CTTGACATGTGGGGATTATAGGG + Intergenic
1107342485 13:39423067-39423089 CATGACATGTGGGGATTACAGGG + Intronic
1107744953 13:43494111-43494133 CTTGACATGTGGGGATTATGGGG + Intronic
1109179661 13:59199025-59199047 CTTGACATGTTGGGATTATAGGG + Intergenic
1109251805 13:60029445-60029467 CTTGACATGTGGGGATTATGGGG - Intronic
1109458547 13:62625501-62625523 GATCACATGAAGGGATTAAAAGG + Intergenic
1109481846 13:62965162-62965184 CTTGACATGTGGGGATTATGGGG - Intergenic
1110431411 13:75428175-75428197 GAGGACTTGGGGGGAGTAGAGGG + Intronic
1110666249 13:78120481-78120503 CTTGACATGTGGGGATTATGGGG + Intergenic
1110845484 13:80186746-80186768 GGTGAAATGGGGAGATTGTAAGG - Intergenic
1111010167 13:82302001-82302023 CTTGACATGTGGGGATTATGGGG + Intergenic
1111089685 13:83427230-83427252 CAGGACATGTGGGGATAATATGG + Intergenic
1111414162 13:87917314-87917336 CATGACATGTAGGGATTATGGGG - Intergenic
1111709458 13:91793343-91793365 CATGACACGTGGGGATTATGGGG + Intronic
1111909355 13:94293266-94293288 CTTGACATGTGGGGATTATGGGG - Intronic
1112142975 13:96666288-96666310 GATGACATGGGGGGATTATAGGG + Intronic
1112897305 13:104315371-104315393 CATGACATGTGGGGATTATGGGG + Intergenic
1113113274 13:106847291-106847313 CTTGACAGGTGGGGATTATAAGG - Intergenic
1113167158 13:107454547-107454569 CATGACACATGGGGATTATAGGG + Intronic
1113510281 13:110848542-110848564 CTTGACATGAGGGGATTATGAGG + Intergenic
1113549450 13:111181216-111181238 GATCACATGGGGGTCTTAGAAGG + Intronic
1115507782 14:34109404-34109426 GATGAGATGGGGGCATTTCATGG + Intronic
1115697295 14:35913089-35913111 CTTGACATGTGGGGATTATGGGG - Intronic
1115887585 14:37991074-37991096 CTTGACATGTGGGGATTATGGGG - Intronic
1116267518 14:42712635-42712657 CAGGACATGTGGGGATTATGGGG + Intergenic
1117395990 14:55311325-55311347 CTTGACATGTGGGGATTATGGGG + Intronic
1117459818 14:55934209-55934231 CTTGACATGTGGGGATTATGGGG - Intergenic
1118046372 14:61975674-61975696 CTTGACATGTGGGGATTATGGGG + Intergenic
1118163902 14:63317330-63317352 GATGACATGGAGGGATTCAAGGG - Intronic
1119353477 14:73985837-73985859 GCTGACATGGGCGGATCACAAGG + Intronic
1120373621 14:83671143-83671165 CTTGACACGTGGGGATTATAGGG + Intergenic
1122730465 14:103793291-103793313 CTTGACATGTGGGGATTATGGGG - Intronic
1125213073 15:37238849-37238871 GGTGAAATGGGGGAATTGTAAGG + Intergenic
1125394982 15:39236928-39236950 CTTGACATGTAGGGATTATAGGG - Intergenic
1126285847 15:47009602-47009624 GAGGAGATGGGGAGATTAAAAGG - Intergenic
1128644012 15:69361742-69361764 CTTGACATGTGGGAATTATAGGG + Intronic
1129018989 15:72497570-72497592 GATGAAATGGAAGGCTTATAAGG + Intronic
1129259576 15:74357003-74357025 GGTAAAATGGGGGAATTATAAGG - Intronic
1130435719 15:83897052-83897074 CATGACAAGTGGGGATTATGGGG + Intronic
1133869405 16:9673725-9673747 GGTGAAATGGGGGAATTGTAAGG + Intronic
1134395907 16:13863125-13863147 CTTGACATATGGGGATTATAGGG + Intergenic
1134401934 16:13918344-13918366 CTTGAGATGGGGGGATTATATGG - Intergenic
1134763855 16:16738637-16738659 CTTGACATGTGGGGATTATAGGG - Intergenic
1134770557 16:16805645-16805667 GATGGCATGAGGAGGTTATAAGG - Intergenic
1134982200 16:18620526-18620548 CTTGACATGTGGGGATTATAGGG + Intergenic
1135889386 16:26343571-26343593 CAAGACATGTGGGGATTATGGGG - Intergenic
1137308986 16:47234806-47234828 CATGACATGTGGGGATTATGGGG - Intronic
1137848287 16:51713192-51713214 CTTGACATGTGGGGATTATGGGG - Intergenic
1138008594 16:53358520-53358542 GCTGACATGGGGGGATTTTCTGG - Intergenic
1138145165 16:54602578-54602600 GATGACAGGGGGTGCTTATGTGG - Intergenic
1143329275 17:6121647-6121669 GTTGGCATGGGGAGATTGTAAGG + Exonic
1143466832 17:7142747-7142769 GCTGAGATGGGGGGATTACGAGG + Intergenic
1143674409 17:8421355-8421377 TTTGAGATGGGGGGATTATCTGG + Intronic
1144207515 17:12989528-12989550 GCTGACATGGGTGGAGTAGAAGG - Intronic
1145356941 17:22167604-22167626 CTTGACATGTGGGGATTATGGGG + Intergenic
1146498416 17:33343534-33343556 CCTGACATGGGGGGAGTCTACGG + Intronic
1146631273 17:34471528-34471550 TGTGATATGTGGGGATTATAGGG + Intergenic
1147942353 17:44058000-44058022 GCTGAGATGGGGGGATCATGAGG + Intronic
1149346385 17:55740598-55740620 GATGTCATGGGAGGATTTTAGGG + Intergenic
1150203187 17:63378025-63378047 CATGACACGTGGGGATTATGGGG + Intronic
1150353789 17:64466246-64466268 CATGAGATGTGGGGATTATGGGG + Intronic
1151430042 17:74056196-74056218 GATGACGTGTGGGGACTGTAGGG - Intergenic
1152454108 17:80402976-80402998 GGTAAAATGGGGGAATTATAAGG - Intergenic
1152998956 18:435510-435532 CTTGACATGTGGGGATTATGGGG + Intronic
1154948987 18:21190125-21190147 CTTGACATGTGGGGATTATGGGG - Intergenic
1155811542 18:30242049-30242071 CTTGACATGTGGGGATTATGAGG + Intergenic
1156938674 18:42739726-42739748 GGTGAAATGGGGGAATTGTAAGG - Intergenic
1156986573 18:43357177-43357199 GTTGACATTGGGGCAATATATGG + Intergenic
1157050283 18:44155717-44155739 CTTGACATGTGGGGATTATGGGG - Intergenic
1157508275 18:48247686-48247708 CTTGACATGTGGGGATTATGGGG - Intronic
1157589010 18:48825035-48825057 GATGAGCTGGGGGGATTGGATGG - Intronic
1157691224 18:49683332-49683354 CTTGACATGTGGGGATTATGGGG + Intergenic
1158195114 18:54876263-54876285 CTTGACATGTGGGGATTATGGGG + Intronic
1158414517 18:57237739-57237761 CACAACATGTGGGGATTATATGG + Intergenic
1158687322 18:59626389-59626411 GCTGACATGGGGGTATTTTCAGG + Intronic
1159318066 18:66806594-66806616 TTTGACATGTGGGGATTATAAGG - Intergenic
1159337797 18:67092313-67092335 CTTGACATGTGGGGATTATGGGG - Intergenic
1160302900 18:77702336-77702358 TATGACATGTGGGGTTTATGGGG + Intergenic
1162407224 19:10482255-10482277 GATGACATGTGAGGAGTAGACGG + Intergenic
1164971755 19:32538889-32538911 CTTGACATGTGGGGATTATGGGG + Intergenic
1166926995 19:46275961-46275983 GGTGAAATGGGGGAATTGTAAGG + Intergenic
1167099604 19:47396118-47396140 GGTGAAATGGGGGAATTGTAAGG - Intergenic
1202637164 1_KI270706v1_random:52381-52403 GATGACATGTGAGTTTTATAGGG + Intergenic
925704502 2:6670954-6670976 CTTGACATGAGGGAATTATAGGG + Intergenic
926588847 2:14718504-14718526 CTTGACATGTGGGGATTATGGGG - Intergenic
926658463 2:15437098-15437120 GATGGCATGGGTGGAAAATAGGG - Intronic
926709759 2:15869403-15869425 CTTGACATGTGGGGATTATGGGG + Intergenic
927115153 2:19892263-19892285 CTTGACATGTGGGGATTATGGGG + Intergenic
927237201 2:20885190-20885212 CATGACACGTGGGGATTATGGGG - Intergenic
927552726 2:24013137-24013159 GATGACATGGGGGCAAAATGGGG + Intronic
928568335 2:32576792-32576814 GATTACATGGGTGAATTATATGG + Intronic
928719951 2:34108847-34108869 GGTGAAATGGCTGGATTATATGG + Intergenic
928779568 2:34803599-34803621 GGTGAAATAGGGGAATTATAAGG + Intergenic
929004700 2:37383633-37383655 GGTGAAATGGGGGAATTGTAAGG + Intergenic
929085547 2:38164170-38164192 CATGACATGTGGGGATTATGGGG - Intergenic
931332349 2:61300561-61300583 GCTGACATGGGTGGATCATGAGG + Intronic
931446391 2:62330734-62330756 CTTGACATGTGGGGATTATGGGG + Intergenic
932309926 2:70731643-70731665 GAGGAAATGAGGGGATTAGAAGG - Intronic
932973809 2:76576484-76576506 GGTGAAATGGGGGAATTGTAAGG + Intergenic
933532677 2:83530480-83530502 CTTGACATGTGGGGATTATGGGG - Intergenic
934016967 2:87898570-87898592 CACGACATGTGGGGATTATGGGG - Intergenic
934578309 2:95417140-95417162 GAAGACCTTGGGGGACTATAGGG + Intergenic
934920486 2:98340544-98340566 GACGAGATGGGCGGATTACAAGG + Intronic
935902911 2:107811457-107811479 GGTGACATGGGGGCATGACATGG - Intergenic
937652083 2:124330416-124330438 CAGGACATGTGGGGATTATGGGG - Intronic
937991823 2:127666923-127666945 CTTGACACGTGGGGATTATAGGG + Intronic
938708007 2:133950622-133950644 CTTGACATGTGGGGATTATGGGG - Intergenic
939803821 2:146748219-146748241 CTTGACATGTGGGGATTATGGGG + Intergenic
940107490 2:150115681-150115703 GGTGAAATGGGGGAATTGTAAGG - Intergenic
940488492 2:154327035-154327057 CTTGACCTGTGGGGATTATAGGG - Intronic
940552504 2:155178955-155178977 CATGACACGTGGGGATTATGGGG - Intergenic
940852869 2:158704796-158704818 CTTGACATGTGGGGATTATGGGG - Intergenic
941395666 2:164969634-164969656 CATGACATGTGGGGATTATGAGG + Intergenic
941587510 2:167379303-167379325 CTTGACATGTGGGGATTATGGGG + Intergenic
941747636 2:169103796-169103818 GATGACATTTGAGGATTCTATGG + Intergenic
942171084 2:173290133-173290155 GATGACATTGGAGGATTGCATGG - Intergenic
942559741 2:177207847-177207869 CTTGACATGTGGGGATTACAGGG + Intergenic
942859801 2:180596024-180596046 CATGACACGTGGGGATTATGGGG - Intergenic
942886953 2:180937553-180937575 TTTGACATGTGGGGATTATGAGG - Intergenic
942891770 2:180998578-180998600 GATGACATAGGTAAATTATAGGG - Intronic
942935544 2:181552296-181552318 CTTGACATGTGGGGATTATGGGG - Intronic
943082171 2:183268241-183268263 CTTGACATGTGGGGATTATAGGG + Intergenic
943216189 2:185039387-185039409 TTTGACATGTGGGGATTATGGGG - Intergenic
943693233 2:190891520-190891542 AATTACATTGGGGAATTATAAGG + Intronic
943815366 2:192247989-192248011 GATGTTGTGGTGGGATTATATGG - Intergenic
944755215 2:202754652-202754674 GCTGACATGGGCGGATCACAAGG + Intronic
944805509 2:203277112-203277134 GCTGACATGGGCGGATCACAAGG + Intronic
944891930 2:204126916-204126938 CACGGCATGTGGGGATTATAGGG - Intergenic
945321287 2:208426554-208426576 CTTGACATGTGGGGATTATGGGG - Intronic
945357983 2:208861175-208861197 CTTGACATGAGGGGATTATAAGG - Intergenic
946585909 2:221187448-221187470 GATGATAAGGGGGAATTACAAGG - Intergenic
947033037 2:225820033-225820055 CTTGACATGTGGGGATTATGAGG - Intergenic
947289975 2:228562093-228562115 CATGACATGTGTGGATTATGTGG + Intergenic
947364054 2:229375870-229375892 CTTGACATGTGGGGATTATGAGG - Intronic
947366800 2:229404497-229404519 CTTGACATGTGGGGATTATGGGG + Intronic
1169619621 20:7491092-7491114 CTTGACATGTGGGGATTATGGGG - Intergenic
1169704261 20:8484729-8484751 GATGACACAAGGGGACTATAAGG - Intronic
1172811867 20:37653948-37653970 CTTGACACGTGGGGATTATATGG + Intergenic
1174095979 20:48089813-48089835 CATGACACGTGGGGATTATGGGG - Intergenic
1175503060 20:59463884-59463906 CTTGACATGTGGGGATTATGGGG - Intergenic
1175563273 20:59951182-59951204 CATGACATGTGGGGATTATGGGG + Intergenic
1176816856 21:13610776-13610798 CAGGACATGGGGGGATGATGGGG + Intronic
1177119712 21:17124569-17124591 GGTGAAATGGGGGAATTGTAAGG - Intergenic
1177328866 21:19629812-19629834 CTTGACATGTGGGGATTATGCGG - Intergenic
1177334338 21:19703972-19703994 CTTGACATGAGGGGATTACAGGG + Intergenic
1177513284 21:22117541-22117563 CTTGACATGTGGGGATTATGGGG + Intergenic
1177529144 21:22337699-22337721 CTTGACATGTGGGGATTATGGGG - Intergenic
1177531856 21:22370954-22370976 CTTGACATGTGGGGATTATGAGG + Intergenic
1178751098 21:35303657-35303679 CTTGACATGTGGGGATTATGGGG + Intronic
1179007158 21:37525482-37525504 CATGACACGTGGGGATTATGGGG + Intergenic
1179011073 21:37556731-37556753 CATGACACATGGGGATTATAGGG + Intergenic
1179049010 21:37872766-37872788 CATGACATGTGAGGATTATGGGG - Intronic
1180788382 22:18559375-18559397 GCTGACATGGGTGGATCATGAGG + Intergenic
1181233356 22:21435943-21435965 GCTGACATGGGTGGATCATGAGG - Intronic
1181245294 22:21498900-21498922 GCTGACATGGGTGGATCATGAGG + Intergenic
1181263768 22:21617945-21617967 GATGAGATGGGTGGATCATGAGG + Intronic
1181824214 22:25500878-25500900 CTTGACATGTGGGGATTATGGGG + Intergenic
1184872292 22:47248590-47248612 CTTGACATGTGGGGATTATGGGG - Intergenic
1184894740 22:47400293-47400315 CTTGACATGTGGGGATTATGGGG + Intergenic
949264399 3:2139929-2139951 CATGACAGGTGGGAATTATAGGG - Intronic
949272600 3:2237012-2237034 GATGAGATGGTGGGAATATTTGG + Intronic
951401383 3:22236442-22236464 GATGACTTGGGAGGCTTAGATGG - Intronic
951793936 3:26517403-26517425 GCTGAGATGGGTGGATTATGAGG - Intergenic
951860692 3:27249022-27249044 CTTGACATGTGGGGATTATAGGG - Intronic
954877373 3:53811070-53811092 GATGGCATGGGGGTGTTATAAGG - Intronic
956548856 3:70437496-70437518 GATAAAATGGGGGAATTGTAAGG + Intergenic
957675115 3:83355796-83355818 GATAAAATGGGGGAATTGTAAGG + Intergenic
957848809 3:85778397-85778419 CCTGACATGCGGGGATTATGGGG - Intronic
958487189 3:94727829-94727851 CTTGACATGTGGGGATTATGGGG - Intergenic
958688711 3:97432894-97432916 CTTGACATATGGGGATTATAGGG + Intronic
959099292 3:101992138-101992160 CTTGACATGTGGGGATTATGGGG - Intergenic
959214950 3:103438889-103438911 GTTGACACAGGGGGATTATGGGG + Intergenic
960077932 3:113509749-113509771 CATGACACATGGGGATTATAGGG - Intronic
961051760 3:123752639-123752661 GATGAAATGGGGGCGTTATGAGG - Intronic
962778807 3:138691445-138691467 TTTGACATGTGGGAATTATAGGG - Intronic
962984285 3:140520565-140520587 CTTGACATGTGGGGATTATCGGG + Intronic
963171021 3:142251390-142251412 GAGGACACGGGAGGATTATGGGG + Intergenic
964362187 3:155910008-155910030 GCTGAGATGGGCGGATTACAAGG + Intronic
964449752 3:156800603-156800625 CATGACATGTTGGGATTATGGGG + Intergenic
964775427 3:160270730-160270752 ATATACATGGGGGGATTATATGG - Intronic
964975420 3:162614193-162614215 CATGACACGTGGGGATTATGGGG - Intergenic
965626178 3:170685964-170685986 GGTGAAATGGGGGAATTGTAAGG + Intronic
966847788 3:184144000-184144022 GATGACATGGGTGGACAAAAGGG - Intronic
967585962 3:191215288-191215310 TTTGACATGTGGGGATTATGGGG + Intronic
969151975 4:5177403-5177425 CATGACATGTGGGCATTATAGGG + Intronic
969195541 4:5560580-5560602 CTTGACACGTGGGGATTATAAGG + Intronic
969396727 4:6926606-6926628 GATGACATGGGCAGAGTCTAGGG + Intronic
969724400 4:8910798-8910820 GTTGAGATGGGGAGATTATCCGG + Intergenic
970157653 4:13157647-13157669 CACGACATGTGGGGATTATGGGG + Intergenic
970906423 4:21221612-21221634 CTTGACATGTGGAGATTATAGGG + Intronic
971977007 4:33703348-33703370 CATGAGATGTGGGGATTATGGGG - Intergenic
972015412 4:34236944-34236966 CTTGACATGTGGGGAGTATATGG + Intergenic
972031508 4:34465180-34465202 CTTGACATGTGGGGATTATGAGG - Intergenic
972094897 4:35335747-35335769 CTTGACATGTGGGGATTATGGGG + Intergenic
972235939 4:37134654-37134676 GCTGAGATGGGCGGATCATAAGG - Intergenic
973032487 4:45361458-45361480 CATGACAGGTGGGGATTATGGGG - Intergenic
973207599 4:47577768-47577790 GATGATATTAGAGGATTATAAGG - Intronic
973991087 4:56408201-56408223 GCTGACGTGGGCGGATTACAAGG + Intronic
974125792 4:57693803-57693825 CTTGACATGTGGGGATTATGGGG - Intergenic
974285946 4:59867579-59867601 CTTGACATGTGGGGATTATAGGG - Intergenic
974698191 4:65401997-65402019 CTTGACATGTGGGGATTATGGGG - Intronic
975052705 4:69884959-69884981 CTTGACATGTGGGGATTATGGGG + Intergenic
975302213 4:72803051-72803073 CTTGAGATGTGGGGATTATAGGG + Intergenic
975361195 4:73474302-73474324 CTTGACATGTGGGGATTATGGGG + Intergenic
975361449 4:73476246-73476268 GTTGACATGTGAGGATTATGGGG + Intergenic
975403149 4:73960850-73960872 CATGACACGTGGGGATTACAAGG - Intergenic
975862284 4:78690381-78690403 GATTACAGGCTGGGATTATAGGG - Intergenic
975874036 4:78814432-78814454 CATGACATGTGGGGATTATAGGG - Intronic
976040310 4:80876268-80876290 CGTGACATGTGAGGATTATATGG - Intronic
976530249 4:86143261-86143283 CTTGACATGTGGGGATTATGGGG + Intronic
976696683 4:87924940-87924962 GATAAAATGGGGGAATTGTAAGG - Intergenic
976871831 4:89803632-89803654 CTTGACATGTGGGGATTATGGGG - Intronic
977292729 4:95181114-95181136 GATGACTTTGGGGGATTAAGGGG - Intronic
977646135 4:99415001-99415023 CTTGACATGTAGGGATTATAGGG - Intronic
978667274 4:111199270-111199292 CTTGACATGTGGGGATTATGGGG + Intergenic
978803924 4:112780846-112780868 CTTGACATGTGGGGATTATCAGG + Intergenic
980111780 4:128643501-128643523 GGTGAAATGGGGGAATTTTAAGG + Intergenic
980338762 4:131513458-131513480 CTTGACATGTGGGGATTATGGGG - Intergenic
980520181 4:133921599-133921621 TTTGACATGTGGGGATTATGGGG - Intergenic
980757874 4:137190022-137190044 CTTGACATGTGGGGATTATGTGG + Intergenic
981219181 4:142212021-142212043 GAAGACATGTTAGGATTATAAGG + Intronic
981464000 4:145045464-145045486 GATGACATGGGGAGATGACCAGG - Intronic
982180339 4:152743967-152743989 GGTGAAATGGGGGAATTGTAAGG + Intronic
983053783 4:163078837-163078859 CTTGACATGTGGGGATTATGGGG - Intergenic
983150482 4:164273392-164273414 CTTGACATGTGGGGATTATGGGG + Intronic
984219621 4:176956612-176956634 TTTGACATGTGGGGATTATGGGG + Intergenic
984393474 4:179167528-179167550 GGTGAAATGGGGGAATTGTAAGG + Intergenic
986449865 5:7853132-7853154 TTTGACATGTGGGGATTATGGGG - Intronic
986554904 5:9001180-9001202 GGTGAAATGGGGGAATTGTAAGG + Intergenic
986678502 5:10211695-10211717 TTTGACATGTGGGGATTATGGGG - Intergenic
987013284 5:13790505-13790527 CTTGACATGTGGGGATTATGAGG - Intronic
987381072 5:17286715-17286737 GATGACTTGGGGTGAGTATCTGG - Intergenic
987398500 5:17449503-17449525 GATGAGATTGGTGGATCATATGG + Intergenic
987693833 5:21302497-21302519 CTTGACATGTGGGGATTATGGGG - Intergenic
987755963 5:22097913-22097935 GGTGAAATGGGGGAATTGTAAGG - Intronic
988053128 5:26055822-26055844 CTTGACATGTGGGGATTATGGGG + Intergenic
988782623 5:34537040-34537062 GATGATAAGGGGTGATGATAAGG - Intergenic
989422750 5:41258941-41258963 CTTGACATGTGGGGATTATGAGG + Intronic
990143228 5:52729994-52730016 CTTGACATGTGGGGATTATGGGG - Intergenic
990266396 5:54081496-54081518 CTTGACATGTGGGGATTATGGGG - Intronic
990706076 5:58531191-58531213 CATGACATGTGGGGATTATGGGG + Intergenic
991746424 5:69747042-69747064 CTTGACATGTGGGGATTATGGGG + Intergenic
991751281 5:69808199-69808221 CTTGACATGTGGGGATTATGGGG - Intergenic
991798025 5:70326987-70327009 CTTGACATGTGGGGATTATGGGG + Intergenic
991825802 5:70622356-70622378 CTTGACATGTGGGGATTATGGGG + Intergenic
991830569 5:70683093-70683115 CTTGACATGTGGGGATTATGGGG - Intergenic
991890366 5:71326307-71326329 CTTGACATGTGGGGATTATGGGG + Intergenic
992092402 5:73328971-73328993 AATGACATGTGGGGATTAGAAGG - Intergenic
992380938 5:76236844-76236866 TTTGACATGTGGGGATTATGGGG - Intronic
992817787 5:80462500-80462522 CTTGACATGCAGGGATTATAGGG + Intronic
992903566 5:81322936-81322958 CTTGACATGTGGGGATTATAGGG + Intergenic
992912319 5:81408064-81408086 CATGACACGTGGGGATTATGGGG + Intergenic
993015781 5:82532988-82533010 CATGACATGTGGGAATTGTAGGG + Intergenic
993285616 5:85991918-85991940 CATGACATGTGGGGATTGTGAGG - Intergenic
994246504 5:97484612-97484634 CTTGACATGTGGGGATTATGGGG + Intergenic
994708135 5:103231123-103231145 CTTGACATGTGGGGATTATGGGG + Intergenic
994785507 5:104156387-104156409 CTTGACATGTGGGGATTATGAGG - Intergenic
994980153 5:106864009-106864031 GAAGTAATGGGGGGATTATACGG - Intergenic
995050233 5:107694895-107694917 CTTGTCATGTGGGGATTATAGGG + Intergenic
995627381 5:114093815-114093837 CTTGACAAGTGGGGATTATAGGG + Intergenic
996682721 5:126245994-126246016 CATCACATGTGGGGATTATGAGG + Intergenic
996917817 5:128732581-128732603 GGTGAAATGGGGGAATTGTAAGG - Intronic
997168627 5:131690381-131690403 CTTGACATGTGGGGATTATGGGG - Intronic
997179312 5:131812023-131812045 GATTACAAGGGGGAATTCTAGGG - Intronic
998202763 5:140138396-140138418 GATGAGGTGGGTGGATTACAAGG + Intergenic
998693561 5:144613988-144614010 GGTGAAATGGGGGAATTATAAGG + Intergenic
998794367 5:145802475-145802497 GAAGAGATGGAGGGAGTATAGGG + Intronic
1000515882 5:162236099-162236121 CTTGACATGTGGGGATTATGGGG + Intergenic
1002553793 5:180018530-180018552 CTTGACATGTGGGGATTATAGGG + Intronic
1003425482 6:5995813-5995835 GATGAGATGGTGGGAGTATTGGG - Intergenic
1004507853 6:16261627-16261649 GGTAAAATGGGGGAATTATAAGG + Intronic
1005557077 6:26997440-26997462 CTTGACATGTGGGGATTATGGGG + Intergenic
1008337739 6:50326530-50326552 CATGAGATGTGGGGATTATGGGG + Intergenic
1008730347 6:54474387-54474409 CTTGACATGTGGGGATTATTGGG - Intergenic
1008850068 6:56013453-56013475 GATAAAATGGGGGAATTGTAAGG + Intergenic
1009467706 6:63992870-63992892 CTTGACATGTGGGGATTATGGGG - Intronic
1009710069 6:67307095-67307117 CTTGACATGTGGGGATTATGAGG - Intergenic
1009900703 6:69804831-69804853 GATGACATGGAAGGATTAGGAGG - Intergenic
1010331046 6:74624212-74624234 CTTGACATGTGGGGATTATGGGG - Intergenic
1010841159 6:80650398-80650420 GATAAAATGGGGGAATTGTAAGG + Intergenic
1010879705 6:81152489-81152511 CTTGACATGTGGGGATTATGGGG + Intergenic
1011221066 6:85054966-85054988 TTTGACATGTGGGGATTATGGGG + Intergenic
1011252959 6:85392510-85392532 ATTGACATGTGGGGATTATGGGG - Intergenic
1011385681 6:86795724-86795746 CTTGACATGTGGGGATTATGGGG + Intergenic
1011775613 6:90727455-90727477 CTTGACATGTGGGGATTATGGGG - Intergenic
1011847640 6:91586317-91586339 TATGACATGGGGGCACTATTTGG - Intergenic
1012038240 6:94170289-94170311 CTTGACACGTGGGGATTATAGGG + Intergenic
1012255205 6:97023097-97023119 CTTGACATGTGGGGATTATGAGG + Intronic
1012256660 6:97040713-97040735 CTTGACATGTGGGGATTATAGGG - Intronic
1012726851 6:102824635-102824657 CTTGACATGTGGGGATTATGGGG - Intergenic
1012772001 6:103449866-103449888 CATGACACGTGGGGATTATGGGG + Intergenic
1012798623 6:103796147-103796169 CTTGATATGTGGGGATTATAGGG + Intergenic
1013581067 6:111535219-111535241 GATGAGGTGGGGGGATCATGAGG - Intergenic
1013905181 6:115208173-115208195 GCTGACATGGGCGGATCACAAGG - Intergenic
1014139604 6:117926131-117926153 CTTGACAAGTGGGGATTATAGGG - Intronic
1014280123 6:119433085-119433107 CTTGACATGTGGGGATTATGAGG - Intergenic
1014329427 6:120042335-120042357 CTTGACATGTGGGGATTATGGGG + Intergenic
1014613959 6:123579734-123579756 CTTGACATGTGGGGATTATAGGG - Intronic
1014740141 6:125140078-125140100 CATGACACTTGGGGATTATAGGG - Intronic
1015173351 6:130279239-130279261 CATGACACATGGGGATTATAAGG - Intronic
1015266886 6:131298524-131298546 GGTAAAATGGGGGAATTATAAGG - Intergenic
1015269796 6:131326469-131326491 GGTAAAATGGGGGAATTATAAGG - Intergenic
1015369656 6:132436540-132436562 GATGAGATGGGAGGATCAGATGG + Intergenic
1015457020 6:133437871-133437893 CTTGACATGTGGGGATTATGAGG + Intronic
1015518879 6:134112289-134112311 CTTGACATGTGGGGATTATGGGG - Intergenic
1015801241 6:137063964-137063986 GGTGAAATGGGGGAATTGTAAGG + Intergenic
1015822511 6:137279588-137279610 CTTGACATGTGGGGATTATAGGG + Intergenic
1016281990 6:142428777-142428799 GTTGACATTTGGGGATTATGGGG + Intronic
1016700808 6:147052078-147052100 GATGAGATGGTGGGAATCTAGGG - Intergenic
1016835701 6:148474669-148474691 GCTGACATGGGAGGATTACTTGG - Intronic
1017348019 6:153407015-153407037 CTTGACATGTGGGGATTATGGGG - Intergenic
1017927862 6:158925848-158925870 TATGACATGTGGGGATTATGGGG - Intergenic
1018138736 6:160805657-160805679 ATTGACATGCGGGGATTATGGGG + Intergenic
1018355049 6:163004601-163004623 CTTGACATGTGGGGATTATGGGG + Intronic
1019496518 7:1342953-1342975 CATGACAAGTGGGGATTATGGGG - Intergenic
1020607872 7:10360644-10360666 CTTGACATGTGGGGATTACAGGG - Intergenic
1020739615 7:11997495-11997517 CGTGACATGTGGGGATTATGGGG + Intergenic
1020840499 7:13211615-13211637 CTTGACATGTGGGGATTATGGGG + Intergenic
1020852813 7:13378358-13378380 CTTGACGTGTGGGGATTATAGGG - Intergenic
1021128950 7:16887485-16887507 GATGAAATAGGGGAAATATAAGG + Intergenic
1021618292 7:22524851-22524873 CTTGACATGTGGGGATTATGGGG - Intronic
1022023990 7:26428731-26428753 CTTGACATGTGGGGATTATGGGG - Intergenic
1024937795 7:54729294-54729316 TATGACATGTGGGGATTATGGGG - Intergenic
1025871395 7:65437713-65437735 GATAACATCGGGAGATTTTATGG + Intergenic
1027466693 7:78523786-78523808 CTTGACATGTGGGGATTATGGGG + Intronic
1027507867 7:79040591-79040613 CTTGACATGTGGGGATTATGGGG - Intronic
1027697665 7:81432001-81432023 CTTGACATGTGGGGATTATGGGG - Intergenic
1027887711 7:83930615-83930637 CTTGACATATGGGGATTATAGGG + Intergenic
1027953777 7:84854630-84854652 CTTGACATGTGGGGATTATGGGG + Intergenic
1028032527 7:85933714-85933736 CATGACATGTGGGGATTATGGGG - Intergenic
1028128226 7:87139746-87139768 GATGACATGGAGGGAAACTAAGG + Intergenic
1028368766 7:90066759-90066781 GATGATAAGAGGGGATAATATGG + Intergenic
1028374388 7:90131269-90131291 CTTGACATGTGGGGATTATGGGG + Intergenic
1028493788 7:91441984-91442006 CTTGACATGTGGGGATTATGGGG - Intergenic
1028516162 7:91680253-91680275 CTTGACATGTGGGGATTATGGGG + Intergenic
1028715180 7:93957410-93957432 CATGACATGTGGGAATTATGGGG - Intergenic
1029317313 7:99726343-99726365 GGTAAGATGGGGGAATTATAAGG - Intronic
1030163474 7:106531080-106531102 GATAAAATGGGGGAATTGTAAGG + Intergenic
1030401004 7:109050027-109050049 CTTGACATGTGGGGATTATGAGG - Intergenic
1030873278 7:114783406-114783428 CATAACATGTGGGGATTATGCGG + Intergenic
1030902365 7:115140421-115140443 CTTGACATGCGGGGATTATGGGG - Intergenic
1030956248 7:115856143-115856165 CATGACATGTGGGTATTATGTGG + Intergenic
1031296752 7:120011954-120011976 GGTGAAATGGGGGAATTGTAAGG - Intergenic
1031454679 7:121964511-121964533 CATGACATGTGGGGATTATGGGG + Intronic
1032715856 7:134508719-134508741 CTTGACATGTGGGGATTATGGGG + Intergenic
1033392370 7:140940169-140940191 CATGCCATGTGGGGATTATGGGG + Intergenic
1033722785 7:144079290-144079312 GCTGAGGTGGGGGGATTACAAGG + Intergenic
1033777871 7:144633077-144633099 GTTGACATGTGCAGATTATAAGG + Intronic
1033875771 7:145817177-145817199 AAAGACATAGGGAGATTATAAGG + Intergenic
1035790670 8:2301459-2301481 TATGACATGTGGGGTTTATGGGG + Intergenic
1035802135 8:2420246-2420268 TATGACATGTGGGGTTTATGGGG - Intergenic
1035817193 8:2553906-2553928 CTTGACATGTGGGGATTATGGGG - Intergenic
1036441615 8:8787038-8787060 GCTTACATGGTGGGATTATTAGG - Intronic
1036472199 8:9062075-9062097 GGTGAAATGGGGGAATTGTAAGG + Intronic
1038391094 8:27201774-27201796 GAGGACCTGGGGAGATTTTAGGG + Intergenic
1038560311 8:28571592-28571614 CATGAAATGGGGTGATTCTAGGG - Exonic
1039098474 8:33913680-33913702 CTTGATATGTGGGGATTATAGGG - Intergenic
1041487930 8:58399449-58399471 CATGACACGTGGGGATTATGGGG + Intergenic
1041651711 8:60309140-60309162 GGTAAAATGGGGGGATTGTAAGG + Intergenic
1042077183 8:65008882-65008904 CTTGACATGTGGGGATTATGGGG + Intergenic
1042631397 8:70820831-70820853 CTTGACATGTGGGGATTATGGGG + Intergenic
1043365395 8:79527078-79527100 CTTGACATGTGGGGATTATGGGG - Intergenic
1043625207 8:82248719-82248741 CATGACATTTGGGGATTATGGGG - Intergenic
1043972595 8:86548547-86548569 GATAAGACGGGGGGATTTTAGGG - Intronic
1044066463 8:87705524-87705546 CTTGACATGTGGGGATGATAGGG + Intergenic
1044066773 8:87707832-87707854 CTTGACATGTGGGGATTATGGGG + Intergenic
1045456198 8:102381475-102381497 CTTGACATGTGGGGATTATGGGG + Intronic
1046223968 8:111252113-111252135 CATGACATGTGGGGATTATAAGG + Intergenic
1046491216 8:114954418-114954440 TGTGAAATGTGGGGATTATAGGG + Intergenic
1047383607 8:124387440-124387462 GATGACAAAGGGAAATTATAGGG + Intergenic
1047644081 8:126851433-126851455 GACTACATTGGGGGACTATATGG + Intergenic
1047860428 8:128959939-128959961 CTTGACATGTGAGGATTATAGGG + Intergenic
1048532788 8:135265568-135265590 CTTGACATGTGGGGATTATGGGG - Intergenic
1048622723 8:136152402-136152424 TTTGACATGTGGGGATTATGAGG + Intergenic
1048748292 8:137641336-137641358 CTTGACATGTGGGGATTATGGGG - Intergenic
1048826939 8:138437312-138437334 CATGACAGGTGGGGATTATGGGG - Intronic
1049489207 8:142884520-142884542 CATGACATGGGTGGGTCATATGG + Intronic
1050385644 9:5087403-5087425 AATGACATGTGGGGATTATGGGG + Intronic
1050769375 9:9177314-9177336 CTTGACATGTGGGGATTATGGGG + Intronic
1050896219 9:10887845-10887867 GATAAAATGGGGGAATTTTAAGG - Intergenic
1051107056 9:13592474-13592496 GATGGGATTGGGGGATTATTGGG - Intergenic
1051607472 9:18929547-18929569 GATTACATGTGAGGATTACAGGG - Intronic
1051668706 9:19489210-19489232 CTTGACATGTGGGGATTATGGGG - Intergenic
1051888410 9:21918619-21918641 CATGACATGTGGGGATTATTGGG - Intronic
1052467958 9:28853822-28853844 CTTGACATGTGGGGATTATGGGG + Intergenic
1052554353 9:29994633-29994655 CTTGACATGGGGGGATTATGGGG + Intergenic
1052653481 9:31329483-31329505 GGTGAAATGGGGGAATTGTAAGG - Intergenic
1052666210 9:31498016-31498038 CTTGACATGTGGGGATTATGGGG + Intergenic
1053637566 9:40027409-40027431 GCTGAGATGGGCGGATTATGAGG + Intergenic
1053768516 9:41437830-41437852 GCTGAGATGGGCGGATTATGAGG - Intergenic
1054547183 9:66349311-66349333 GCTGAGATGGGCGGATTATGAGG - Intergenic
1054852701 9:69865013-69865035 CTTGACATGTGGGGATTATGGGG - Intronic
1055225640 9:73991076-73991098 GTTAACATGTGGGGATTATAGGG + Intergenic
1056360816 9:85855778-85855800 CTTGACATGTGGGGATTACAGGG - Intergenic
1056434846 9:86565918-86565940 ATTGACATGTGGGGATTATGGGG + Intergenic
1056805795 9:89727629-89727651 GGGGAGATGGGGTGATTATAAGG + Intergenic
1057823587 9:98353751-98353773 CTTGACATGTGGGGATTATCGGG - Intronic
1058209089 9:102144820-102144842 CTTGACATGTGGGGATTATAGGG + Intergenic
1059565103 9:115376258-115376280 CTTGACATGTGGGGATTATGGGG + Intronic
1059613811 9:115927298-115927320 CTTGACATGTGGGGATTATGGGG - Intergenic
1059759469 9:117324583-117324605 CTTGACATGTGGGGATTATGGGG + Intronic
1059987036 9:119830463-119830485 GATGATATGGTGGGGTTTTAGGG + Intergenic
1060706261 9:125804475-125804497 CGTGACATGAAGGGATTATAAGG + Intronic
1062057007 9:134473980-134474002 GGTGACTTGGGGGGCTTGTAGGG + Intergenic
1062719779 9:138033851-138033873 CTTGACACGTGGGGATTATAGGG + Intronic
1186059030 X:5683719-5683741 CTTGACATGTGGGGATTATAGGG - Intergenic
1186260185 X:7769284-7769306 CTTGACATGTGGGGATTATGGGG + Intergenic
1187574890 X:20543264-20543286 CTTGACATGTGGGGATTATAGGG - Intergenic
1187797915 X:23024559-23024581 CTTGACATGTGGGGATCATAGGG + Intergenic
1188048942 X:25460726-25460748 CGTGACATGTGGGGATTATGAGG + Intergenic
1188758477 X:33995140-33995162 TTTGACATGTGGGGATTATGGGG - Intergenic
1188895832 X:35667509-35667531 CTTGACATGTGGGCATTATAGGG - Intergenic
1189176712 X:38964587-38964609 GTTGACACGTGGGGATTATGGGG + Intergenic
1189577066 X:42365241-42365263 CTTGACATGTGGGCATTATAGGG + Intergenic
1189743192 X:44142698-44142720 CTTGACACGTGGGGATTATAGGG + Intergenic
1190579113 X:51873310-51873332 CTTGACATGTGGGGATTATGAGG + Intronic
1190819128 X:53957110-53957132 GCTGACATGGGCGGATCACAAGG + Intronic
1191895176 X:65985089-65985111 GATGACATGGGGGCATAATTTGG + Intergenic
1192417973 X:71001426-71001448 GAAGACATGGAGACATTATAGGG - Intergenic
1192619673 X:72665885-72665907 GATGACATAGTTGGGTTATAAGG + Intronic
1193025072 X:76838221-76838243 TATGACATGTGGGGATTATCAGG + Intergenic
1193143604 X:78054986-78055008 CATGACATGTGGGGATTAAGGGG - Intergenic
1194019825 X:88673950-88673972 CTTGACACGTGGGGATTATAGGG - Intergenic
1194083048 X:89491249-89491271 CATGACATGTGAGGATTATGGGG + Intergenic
1194322320 X:92464292-92464314 TGTGACATGTGGGGATTATGGGG - Intronic
1194518226 X:94885520-94885542 CTTGACATGTGGGGATTATGGGG + Intergenic
1194568279 X:95521012-95521034 CTTGACATGTGGGGATTATGTGG + Intergenic
1194691791 X:96994881-96994903 GTTGACACGTGGGGATTATGGGG + Intronic
1194875922 X:99187658-99187680 CTTGACATGTGGGGATTATGGGG - Intergenic
1195326720 X:103764413-103764435 GGTAAAATGGGGGGATTGTAAGG + Intergenic
1196227077 X:113179431-113179453 GGTAAAATGGGGGAATTATAAGG + Intergenic
1196228229 X:113190322-113190344 CTTGACATGTGGGGATTACAGGG - Intergenic
1196642051 X:118073503-118073525 GATGATATTGGGGGATGATATGG - Intronic
1196949667 X:120864706-120864728 CTTGACATGTGGGGATTATGGGG - Intergenic
1196992539 X:121345631-121345653 GGTGAAATGGGGGAATTGTAAGG + Intergenic
1197016397 X:121631525-121631547 CCTGACATGTGGGGATTATGAGG + Intergenic
1197341822 X:125284490-125284512 CTTGACATGTGGGGATTATGGGG + Intergenic
1197582014 X:128295077-128295099 CATGACATGTGGGGATTATGGGG - Intergenic
1198276660 X:135100565-135100587 CTTGACATGTGAGGATTATAGGG - Intergenic
1199127516 X:144139975-144139997 CACGACATGTGGGGATTATGGGG + Intergenic
1199200735 X:145086639-145086661 CTTGACATGTGGGGATTATGGGG - Intergenic
1199431646 X:147767883-147767905 CATGACATGTGGGGATTATGGGG - Intergenic
1199462780 X:148102048-148102070 TTTGACATGTGGGGATTATGGGG - Intergenic
1199574382 X:149299399-149299421 CTTGACATGTGGGGATTATGGGG - Intergenic
1200276927 X:154741954-154741976 CTTGACATGTGGGGATTATGGGG + Intronic
1200390811 X:155945076-155945098 CTTGACATGTGGGGATTATAGGG - Intergenic
1200435701 Y:3147123-3147145 CATGACATGTGAGGATTATGGGG + Intergenic
1200630477 Y:5577769-5577791 TGTGACATGTGGGGATTATGGGG - Intronic
1200662930 Y:5983702-5983724 CTTGACATGTGGGGATTATGGGG - Intergenic
1201590149 Y:15605631-15605653 CATGACATGTGGGAATTATGGGG + Intergenic
1202382827 Y:24292318-24292340 CTTGACATGTGGGGATTATGGGG - Intergenic
1202487957 Y:25377807-25377829 CTTGACATGTGGGGATTATGGGG + Intergenic