ID: 1112142976

View in Genome Browser
Species Human (GRCh38)
Location 13:96666302-96666324
Sequence ATTATAGGGACTACAATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1146
Summary {0: 2, 1: 18, 2: 225, 3: 432, 4: 469}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112142964_1112142976 10 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142972_1112142976 -3 Left 1112142972 13:96666282-96666304 CCCTCTGATGACATGGGGGGATT 0: 1
1: 0
2: 44
3: 584
4: 1724
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142973_1112142976 -4 Left 1112142973 13:96666283-96666305 CCTCTGATGACATGGGGGGATTA 0: 1
1: 0
2: 52
3: 581
4: 1892
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142967_1112142976 3 Left 1112142967 13:96666276-96666298 CCAGGTCCCTCTGATGACATGGG 0: 1
1: 2
2: 39
3: 396
4: 1283
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142965_1112142976 6 Left 1112142965 13:96666273-96666295 CCACCAGGTCCCTCTGATGACAT 0: 1
1: 17
2: 266
3: 1091
4: 3059
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142960_1112142976 28 Left 1112142960 13:96666251-96666273 CCCACCATGATTCAATTACCTTC 0: 1
1: 13
2: 153
3: 345
4: 580
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142961_1112142976 27 Left 1112142961 13:96666252-96666274 CCACCATGATTCAATTACCTTCC 0: 184
1: 3372
2: 6558
3: 9434
4: 9921
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142959_1112142976 29 Left 1112142959 13:96666250-96666272 CCCCACCATGATTCAATTACCTT 0: 1
1: 13
2: 178
3: 404
4: 734
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469
1112142962_1112142976 24 Left 1112142962 13:96666255-96666277 CCATGATTCAATTACCTTCCACC 0: 109
1: 2008
2: 5532
3: 9528
4: 10863
Right 1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG 0: 2
1: 18
2: 225
3: 432
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112142976 Original CRISPR ATTATAGGGACTACAATTCA AGG Intronic
900877674 1:5356649-5356671 ATTATAGGAGCTACAATTCAAGG + Intergenic
900908826 1:5579774-5579796 ATTATAGGGATTACAATTCAAGG + Intergenic
901400591 1:9012822-9012844 ATTATGGTGACTGCAATACATGG - Intronic
901612675 1:10511536-10511558 GTTATAGGTCCTACAGTTCATGG - Intronic
902084348 1:13847506-13847528 ATTATGGGCATTACAATTGAAGG - Intergenic
903242145 1:21990184-21990206 ATTATGGGGATTACAATTCAAGG + Intronic
903245655 1:22013371-22013393 ATTATGGGGATTACAATTCAAGG + Intergenic
903844126 1:26267261-26267283 ATTATAAGGGATACAATTCAGGG + Intronic
903914056 1:26750329-26750351 ATTATAGGTACAACAACTAAAGG - Intronic
904337447 1:29807274-29807296 ATTATGGGAGCTACAGTTCAAGG - Intergenic
904820463 1:33239757-33239779 ATTACAGGGATTACAATTCAAGG + Intergenic
905763928 1:40584439-40584461 ATTATGGGGATTACAATTCAAGG + Intergenic
905817802 1:40965510-40965532 CTGCTAGGGACTACATTTCATGG + Intergenic
906831296 1:49034562-49034584 ATTATGGGAACTACAATTCCAGG - Intronic
906938294 1:50233910-50233932 ATTATGGGAGCTAAAATTCAAGG - Intergenic
907038786 1:51239230-51239252 ATTAAAGGTACTAGAATTTATGG + Intronic
907180511 1:52565726-52565748 ATTATGGGAACTACAATTCAAGG - Intergenic
907556224 1:55346287-55346309 ATTATAAGAACTATAATTCAAGG + Intergenic
907839134 1:58139603-58139625 ATTATGGGAACTACAATTTAAGG + Intronic
907846553 1:58213639-58213661 ATTATGGGAACTACAATTCAAGG + Intronic
907934649 1:59031556-59031578 ATTATGGAGATTACAATTCAAGG + Intergenic
908118573 1:60964735-60964757 ATTATGGGAACTACAACACAAGG + Intronic
908846417 1:68329002-68329024 ATTATGGGGATTACAATTCAAGG - Intergenic
909058559 1:70851854-70851876 ATTATGGGAACTAAAATTAAAGG - Intergenic
909424759 1:75510156-75510178 ATTATGGGAGCTACAATTCAAGG + Intronic
909439973 1:75686145-75686167 ATTATGGGAACTACTATTCAAGG + Intergenic
909748193 1:79125585-79125607 ATTATGGGAACTACAAGTCAAGG - Intergenic
909794879 1:79720466-79720488 ATTATCAGGATTACAATTCAAGG + Intergenic
909933069 1:81520470-81520492 ATTATGGGGATTACAATTCAAGG - Intronic
910042945 1:82875212-82875234 ATTATAGGGATTACCATTCAAGG + Intergenic
910378188 1:86595865-86595887 ATATTGGGGATTACAATTCATGG + Intergenic
910764885 1:90771886-90771908 ATAATGGGAGCTACAATTCAAGG - Intergenic
911229062 1:95340757-95340779 AGAAAAGGGACTACCATTCATGG - Intergenic
911466267 1:98256978-98257000 ATTATGGGGATTACAATTTGAGG + Intergenic
911467345 1:98272361-98272383 ATTATGGAGATTACAATTCAAGG - Intergenic
911488436 1:98531467-98531489 ATTATAGGCACTAGAATTCAGGG + Intergenic
911586687 1:99698960-99698982 ATTATCAGGATTACAATTCCAGG + Intergenic
911788262 1:101979347-101979369 ATTATAGGAATTACAATTCGAGG - Intronic
911788421 1:101980344-101980366 ATTATGGGGATTACAATTTGAGG - Intronic
912153020 1:106882460-106882482 ATTATGGGGATTACAATTCAAGG + Intergenic
912153280 1:106884398-106884420 ATTATGGAGATTACAATTCAAGG + Intergenic
912157971 1:106945647-106945669 ATTATGGGAACCACAGTTCAAGG + Intergenic
912970910 1:114282071-114282093 ATTATGGAAGCTACAATTCAAGG + Intergenic
913378117 1:118177443-118177465 ATTATGGGGATTACAATTCAAGG + Intronic
915876064 1:159613225-159613247 ATTATGGGAGCTATAATTCAAGG + Intergenic
916358452 1:163939428-163939450 ATTATGGGGATTACAATTCAAGG - Intergenic
916517024 1:165527881-165527903 TTTATAGTGAGTACACTTCAAGG - Intergenic
916670126 1:167010028-167010050 GTCATAGGGATTACAATTCGAGG - Intronic
916851361 1:168707612-168707634 ATTATGGAAACCACAATTCAAGG - Intronic
917140287 1:171828351-171828373 ATTATGGGGATTACAATTTGAGG + Intergenic
917468875 1:175308814-175308836 ATGATGAGGATTACAATTCAAGG - Intergenic
917586377 1:176431120-176431142 ATTATAGTAACTACAGTTCAAGG + Intergenic
917947126 1:179985813-179985835 ATTATGGAGATTACAATTCAGGG + Intronic
918352309 1:183669988-183670010 ATTATGGGAGCTACAATTCAAGG + Intronic
918719323 1:187832152-187832174 ATGGTAGGAGCTACAATTCAAGG + Intergenic
918828159 1:189354395-189354417 ATTATGGGGATTACAATTTGAGG - Intergenic
918849590 1:189669100-189669122 ATTACGGGGATTATAATTCAAGG + Intergenic
919156305 1:193770304-193770326 ATCATAGCCACTACAATGCAGGG + Intergenic
919502520 1:198355441-198355463 ATTATGGGGATTACAATTCAAGG - Intergenic
920000564 1:202795835-202795857 AATATAGGGAGTAAAATACAGGG + Intronic
920000571 1:202795908-202795930 AATATAGGGAGTAAAATACAGGG + Intronic
920254596 1:204645919-204645941 ATTATAGGGATTACAATTCAAGG + Intronic
920784134 1:209024375-209024397 ATTATGGGAACTACAGTTTAAGG - Intergenic
920900607 1:210106714-210106736 ATTATGGGAACTACAATCCAAGG + Intronic
921297802 1:213721293-213721315 ATTATGGGAGCTATAATTCAAGG - Intergenic
921429059 1:215042131-215042153 ATTATGGGAGCTGCAATTCAAGG + Intronic
921432215 1:215078642-215078664 ATTATGGAGATTACAAGTCAAGG + Intronic
922375635 1:224961692-224961714 ATTATGGGAATTACAATTCAAGG + Intronic
922384785 1:225071909-225071931 ATTATGGGAACTACAATTCAAGG + Intronic
922409582 1:225358719-225358741 ATTATGGGGATTACAATTCAAGG - Intronic
923788373 1:237090190-237090212 ATTATGGGAACTACAATTCAAGG + Intronic
923920721 1:238561733-238561755 ATTATAGGAACTAAAATTCAAGG - Intergenic
924297993 1:242608112-242608134 ATTATAGAGATTACAATTCAAGG + Intergenic
1063056624 10:2511450-2511472 ATTATGGGGATTGCAGTTCAAGG + Intergenic
1063327982 10:5124285-5124307 ATTATAGCAAAAACAATTCATGG + Intronic
1063518649 10:6721110-6721132 ATTATGGGAGCTATAATTCAAGG + Intergenic
1063568158 10:7190840-7190862 ATTATGGGAGCTACAATTCAAGG - Intronic
1063616190 10:7602380-7602402 ATTATGGGGATTAAAATTCAAGG - Intronic
1064080020 10:12300802-12300824 ATTATGGGAGCTACAATTCAAGG + Intergenic
1064098205 10:12440057-12440079 ATTATGGGAACTGTAATTCAAGG + Intronic
1064361204 10:14666494-14666516 ATTATGGGAACTGCAATCCAAGG + Intronic
1064375259 10:14789672-14789694 ATTATGGGAGCTACAATTCAAGG + Intergenic
1065342112 10:24717379-24717401 CTTATAGGGACTGCAATCCAAGG + Intronic
1066113930 10:32222935-32222957 ATTATGGGAGCTACAATTCAAGG + Intergenic
1068128540 10:52869471-52869493 ATTATGGGGATTACAATTCAAGG - Intergenic
1068221662 10:54052784-54052806 ATTATGGGAACTAAAATTCAAGG - Intronic
1068243666 10:54337385-54337407 ATTATGGGAGCTACAGTTCAAGG - Intronic
1068278680 10:54838228-54838250 ATTATGGTGATTACAATTCAAGG - Intronic
1068614289 10:59095730-59095752 ATTATAGAGATTACAATTCAAGG - Intergenic
1069156804 10:65039656-65039678 ATCATGGGAACTACAATTCAAGG - Intergenic
1069159897 10:65080301-65080323 ATTATGGGGATTAAAATTGAAGG - Intergenic
1069312688 10:67058136-67058158 ATTATAGGAACTGTAATTCGAGG - Intronic
1069424625 10:68278709-68278731 ATTATGGGAGCTACAATTCAAGG - Intergenic
1069681207 10:70286808-70286830 ATTATGGGAGCTACAATTCAAGG - Intergenic
1071718787 10:88122394-88122416 ATTATGAAGATTACAATTCAAGG + Intergenic
1072465462 10:95658248-95658270 ATTATGGGAATTACAATTCAAGG - Intergenic
1072593938 10:96854019-96854041 ATTATGGAGATTACAATTCAAGG + Intronic
1072982369 10:100109945-100109967 ATTATGGGGATTACAATTCAAGG + Intergenic
1073640903 10:105251374-105251396 ATTCTGGGGATTACTATTCAAGG + Intronic
1073861434 10:107746767-107746789 ATTATGGGAACTACAATTCAAGG + Intergenic
1073990840 10:109260940-109260962 GTTATGGGAGCTACAATTCAAGG + Intergenic
1074235141 10:111577292-111577314 ATTATAGGAATTACAATTTGAGG + Intergenic
1074235779 10:111583093-111583115 ATTATGGGAATTACAATTTAAGG + Intergenic
1074272179 10:111964982-111965004 ATTATGCGAACTACAATTCAAGG + Intergenic
1074838648 10:117325852-117325874 ATTATGGGGATTACAGTTCAAGG - Intronic
1076177090 10:128376592-128376614 ATTATGGAAACTACAATTCAAGG + Intergenic
1076377488 10:130001389-130001411 ATTATGGGGATGACAATTCAAGG - Intergenic
1076494758 10:130889739-130889761 ATTATGGGAATTACAATTCAAGG + Intergenic
1076532267 10:131152997-131153019 ATTATGGGGATTACAATTCGAGG + Intronic
1076585071 10:131541494-131541516 ATTATGGGGTTTACAATTCAAGG + Intergenic
1076838850 10:133034869-133034891 ATTATGGGAACTACAATTCAAGG - Intergenic
1077699098 11:4423448-4423470 ATAATTCGGATTACAATTCAAGG + Intergenic
1078301612 11:10136243-10136265 ATTATGAGAACTACAATTCAAGG + Intronic
1078553990 11:12303168-12303190 ATTATGGGGATTACAGTTCAAGG + Intronic
1078601980 11:12740778-12740800 ATCATGGGAACTACAATTCAAGG + Intronic
1078857389 11:15217348-15217370 ATTATGGGAACTACAGTTCAAGG + Intronic
1079127456 11:17728521-17728543 ATTATGGGGATTACAATTCTAGG - Intergenic
1079171561 11:18101313-18101335 ATTATGGGGATTGCAATTCAAGG - Intronic
1079511609 11:21216973-21216995 ATTATGGGAACTACAATTCAGGG - Intronic
1079655841 11:22985623-22985645 ATTATGGGAGCTATAATTCAAGG + Intergenic
1079821401 11:25135407-25135429 ATTATGGGATCTACAATTCAAGG - Intergenic
1080019027 11:27539859-27539881 ATTATGGGAACTACAATTCAAGG - Intergenic
1080206200 11:29732207-29732229 ATTATGGGAACTACAATTCAAGG + Intergenic
1080245789 11:30177779-30177801 ATTATGGGAAATACAATTCAAGG + Intergenic
1080552817 11:33388405-33388427 ATTATGGGAACTACAATTCAAGG + Intergenic
1080697884 11:34619078-34619100 ATTACAGGGCCTATAATTAAAGG + Intergenic
1080943752 11:36948279-36948301 ATTATGGGAACTACAATTCAAGG + Intergenic
1081081669 11:38748272-38748294 ATTATGGGGATTACAATTCAAGG + Intergenic
1081219834 11:40446903-40446925 ATTATGGGGATTACAATTCAAGG + Intronic
1081236665 11:40654798-40654820 ATTATGGGGATTATAATTCAAGG - Intronic
1081271554 11:41090643-41090665 ATTATGGGGATTACAATTCGAGG - Intronic
1081305552 11:41507952-41507974 ATTATAGGAGCCATAATTCAAGG - Intergenic
1081348991 11:42026201-42026223 ATTATGGGAATGACAATTCAAGG + Intergenic
1081388900 11:42505003-42505025 ATTATGGGAACTAAAATTCAAGG + Intergenic
1081393662 11:42559837-42559859 TTTATGGGGATTACAATTCAAGG - Intergenic
1081455253 11:43215576-43215598 ATTATGGCAACTCCAATTCAAGG - Intergenic
1082088330 11:48068310-48068332 AACATGGGGATTACAATTCAAGG - Intronic
1082906524 11:58313040-58313062 ATTATGGGAGCTACAATTCAAGG + Intergenic
1082941879 11:58714549-58714571 ATTATGAGAACTATAATTCAAGG - Intronic
1083371762 11:62188120-62188142 ATTTTCAGAACTACAATTCATGG - Intergenic
1084417261 11:69040130-69040152 ATTATGGGAACTATAATTCAAGG + Intergenic
1085874139 11:80385713-80385735 ATTATGGAAACTACAATTCAAGG + Intergenic
1085938825 11:81183804-81183826 ATTATGAGGATTACAATTCAAGG + Intergenic
1085986457 11:81793616-81793638 ATTATGGGGATTACAATTTGAGG + Intergenic
1086265929 11:84998210-84998232 ATTATGGGGATTACAATTCAAGG - Intronic
1086509854 11:87544403-87544425 ATTATGAGGATTACAATTCAAGG + Intergenic
1086535597 11:87841190-87841212 ATTATGGGAACTACAATTCAAGG - Intergenic
1086606623 11:88703560-88703582 ATTATGAGAACTACAATTCAAGG - Intronic
1086816130 11:91373549-91373571 ATTATGGAAACTACAATTCAAGG - Intergenic
1086828713 11:91533326-91533348 ATTATGGGGATTACAATTCAAGG - Intergenic
1086828964 11:91535222-91535244 ATTATGGGGATTAGAATTCAAGG - Intergenic
1086836983 11:91637275-91637297 ATTATGGGGATTACTATTCAAGG - Intergenic
1087009923 11:93503424-93503446 ATTATGGGAGCTACAATTCAAGG + Intronic
1087299782 11:96418923-96418945 ATTATGGGGATTACAATTCAAGG - Intronic
1087400344 11:97658063-97658085 ATAATTTGGATTACAATTCAAGG + Intergenic
1087434953 11:98103041-98103063 ATTATAGAGAGTAGAATTTAAGG + Intergenic
1087729925 11:101767489-101767511 ATTATATGAACTACAATTCAAGG + Intronic
1087730198 11:101769471-101769493 ATCATGGGAACTATAATTCATGG + Intronic
1087917117 11:103823729-103823751 ATCATGGGGAGTATAATTCAAGG - Intergenic
1087987886 11:104707292-104707314 ATTATGGTGATTACAATTCAAGG + Intergenic
1088937512 11:114418004-114418026 ATTATGGGAACTACAATTCAAGG + Intronic
1089115956 11:116095305-116095327 ATTATGGGAGCTACAGTTCAAGG + Intergenic
1089152112 11:116372250-116372272 ATTATGGGAGCTACAATTCAAGG - Intergenic
1089162430 11:116449473-116449495 ATTATAAGGATTATAATTCAAGG + Intergenic
1090159446 11:124477264-124477286 AATATAGCCAATACAATTCAGGG + Intergenic
1090935541 11:131338573-131338595 ATTATGTGAACTACAATTCAAGG + Intergenic
1091060980 11:132461957-132461979 ATTATGGAAACTACAATTCAAGG + Intronic
1091148436 11:133302180-133302202 ATTATGGAGATTACAATTCAAGG - Intronic
1092225104 12:6743362-6743384 ATTACGGGAGCTACAATTCAAGG - Intergenic
1092971647 12:13701229-13701251 ATTATGGGGATTACAATTCAAGG + Intronic
1093123277 12:15299177-15299199 ATTACAGAGATTACAATTCAAGG + Intronic
1093123542 12:15301082-15301104 ATTATGGGGATTACAATTCGAGG + Intronic
1093195861 12:16129017-16129039 ATTATAGGAGCTACAATTCAAGG - Intergenic
1093220247 12:16412556-16412578 ATTATGGGAGCTACAATTCAAGG - Intronic
1093337070 12:17919094-17919116 ATTATGGGAGCTACAATTCAAGG + Intergenic
1094282356 12:28754236-28754258 ATTATGGAAGCTACAATTCAAGG + Intergenic
1094342960 12:29433201-29433223 ATTATGGAAGCTACAATTCAAGG - Intronic
1094421047 12:30272007-30272029 ATTATGGGAACTAAAAGTCAGGG + Intergenic
1094556026 12:31501119-31501141 ATTATGGGAACTACAATTCAAGG - Intronic
1094799689 12:34018827-34018849 ATTATGGGGATTATAATTCAAGG + Intergenic
1095112478 12:38313146-38313168 ATTATGGGGATCATAATTCAAGG + Intergenic
1095122504 12:38436525-38436547 ATTATGGGAGCTACAGTTCAAGG + Intergenic
1095136739 12:38614259-38614281 ATTATGGGGGTTACAATTCAAGG - Intergenic
1095318793 12:40800074-40800096 ATAAAAAGGATTACAATTCAAGG - Intronic
1095425423 12:42069777-42069799 ATTACGGGGGCTACAATTCAAGG + Intergenic
1095491723 12:42742084-42742106 ATTATAAGTACTACCGTTCATGG - Intergenic
1095492794 12:42752920-42752942 ATTTTGGGGATTACAATGCAAGG - Intergenic
1095557237 12:43522357-43522379 ATTATGGGGATTACAGTCCAAGG + Intronic
1095765052 12:45885890-45885912 ATTATGGGAACTACAATTCAAGG + Intronic
1095781794 12:46068218-46068240 ATTACGGGGATTACAATTCAAGG - Intergenic
1095795117 12:46210572-46210594 ATTATGGGAGTTACAATTCAAGG - Intronic
1095836676 12:46647393-46647415 ATTATGGGGATTGCAATTCAAGG + Intergenic
1096960118 12:55569269-55569291 ATTATGGGAGCAACAATTCAAGG + Intergenic
1097319713 12:58211523-58211545 ATTGTGGGAACTACAATTCGAGG + Intergenic
1097444096 12:59647224-59647246 ATTATGGGAACTACAATTCAAGG - Intronic
1097476006 12:60057361-60057383 ATTATGGGAACTAAAATTCAAGG - Intergenic
1097605287 12:61746078-61746100 ATTATAGGGATTACAATTCAAGG - Intronic
1098193881 12:67978876-67978898 ATTATGGGGATTACAATTCAAGG - Intergenic
1098231921 12:68380093-68380115 AAAAGAGGGACTTCAATTCAGGG - Intergenic
1098713149 12:73793254-73793276 ATTATGGGAGCTACAATTCAAGG - Intergenic
1099838258 12:87935451-87935473 ATTATGGGGTTTACAATTCAAGG - Intergenic
1099914252 12:88872574-88872596 ATTATGGGGATTACAATTCAAGG - Intergenic
1100423094 12:94456751-94456773 ATTATGGGGATTATAATTCAAGG + Intronic
1100504587 12:95207055-95207077 ATTATGGGGACTACAATTCAAGG - Intronic
1100857694 12:98772694-98772716 ATTATGGGAGCTACAATTCAAGG + Intronic
1100937795 12:99690232-99690254 ATTATGGGGATTAAAATTCAAGG + Intronic
1100958475 12:99936144-99936166 ATTATGAGGATTACAATCCAAGG + Intronic
1101061131 12:100973427-100973449 ATTATAGGGATAAAAATCCATGG - Intronic
1101304932 12:103518965-103518987 GTTACGGGGATTACAATTCAAGG - Intergenic
1101339583 12:103831110-103831132 GTTATGGGGATTACAATTCAAGG - Intronic
1101538190 12:105639939-105639961 ATTATGAGAGCTACAATTCAAGG + Intergenic
1101728593 12:107408085-107408107 ATTGTAGAGAATACAATACACGG - Intronic
1101742693 12:107513317-107513339 ATTATGGGGATTACAATTCAAGG - Intronic
1101763368 12:107677315-107677337 ATCATGGGAGCTACAATTCAAGG + Intergenic
1102041113 12:109801301-109801323 ATTATGGGAACTACAATTCAAGG - Intronic
1103270783 12:119671647-119671669 ATTATGGGGATTACAATTCAAGG + Intronic
1104100970 12:125609181-125609203 ATTATGGGGATTACAATTCAAGG + Intronic
1104114543 12:125736614-125736636 ATTATGGGAGCTACAATTCAAGG + Intergenic
1104175729 12:126330681-126330703 ATTATGGGGATTAGAATTCAAGG + Intergenic
1104337725 12:127915781-127915803 ATTTTAGGGACTTCAGTTAACGG + Intergenic
1104411061 12:128558285-128558307 ATTATGGGAGCTACAATTCAAGG - Intronic
1104514615 12:129413164-129413186 ATTATGGGAGTTACAATTCAAGG - Intronic
1104525460 12:129516642-129516664 ATTATGGGAGCTACAATTCAAGG + Intronic
1105342375 13:19539266-19539288 ATTATGGGAGCTACAATTCAAGG - Intergenic
1105644441 13:22302522-22302544 ATTATGGGGACTACAGTTCAAGG + Intergenic
1105698264 13:22911753-22911775 ATTATGGGGATTGCAATTCAAGG + Intergenic
1105718609 13:23091895-23091917 ATTATGGAGATTACAATTCAAGG - Intergenic
1105849919 13:24323993-24324015 ATTATGGGGATTGCAATTCAAGG + Intergenic
1106022029 13:25924723-25924745 ATTATGGGAACTACAATTCAAGG - Intronic
1106363373 13:29052803-29052825 ATTATGGGAACTACAATTCAAGG - Intronic
1106666122 13:31852489-31852511 AATATAGAGAATAAAATTCATGG + Intergenic
1106689988 13:32104690-32104712 ATTATGGGAGCTACAATTCGAGG - Intronic
1106888467 13:34216293-34216315 ATTATGGGAGCTACAACTCAAGG + Intergenic
1106927779 13:34631375-34631397 ATTATAGGGATTACAATTCAAGG + Intergenic
1107077350 13:36337371-36337393 ATTATGGGTATTACAGTTCAAGG - Intronic
1107585934 13:41848423-41848445 ATTATGGGGATTATAATTCGAGG - Intronic
1108199621 13:48030191-48030213 ATTATGGGAGCTACAATTCAAGG - Intergenic
1108219400 13:48217540-48217562 ATTATGGGAACCACAATTCAAGG - Intergenic
1108270442 13:48754788-48754810 ATTGTGGGAGCTACAATTCAAGG - Intergenic
1108771221 13:53702367-53702389 ATTATGGGGATTACAATTTAAGG + Intergenic
1108906612 13:55483192-55483214 ATTATGGTAACTAGAATTCAAGG - Intergenic
1108951931 13:56105164-56105186 ATTATGGGGGTTACAATTCAAGG + Intergenic
1109158923 13:58948232-58948254 ATTATGGGGATTACAATTCAAGG - Intergenic
1109318083 13:60775877-60775899 ATTATGAGGACTACAATCCAAGG + Intergenic
1109372573 13:61442572-61442594 CTTATGGGCACTACAATTCCAGG - Intergenic
1109579486 13:64308135-64308157 ATTATGGGGATTACAACTTAAGG + Intergenic
1109718208 13:66244920-66244942 ACTATGGGGAATACAATTCAAGG - Intergenic
1109718463 13:66246885-66246907 ACTATGAGGATTACAATTCAAGG - Intergenic
1110208511 13:72946374-72946396 ATTTTAGGAACTACAATTCAGGG + Intronic
1110361375 13:74629496-74629518 ATTATGGGAGCTAAAATTCAAGG - Intergenic
1110619303 13:77577528-77577550 CTCATGGGGACTACAATTCGAGG + Intronic
1110712932 13:78669885-78669907 TTTATAGTGAGAACAATTCAAGG + Intergenic
1111199825 13:84920027-84920049 ATTATGGGGATTACAATTCAAGG - Intergenic
1111244926 13:85524802-85524824 ATTATGGGAGCTGCAATTCAAGG + Intergenic
1111358641 13:87145148-87145170 GTTATGGGAATTACAATTCAAGG - Intergenic
1111394458 13:87646886-87646908 ATTATGGGAGCTACAATTCAAGG + Intergenic
1111410601 13:87871951-87871973 ATTATGGGAGTTACAATTCAAGG + Intergenic
1111505362 13:89183001-89183023 ATTATGGGATCTAAAATTCAAGG + Intergenic
1111510466 13:89255321-89255343 TTTATGGGAGCTACAATTCAAGG - Intergenic
1111518645 13:89368255-89368277 ATTGTAGGAGCTACAATTCAAGG + Intergenic
1111964920 13:94851253-94851275 ATTATGGGAGCTACAATTCAAGG - Intergenic
1112142976 13:96666302-96666324 ATTATAGGGACTACAATTCAAGG + Intronic
1112694731 13:101935417-101935439 ATTATGGGAACTGCAATTCAAGG - Intronic
1112941487 13:104867098-104867120 AGTATCAGAACTACAATTCAAGG + Intergenic
1113086528 13:106574623-106574645 ATTATGGGGATTACAATTCAAGG - Intergenic
1113140546 13:107144180-107144202 ATTATAGGGACACCAATCCGCGG - Intergenic
1113509748 13:110843747-110843769 ATTATGGGAACTACAATTCAAGG - Intergenic
1113526183 13:110979495-110979517 ATTATGGGAGCTAAAATTCAAGG + Intergenic
1113920283 13:113904131-113904153 ATTATGGAACCTACAATTCAAGG - Intergenic
1114131145 14:19794398-19794420 ATGATAGGGAATAAAATGCAAGG + Intronic
1114951173 14:27755874-27755896 ATTATGGAGATTACAATTCAAGG + Intergenic
1115254587 14:31385683-31385705 CTTATAAGGTATACAATTCAGGG - Intronic
1115430896 14:33317491-33317513 ATTATGGGAAGTACAGTTCAAGG - Intronic
1116242903 14:42369487-42369509 TTTATAAGGATTACAATTCTTGG - Intergenic
1116272046 14:42785110-42785132 ATTATGGGGATTACAATTTAAGG - Intergenic
1116399773 14:44492200-44492222 ATTTTAGGGTGTAAAATTCAGGG - Intergenic
1116589761 14:46757159-46757181 ATTATGGGAGCTACAATTTAAGG - Intergenic
1116783970 14:49267728-49267750 GTTATGGCAACTACAATTCAAGG - Intergenic
1117182695 14:53208403-53208425 ATTACGGGAAGTACAATTCAAGG - Intergenic
1117641825 14:57808092-57808114 ATAATGGGAACTACAATTCAAGG + Intronic
1118067253 14:62205804-62205826 ATTATGGGAACTACAATTTAAGG - Intergenic
1118291988 14:64535461-64535483 ATTATGGGAGCTACAATTCAAGG - Intergenic
1118505699 14:66409052-66409074 ATTATGGGGATTACAATTTGAGG - Intergenic
1118679583 14:68226417-68226439 ATTATGGGAGCTACAATTCAAGG - Intronic
1119040237 14:71268246-71268268 ATTATGGGAACCACAATTCAAGG - Intergenic
1119450292 14:74703424-74703446 ATTATGGGAGCTAAAATTCAAGG + Intronic
1119839356 14:77779928-77779950 ATTATGGGGATTACAATTCAAGG + Intergenic
1119943364 14:78665514-78665536 ATTATGGGAACTACAATTCAAGG + Intronic
1120082908 14:80236098-80236120 ATTATGGGAGCTACAATTTAAGG + Intronic
1120114351 14:80595990-80596012 ATTATGGAAGCTACAATTCAAGG + Intronic
1120234739 14:81876980-81877002 ATTATGGGGGTTACAATTCGAGG - Intergenic
1120283400 14:82466778-82466800 ATTATGGGAACTACAAGTCACGG + Intergenic
1120370731 14:83631188-83631210 ATTATGGGAGCTACAACTCAAGG + Intergenic
1120373622 14:83671157-83671179 ATTATAGGGATTACAATATGAGG + Intergenic
1120384315 14:83824928-83824950 ATTATGGAGGCTACAATTCAAGG + Intergenic
1120417849 14:84242823-84242845 ATTATGGGAACTACAATTCAAGG + Intergenic
1120418083 14:84244687-84244709 ATTATGGGGATTACAATTCAAGG + Intergenic
1120422199 14:84302569-84302591 ATTATGAGAGCTACAATTCAAGG + Intergenic
1120659344 14:87233913-87233935 ATTATGGGGATTACAATTCAAGG - Intergenic
1120808793 14:88781578-88781600 ATTATGAGAACTACAAATCAAGG - Intronic
1120837691 14:89056224-89056246 ATTGTGGGAGCTACAATTCAAGG + Intergenic
1120920947 14:89755064-89755086 ATTATGGGAACTACAAGTCAAGG + Intergenic
1121152430 14:91647772-91647794 ATTATGGGAGCTACAATTCAAGG + Intronic
1121267612 14:92614541-92614563 ATTATGGGAGCTATAATTCAAGG - Intronic
1121602495 14:95216333-95216355 ATTATGGGAGCTACAATTCAAGG + Intronic
1121995317 14:98597914-98597936 ATTATGGAAGCTACAATTCAAGG - Intergenic
1122089531 14:99329043-99329065 ATTATGGGAACTACAATTCAAGG - Intergenic
1122801880 14:104235096-104235118 ATTATGGGAAATATAATTCAAGG - Intergenic
1123016033 14:105376182-105376204 CTTATGGGGATTACAATTCAAGG + Intronic
1125065920 15:35486300-35486322 ATTATGGAGATTACAAATCAAGG + Intronic
1125091275 15:35795719-35795741 ATTATGGAAATTACAATTCAAGG - Intergenic
1125356581 15:38822842-38822864 ATTATGGGAACTACAATTCAAGG - Intergenic
1126232056 15:46338777-46338799 ATTATGGGGATTATAATTCAAGG - Intergenic
1126533141 15:49732507-49732529 TTAATGGGGATTACAATTCAAGG + Intergenic
1126841785 15:52724492-52724514 ATTATGGGAGCTACAATTCAAGG - Intergenic
1126856884 15:52847506-52847528 ATTGTGGGGATTAAAATTCAAGG + Intergenic
1126918197 15:53489625-53489647 ATTATGGGAGCTACAATTCAAGG - Intergenic
1127245127 15:57164592-57164614 ATTATGGGATCTACAATTCAGGG + Intronic
1128807921 15:70547109-70547131 ATTATGGGAACTACAATTCAAGG - Intergenic
1128929762 15:71693639-71693661 ATTATGGGAGCTACAATTCAAGG - Intronic
1129093918 15:73182785-73182807 ATTATGGGAGCTACAATTCAAGG + Intronic
1129584672 15:76850064-76850086 ATTATGGGGATTACAATTCAAGG + Intronic
1129585698 15:76862082-76862104 ATTATGGGGATTATAATTCAAGG + Intronic
1129700666 15:77766505-77766527 ATTATGGGGATTACAATTCGAGG - Intronic
1130740118 15:86590255-86590277 ATTATGGGAACTATAATTCAAGG - Intronic
1131739827 15:95376277-95376299 ATTATGGGGATTACAATTCGAGG + Intergenic
1131984013 15:98023203-98023225 ATTATGGGAGCTACAATTCAAGG - Intergenic
1132159783 15:99529548-99529570 ATTATAACGATTACAATTCAAGG - Intergenic
1133551353 16:6857536-6857558 TTTTTATTGACTACAATTCAAGG + Intronic
1133665902 16:7967338-7967360 CTTACAGGGATTACAATTCTAGG + Intergenic
1133691539 16:8220501-8220523 ATTATGGGGATAACAATTCAAGG - Intergenic
1133921328 16:10155905-10155927 ATTATGGAAGCTACAATTCAAGG + Intronic
1134212742 16:12291474-12291496 ATTGTGGGAGCTACAATTCAAGG + Intronic
1134424856 16:14130993-14131015 ATTATGGGAACTACAATTCAAGG + Intronic
1134593668 16:15477381-15477403 ATTATGGGAATTACAATTCAAGG + Intronic
1134804121 16:17110309-17110331 ATTCTGGGAGCTACAATTCAAGG - Intronic
1135462569 16:22658003-22658025 ATTATGGAAATTACAATTCAAGG - Intergenic
1135759081 16:25121810-25121832 ATTATGGGGATTACAATTCAAGG + Intronic
1135812862 16:25605530-25605552 ATTATGGGGATTAGAATTCAAGG - Intergenic
1135835876 16:25824637-25824659 ATTATGGGAGCTACAGTTCAAGG + Intronic
1135933482 16:26759427-26759449 ATTATAGGAGCTACAATTCAAGG + Intergenic
1136078677 16:27837336-27837358 ATTATGGGGATTACAATTCAAGG + Intronic
1136287045 16:29250521-29250543 ATTATGGACACTATAATTCAAGG - Intergenic
1137686868 16:50392455-50392477 ATTATGGGAGCTACAATTCAAGG + Intergenic
1138398777 16:56729285-56729307 ATTATGGGGATTATAATTCAAGG + Intronic
1138821155 16:60261673-60261695 ATTATGGAGATTACAATTCAAGG + Intergenic
1138828852 16:60354443-60354465 TGTTTAGGGAGTACAATTCATGG + Intergenic
1138876389 16:60955775-60955797 ATTATGAGAACTACAATTCAAGG + Intergenic
1138992890 16:62412901-62412923 ACTATGGGGATTACAACTCAAGG + Intergenic
1139032331 16:62900272-62900294 ATTATAGGAACTACAATTCAAGG - Intergenic
1139033400 16:62912599-62912621 ATTATGGGAACTACAATTCAAGG + Intergenic
1139110236 16:63881496-63881518 ATTATGGGAGCTACAATTCAAGG + Intergenic
1139135971 16:64205203-64205225 AATATGGGAGCTACAATTCAAGG + Intergenic
1139165923 16:64565477-64565499 ATTATGGGAACTACAATTCAAGG - Intergenic
1139238726 16:65368515-65368537 ATTATGGGAGCTACAATTCAAGG - Intergenic
1139245049 16:65433432-65433454 ATTATGGGAGCTACAATTCAAGG - Intergenic
1139370681 16:66467562-66467584 ATTATAGGGATTACAATTAAAGG + Intronic
1140146777 16:72319189-72319211 ATCATGGGGATTACAATTCAAGG + Intergenic
1140265151 16:73414233-73414255 ATGAAAGGGACCATAATTCAGGG + Intergenic
1140654173 16:77122702-77122724 ATTATGGGAGCTACAATTCAAGG + Intergenic
1140683787 16:77412827-77412849 ATTATGGGAGCTACAGTTCAAGG + Intronic
1141201649 16:81903010-81903032 ATTATAGGAGCTGCAATTCAAGG + Intronic
1141206216 16:81934982-81935004 ATTATGGGAGCTACAATTCAAGG + Intronic
1141214341 16:82009852-82009874 ATTATGGGATCTACAATTCAAGG - Intronic
1141239971 16:82256655-82256677 ATTATGGGAATTGCAATTCAAGG + Intergenic
1141263884 16:82478060-82478082 ATTATGGGAATTACAATTCTAGG + Intergenic
1141339487 16:83189790-83189812 ATTATGGGAACTACAATTCAAGG - Intronic
1141374503 16:83518015-83518037 ATTATGACAACTACAATTCAAGG - Intronic
1141737561 16:85863894-85863916 ATTACGAGGATTACAATTCAAGG - Intergenic
1141801414 16:86311842-86311864 ATGATCGGGGCTACAGTTCACGG + Intergenic
1141909612 16:87049694-87049716 ATTATGGGAGCTACGATTCAAGG + Intergenic
1142092649 16:88223153-88223175 ATTATGGACACTATAATTCAAGG - Intergenic
1142642202 17:1290774-1290796 ATTATGGGGCCTACAATTCAAGG - Intronic
1143520792 17:7443141-7443163 AGTCCAGGGACTACATTTCAGGG - Exonic
1147016906 17:37499252-37499274 ATTATGGGAATTACAATTCAAGG + Intronic
1147884975 17:43678249-43678271 ATAATAGCGCCTACACTTCAGGG + Intergenic
1149041586 17:52196173-52196195 ATTATGGGGATTATAATTCGAGG - Intergenic
1149113275 17:53061288-53061310 ATTATGGAAACTACAATTTAAGG - Intergenic
1149386212 17:56145640-56145662 ATTACTGGAATTACAATTCAAGG + Intronic
1149501893 17:57159146-57159168 ATTATAGGGATTACAATTCAAGG - Intergenic
1149700615 17:58652291-58652313 ATTATGGGAACTACAATTCAAGG - Intronic
1150203189 17:63378039-63378061 ATTATGGGGGTTACAATTCAAGG + Intronic
1150527069 17:65935080-65935102 ATTATGGGGATTACAATTTGAGG + Intronic
1150545101 17:66148309-66148331 ATTATGGGAGCTATAATTCAAGG + Intronic
1150601936 17:66658568-66658590 ATTATGAGAACTACAATTCAAGG + Intronic
1151045421 17:70914533-70914555 ATTATGGGAGCTACGATTCAAGG + Intergenic
1151902455 17:77025587-77025609 ATAATGGGGATTACAATTCGAGG + Intergenic
1152984342 18:308158-308180 ATCATGGGGGCTACAACTCAAGG - Intergenic
1153443084 18:5142404-5142426 ATTGTGGGGATTACAATTCAAGG + Intergenic
1155262690 18:24060051-24060073 ATTATGGGAGCTACAATTCAAGG + Intronic
1155287461 18:24305700-24305722 ATTATTGGAGCTATAATTCAAGG - Intronic
1155390864 18:25335229-25335251 ATTCTAGGAACTACCTTTCATGG - Intronic
1155413403 18:25570834-25570856 ATTATGGGAACTAAAATTCAAGG + Intergenic
1155466019 18:26136106-26136128 ATTATATGGGCCACAATTAAAGG + Intronic
1155639813 18:27999797-27999819 ATTATGAGGATTACAATTCAAGG - Intronic
1155711396 18:28884806-28884828 ATTATGGGGATTACAATTCAAGG + Intergenic
1155805676 18:30168397-30168419 ATTATGGGAACTACAGTTCAAGG - Intergenic
1156051761 18:32944711-32944733 ATTATGGGAGCTACAATTCAAGG - Intronic
1156187314 18:34678166-34678188 ATTATGAGAACTACAAGTCAAGG + Intronic
1156303199 18:35853477-35853499 ATTATGGGAACTACAATTCAAGG + Intergenic
1156644968 18:39149832-39149854 ATTATGGGAACTACAATTCAAGG + Intergenic
1156769016 18:40697355-40697377 ACTATGGGAACAACAATTCAAGG - Intergenic
1157986213 18:52440476-52440498 ATTATAGGGATGACATTTAATGG + Intronic
1157987026 18:52449693-52449715 ATTATGGAGGCTACAATTAAAGG - Intronic
1158174299 18:54636844-54636866 ATCATGGGAGCTACAATTCAAGG + Intergenic
1158185703 18:54768910-54768932 ATTATGGGGATTACAATTCGAGG + Intronic
1158220312 18:55143832-55143854 ATTACGGGAACTAAAATTCAAGG - Intergenic
1158262205 18:55619933-55619955 ATTATGGGGATTACAATTCAAGG - Intronic
1158595734 18:58814354-58814376 CTTGTGGGGATTACAATTCAAGG - Intergenic
1159012199 18:63068423-63068445 ATTATGGGAATTACAATCCAAGG - Intergenic
1159031355 18:63235982-63236004 ATTATGGGAGCTACAATTCAAGG - Intronic
1159152166 18:64534701-64534723 ATTATGAGAGCTACAATTCAAGG - Intergenic
1159455626 18:68657340-68657362 ATTATGGGGATAACAATTCGAGG + Intergenic
1159603615 18:70452353-70452375 ATTACGGGGATTACAATTCAAGG + Intergenic
1159763298 18:72455492-72455514 ATTATGGGAACTACAATTCAAGG - Intergenic
1159768998 18:72526791-72526813 TTTATGGGAGCTACAATTCAAGG - Intergenic
1159769195 18:72528176-72528198 ATAATGGGAACTACAATTCAAGG + Intergenic
1159805733 18:72956760-72956782 ATTATCAGAGCTACAATTCAAGG + Intergenic
1159811977 18:73026868-73026890 ATTATGGGGATTACACTTCAAGG - Intergenic
1160009659 18:75096929-75096951 ATTAGAGGCTGTACAATTCAGGG - Intergenic
1160547588 18:79670687-79670709 ATTATGGGAGCTACAATTCAAGG - Intergenic
1162002072 19:7751481-7751503 ATTATGGGAGCTACGATTCAAGG + Intergenic
1163770200 19:19186411-19186433 ATTATGGGAACTACAATTCAAGG - Intronic
1164154837 19:22587051-22587073 ATTATGGGAATTACAATTCGAGG - Intergenic
1165179476 19:33955393-33955415 ATTATGGGAATTACAATTCAAGG + Intergenic
1166324996 19:42043974-42043996 ATTATGGGGATTACAATTCAAGG - Intronic
1167804728 19:51773068-51773090 ATTATGGGGATTACAATTCAAGG - Intronic
1168286117 19:55334695-55334717 GTTATGGGGATTAAAATTCAAGG - Intergenic
925025496 2:603774-603796 ATTATGGGAACTACAATCCAAGG + Intergenic
925178242 2:1799760-1799782 ATTATAGGGATTATAATTCGAGG - Intronic
925245703 2:2380520-2380542 ATTATGGGGATTACAATTCAAGG - Intergenic
925522129 2:4758588-4758610 ATTATGGGAGCTACAATTCAAGG + Intergenic
925601612 2:5613731-5613753 ATTATGGGAATTGCAATTCAAGG - Intergenic
925629380 2:5873769-5873791 ATTATGGGAGCTACAATTCAAGG + Intergenic
926304183 2:11626096-11626118 ATTATGGGAGCTACAATTCAAGG + Intronic
926351658 2:12000946-12000968 ATTATTGGGAATACACTTGAGGG + Intergenic
926474296 2:13303318-13303340 ATTATAGGGATTACAATTCAAGG - Intergenic
926588846 2:14718490-14718512 ATTATGGGGATTACAATTCAAGG - Intergenic
926896950 2:17702616-17702638 ATTATGGGAACTTAAATTCAAGG - Intronic
927831795 2:26357836-26357858 ATTATGGGAGCTACAATTCAAGG - Intronic
928609781 2:32981655-32981677 ATTATGAGAGCTACAATTCAAGG - Intronic
928620255 2:33081712-33081734 ACTATGGGGACTGCAATTCAAGG - Intronic
928643762 2:33328692-33328714 ATTATGGGGATTACAATTCAAGG + Intronic
928725670 2:34171215-34171237 ATTATGGGAACTATAATTCAAGG + Intergenic
929237727 2:39624341-39624363 ATTTTATGCACTACAATTCCAGG + Intergenic
929265745 2:39917406-39917428 ATTATGGAGATTACAATTCCAGG - Intergenic
929444048 2:41989006-41989028 ATTATGGGAACTACAGTTCAAGG + Intergenic
929565493 2:42981386-42981408 AGAATAAGGACTACATTTCATGG + Intergenic
929715161 2:44302706-44302728 GTTATAGGGACTCCAATACAAGG + Intronic
929733429 2:44520722-44520744 ATTATGGGGATTACAATTCAAGG - Intronic
929850980 2:45590459-45590481 ATTATGGGGATTACAAATCAAGG - Intronic
930480709 2:51944615-51944637 ATTATGGGGATTACAATTCAAGG - Intergenic
930496479 2:52151107-52151129 ATTATGGGAACTACAGTTCTGGG + Intergenic
930507586 2:52304171-52304193 ATTATGGGAACTACAATTCAAGG - Intergenic
930582638 2:53230503-53230525 ATTCTGGGGATTACAATTCAAGG - Intergenic
930594076 2:53364396-53364418 ATTATTGTAACTACTATTCAAGG + Intergenic
930939946 2:57000498-57000520 ATTATGGGAACTACAATTCAAGG + Intergenic
930997408 2:57737143-57737165 ACTATGTGGACTACAGTTCAAGG - Intergenic
931130844 2:59333822-59333844 ATTATGGGAACTACAATTCAAGG - Intergenic
933295636 2:80487645-80487667 ATTATGGGAACTACAGTTCAAGG + Intronic
934486187 2:94713827-94713849 GTTATGGAGATTACAATTCAAGG - Intergenic
934515318 2:94982533-94982555 ATTAAAGGGACTAGAAAACAAGG + Intergenic
935949084 2:108312620-108312642 ATTATGGGAGCTACAATTCAAGG - Intergenic
936703012 2:115036308-115036330 ATTATGGGGATTACAATTCAAGG + Intronic
936805259 2:116324094-116324116 ATTATGGAGATTACAATTCAAGG - Intergenic
937030536 2:118735585-118735607 ATTATGGAGATTACCATTCAAGG + Intergenic
937174190 2:119910565-119910587 ATTATGGAGACTACAAGTCAAGG - Intronic
937209116 2:120256411-120256433 ATTATGGGGATTACAATTCAAGG - Intronic
937543321 2:122986208-122986230 TTTATGGGGATTACAATTCGAGG - Intergenic
937806382 2:126150471-126150493 ATTACAGAGACCACAATTAAAGG + Intergenic
937806635 2:126152369-126152391 ATTACAGAGATTACAATTCAAGG + Intergenic
938061023 2:128254312-128254334 ATTATGGGAACTACAATTCAAGG + Intronic
939174667 2:138735561-138735583 ATTATGGGAGATACAATTCAAGG + Intronic
939363984 2:141209180-141209202 ATTATGGGAACTACAATTCAAGG - Intronic
939593402 2:144094696-144094718 ATTATGGAGATTACAGTTCAAGG + Intronic
939599216 2:144167462-144167484 ATTATGAAGATTACAATTCAAGG - Intronic
939893367 2:147763518-147763540 ATTAGGGGGGCTACAATTCAAGG + Intergenic
940138042 2:150461327-150461349 AATATGGGCACTACAATTCAAGG + Intergenic
940141084 2:150491196-150491218 ATTTGAGTGACTACAAGTCAGGG + Intronic
940199090 2:151130253-151130275 ATTACAGAAGCTACAATTCAAGG + Intergenic
940561725 2:155305477-155305499 ATTATGTGACCTACAATTCAAGG - Intergenic
940592263 2:155744646-155744668 ATTATGGGAGCTACAATTCAAGG - Intergenic
941226047 2:162849309-162849331 ATTATGGGGATTACAATTCCAGG + Intergenic
941349358 2:164413550-164413572 ATTGTGGGGATTATAATTCAAGG + Intergenic
941349613 2:164415429-164415451 ATTATGGGGATTACAATTTGAGG + Intergenic
941417933 2:165245193-165245215 ATTATGGGAACTACAATTCAAGG - Intronic
941508264 2:166375331-166375353 GTTAGATGGACTTCAATTCAAGG - Intronic
941869279 2:170366844-170366866 AGTCTAGGGACCACAATTAAAGG - Intronic
942380358 2:175384915-175384937 ATTATGAGGATTACAATTCATGG - Intergenic
942380637 2:175386810-175386832 ATAATGAGGATTACAATTCAAGG - Intergenic
942381999 2:175401251-175401273 ATTATGAGGATTATAATTCAAGG + Intergenic
942559742 2:177207861-177207883 ATTACAGGGATTACAATTCAAGG + Intergenic
943047176 2:182872945-182872967 GTTATGGGGATTACAATTCATGG - Intergenic
943082172 2:183268255-183268277 ATTATAGGGATTACAATTCAAGG + Intergenic
943159286 2:184226361-184226383 CTTATGGGGATTATAATTCAAGG - Intergenic
943216188 2:185039373-185039395 ATTATGGGGATTACAATTCAAGG - Intergenic
943231819 2:185264076-185264098 ATTATGGGGATTACAATTCAGGG + Intergenic
943232063 2:185266036-185266058 ATTATGGGGATGACAAATCAAGG + Intergenic
943478333 2:188386376-188386398 ATTGTGGGAATTACAATTCAAGG + Intronic
943926101 2:193782608-193782630 ATTACGGGGATTACAATTCAAGG - Intergenic
943939369 2:193971246-193971268 ATTTTGGGAGCTACAATTCAAGG + Intergenic
943999646 2:194816592-194816614 ATTATGAGGATTACAATTCAAGG + Intergenic
944048815 2:195442992-195443014 ATTATGGAGATTACAATTCAAGG + Intergenic
944917663 2:204377715-204377737 ATTATGAGAGCTACAATTCAAGG - Intergenic
945865463 2:215169534-215169556 ATCCTATGGACTACAATTCTTGG - Intergenic
945928363 2:215829251-215829273 ATTACAGAAACTAAAATTCAAGG + Intergenic
946022000 2:216646830-216646852 ATTGTGGGAGCTACAATTCATGG + Intronic
946142138 2:217700464-217700486 ATTATGGGAATTACAATTCAAGG - Intronic
946579146 2:221107523-221107545 ATTATGGGAACTAGAATTCAAGG + Intergenic
946642454 2:221799317-221799339 ATTATGGGGATTACAATTCTAGG - Intergenic
946845013 2:223851265-223851287 ATTATGGGAGCCACAATTCAAGG - Intergenic
946875490 2:224125744-224125766 ATTATGGGAGCTACAATTCAAGG + Intergenic
946900901 2:224370279-224370301 ATTATAGGACCCAAAATTCAAGG - Intergenic
946999734 2:225440109-225440131 ATTATGGGAATCACAATTCAAGG + Intronic
947070354 2:226281440-226281462 ATTATAGGAGCTACAATTCCAGG - Intergenic
947094101 2:226546235-226546257 ATTATAGGAGCTATGATTCAAGG + Intergenic
947208141 2:227681243-227681265 ATTATGGGGATTACAATTCAAGG + Intergenic
947291711 2:228583247-228583269 ATTATGGGAACTACAATTCAAGG + Intergenic
947729899 2:232421847-232421869 ATTATGGGGATTACAATTCGAGG - Intergenic
947908633 2:233785964-233785986 ATTATGGGAGCTATAATTCAAGG - Intronic
948056334 2:235011560-235011582 ATCATAGAGACTACGATCCAGGG - Intronic
948064792 2:235069485-235069507 ATTATGGGAGCTATAATTCAAGG + Intergenic
948066560 2:235085434-235085456 ATTCTCGGGATTATAATTCAAGG - Intergenic
1169855628 20:10099548-10099570 ATTATGGAAGCTACAATTCAAGG - Intergenic
1170092925 20:12612050-12612072 ATTATAGGCTTTAAAATTCAAGG - Intergenic
1170739872 20:19046591-19046613 ATTATGGCGATTACAATTCAAGG + Intergenic
1170750504 20:19140694-19140716 ATTATGGGGATTACAATTCAAGG + Intergenic
1171072293 20:22084509-22084531 ATGAAAGGAAGTACAATTCAGGG + Intergenic
1171167249 20:22982709-22982731 ATTATTGGAACTACAATTTAAGG + Intergenic
1171749814 20:29038063-29038085 ATTATGGAAACTACATTTCAAGG + Intergenic
1172462109 20:35126972-35126994 AATATGGGAGCTACAATTCAAGG - Intronic
1174193529 20:48757067-48757089 ATTATGGGAGCTACAATTCAAGG + Intronic
1174207780 20:48853562-48853584 ATTATGGAGATTACAATTCAAGG + Intergenic
1174581087 20:51572287-51572309 ATTATGGAAACTACAATTCAAGG + Intergenic
1174857386 20:54059155-54059177 ATTATGAGGATTACAATTCAAGG + Intronic
1174891943 20:54404793-54404815 ATTATGGGGTTTACAATTCAAGG - Intergenic
1175048711 20:56132700-56132722 ATTATGGGAGCTTCAATTCAAGG - Intergenic
1175275629 20:57768672-57768694 ATTATGGGGATTACAATGCAAGG - Intergenic
1175337195 20:58204415-58204437 ATTATGGGAGCTACAATTCAAGG - Intergenic
1175603259 20:60292136-60292158 ATTATGGTGATTACAATTCAAGG - Intergenic
1175619859 20:60434378-60434400 ATTACGGGGATTATAATTCAAGG - Intergenic
1175762098 20:61568207-61568229 ATTATGGGAACTAAAATTCAAGG - Intronic
1176315423 21:5237938-5237960 ATTATGGAAACTACATTTCAAGG - Intergenic
1176883602 21:14228527-14228549 ATAATGGGGATTACAACTCAAGG - Intergenic
1176883881 21:14230548-14230570 ATAATGGGGATTACAATTCAAGG - Intergenic
1176992805 21:15519316-15519338 ATTATGGAAACTACAATTCGAGG + Intergenic
1177055615 21:16297794-16297816 ATCATGGAAACTACAATTCAAGG - Intergenic
1177171180 21:17657649-17657671 ATTATAGGGACCAAAAATGAGGG - Intergenic
1177223162 21:18219438-18219460 ATTATGGGAACTACAATTAAAGG + Intronic
1177261141 21:18732108-18732130 ATTATGGGAGCTACAATTCAAGG - Intergenic
1177307382 21:19336105-19336127 ATTATGGGAGCTACTATTCAAGG + Intergenic
1177334339 21:19703986-19704008 ATTACAGGGATTACAATTCAAGG + Intergenic
1177407608 21:20690635-20690657 ATTATGGGAACTACAATTCAAGG + Intergenic
1177479507 21:21668834-21668856 ATTATGGGACCTACAATTCAAGG + Intergenic
1177529143 21:22337685-22337707 ATTATGGGGATTACAATTCAAGG - Intergenic
1177531857 21:22370968-22370990 ATTATGAGGAATACAATTCAAGG + Intergenic
1177755463 21:25342077-25342099 ATTGTGGGAGCTACAATTCAAGG - Intergenic
1177855203 21:26392882-26392904 ATTATGGGATTTACAATTCAAGG + Intergenic
1178041442 21:28644373-28644395 ATTATGGGGATCACAATTCCAGG + Intergenic
1178111007 21:29370248-29370270 ATTATGGGGATTACAGTTCCTGG + Intronic
1178117645 21:29434127-29434149 ATTATGGGAGCTACAATTCAAGG - Intronic
1178122685 21:29485185-29485207 ATTATGGGGGCTACAATTCCAGG + Intronic
1178216344 21:30603509-30603531 ATTATGAGAGCTACAATTCAAGG - Intergenic
1178266597 21:31148243-31148265 ATTATGGGAGCTACAATTCAAGG - Intronic
1178392378 21:32209630-32209652 ATTATGGGGACTACAATTCAAGG - Intergenic
1178667410 21:34560925-34560947 ATTATCGAGATTACAATTCATGG - Intronic
1179011074 21:37556745-37556767 ATTATAGGGACTACAATTCAAGG + Intergenic
1179051272 21:37890372-37890394 ATTACGGGGACTACAATTCGAGG + Intronic
1180393211 22:12303893-12303915 ATTATGGAAACTACATTTCAAGG - Intergenic
1180406538 22:12560875-12560897 ATTATGGAAACTACATTTCAAGG + Intergenic
1180818720 22:18810036-18810058 GTTATAGGGTCTACAGTTGATGG - Intergenic
1181204943 22:21244491-21244513 GTTATAGGGTCTACAGTTGATGG - Intergenic
1182022935 22:27096341-27096363 ATTATGGGGATTACAATTGGAGG + Intergenic
1182891836 22:33825692-33825714 ATTACACGAACTACAATTCAAGG + Intronic
1182991991 22:34777136-34777158 TTTATATGGATTCCAATTCAAGG - Intergenic
1183847512 22:40554340-40554362 ATTATGGGAACTACAGTTCAAGG - Intronic
1184830245 22:46981462-46981484 ATTATGGAGATTACAATTCAAGG - Intronic
1184894741 22:47400307-47400329 ATTATGGGGATTACAGTTCGAGG + Intergenic
1184962623 22:47942557-47942579 ATTATGGGAGCTACAATTCAAGG + Intergenic
1203221982 22_KI270731v1_random:50924-50946 GTTATAGGGTCTACAGTTGATGG + Intergenic
1203268849 22_KI270734v1_random:35889-35911 GTTATAGGGTCTACAGTTGATGG - Intergenic
949400799 3:3663680-3663702 ATTATGGGAGCTACAATTCAAGG - Intergenic
949956757 3:9275507-9275529 ATTATGGGAGCTACAATTCAAGG - Intronic
950589437 3:13925624-13925646 ATTATGGGAACTACAATTCAAGG - Intergenic
950917604 3:16662015-16662037 ATTATGGGAACTACAACTCAAGG - Intronic
950990860 3:17435635-17435657 ATTATGGGAACTACAATTCAAGG + Intronic
951010229 3:17669025-17669047 ATTATGGGAACTACAATTCAAGG - Intronic
951162388 3:19440640-19440662 ATTATGGGAGCTACAATTCAAGG + Intronic
951257502 3:20467441-20467463 ATTATGGGAACTACAATTCAAGG - Intergenic
951470098 3:23046516-23046538 ATTATGGGGATTACAATTTGAGG - Intergenic
951482006 3:23170932-23170954 ATTATGGGAGCTACAATTCAAGG + Intergenic
951725216 3:25750292-25750314 ATTATAAGGATTACAATTCAAGG + Intronic
952579513 3:34815836-34815858 ATTATGGGGATAATAATTCATGG - Intergenic
952609693 3:35193471-35193493 ATCATGGGGATTACAATTCAAGG - Intergenic
952642962 3:35620045-35620067 AACATAGGCAATACAATTCAGGG + Intergenic
952671431 3:35974077-35974099 ATTATGGGGATTACAATTCAAGG + Intergenic
952891654 3:38046300-38046322 ATTACGGGAGCTACAATTCAAGG - Intronic
953144082 3:40257633-40257655 ATTATATGAACTTTAATTCAAGG - Intronic
953299169 3:41754085-41754107 ATTACAGGGATTATAATTCAAGG + Intronic
953678718 3:45023725-45023747 ATTATGAGGATTACAATTCAAGG + Intronic
954900916 3:54018823-54018845 ATTATGGGAGCCACAATTCAAGG + Intergenic
954951546 3:54479004-54479026 GTTACAGTAACTACAATTCAAGG - Intronic
955671227 3:61405165-61405187 ATTATGGGACTTACAATTCAAGG + Intergenic
955836783 3:63064398-63064420 ATTATAGAAACTAGAATGCAAGG + Intergenic
956284207 3:67591429-67591451 ATTCTGGGAAATACAATTCAAGG - Intronic
956512630 3:70011010-70011032 ATTGTAGGGATTACAATTCAAGG + Intergenic
956591784 3:70923210-70923232 ATTATGGGAGTTACAATTCAAGG - Intergenic
956739855 3:72267265-72267287 ATTATGGGAGCTACAATTCAAGG + Intergenic
956867840 3:73386918-73386940 CTTATGGGAGCTACAATTCAAGG - Intronic
957134867 3:76273791-76273813 ATTATGGGAACTACAATTCAAGG + Intronic
957210470 3:77251634-77251656 ATTATGGGAGCTACAATTCAAGG - Intronic
957477273 3:80740649-80740671 ATTATGGGAACTACAATTCAAGG + Intergenic
957696970 3:83650958-83650980 ATTATGGGAGCTACAATTCAAGG + Intergenic
957848808 3:85778383-85778405 ATTATGGGGATTACAATTCAAGG - Intronic
957875375 3:86139390-86139412 ATTATGGGGATTATAATTCAAGG - Intergenic
957897099 3:86436703-86436725 ATTTTGGGAGCTACAATTCAAGG - Intergenic
957899130 3:86465349-86465371 ATTATGGGGATTACAATTTGAGG + Intergenic
957949644 3:87107940-87107962 ATTATGGAAGCTACAATTCAGGG - Intergenic
957978319 3:87475089-87475111 ATTCTGGGGATTACAATTCAAGG - Intergenic
958056990 3:88426527-88426549 ATTATGGGAACTACAATTCAGGG - Intergenic
958057279 3:88428497-88428519 ATTATGGGAACTACAATTCAAGG - Intergenic
958514826 3:95100880-95100902 ATTATGGAAGCTACAATTCAAGG - Intergenic
958640384 3:96797734-96797756 ATCATGGGGATTCCAATTCAAGG + Intergenic
958648252 3:96901126-96901148 TTAATAGAGACTAAAATTCATGG + Intronic
958660665 3:97062562-97062584 ATTATAGGAGCTACAATTCAAGG - Intronic
959127439 3:102307485-102307507 ATCATATGGACTGCAATTCTTGG + Intronic
959237968 3:103748701-103748723 ATTATGGCGCTTACAATTCAAGG + Intergenic
959549188 3:107635515-107635537 TTTATAGGAAATACAATTGAAGG + Intronic
959879804 3:111430095-111430117 GTTATGGGAACTATAATTCAAGG + Intronic
959985981 3:112571829-112571851 CATATGGGGATTACAATTCAAGG + Intronic
960499401 3:118418742-118418764 ATTATGGGAACTACAATTCAAGG + Intergenic
960499555 3:118419683-118419705 ATTATGGGAACTAAAATTTAAGG + Intergenic
962062768 3:131948181-131948203 ACTATGGGGATTAAAATTCAAGG - Intronic
962255947 3:133870360-133870382 ATCATGGGGATTACAATTCGAGG + Intronic
962421465 3:135232994-135233016 ATCATGGGAACTACAATTCAAGG + Intronic
962552553 3:136510176-136510198 ATTATGGGGATTACAATTTGAGG - Intronic
962778806 3:138691431-138691453 ATTATAGGGATTATAATTTGAGG - Intronic
963351782 3:144160421-144160443 TTTATGGGTATTACAATTCAAGG + Intergenic
963667250 3:148203881-148203903 ATTAAAAGGACTATAATTGAAGG - Intergenic
963878159 3:150500144-150500166 ATTATGGGGATTAAAATTCAAGG + Intergenic
964258207 3:154804221-154804243 ATTGTGGGAATTACAATTCAAGG + Intergenic
964675857 3:159279120-159279142 ATTATGGGAGCTACAATTCAAGG - Intronic
964945342 3:162216654-162216676 CTTATGAGGATTACAATTCAAGG + Intergenic
965108564 3:164389367-164389389 ATAAGGGGGATTACAATTCAAGG + Intergenic
965250344 3:166335247-166335269 AATATAGGGCCTACAAATGAGGG - Intergenic
965441816 3:168723807-168723829 ATTATGGAGATTATAATTCAAGG - Intergenic
965950596 3:174303701-174303723 ATTATGGGAATTACAATTCAAGG - Intergenic
966336356 3:178872422-178872444 ATTATGGGGATTACAACTCGAGG - Intergenic
967430602 3:189381036-189381058 ATTATGGGAACTACAATTCAAGG - Intergenic
967554171 3:190835468-190835490 ATTATGGGAATTACAATTCAAGG - Intergenic
967628466 3:191713864-191713886 ATTATTGGGATCACAATTCAAGG + Intergenic
967776885 3:193394552-193394574 ATTACGGGGATTACACTTCAAGG + Intergenic
967998256 3:195183198-195183220 GTTATGAGGATTACAATTCAAGG - Intronic
968524482 4:1049059-1049081 ACTATGGAGAGTACAATTCAAGG + Intergenic
968947457 4:3672862-3672884 ATTATGGGAACTACAATTGAAGG - Intergenic
969195542 4:5560594-5560616 ATTATAAGGATTACAATTCAAGG + Intronic
969628496 4:8321118-8321140 ATTATGGGGATTACAATTCAAGG + Intergenic
969843480 4:9900937-9900959 ATTGTGGGAACTATAATTCAAGG + Intronic
969947562 4:10799965-10799987 ATTATGTGTATTACAATTCAAGG + Intergenic
969960621 4:10941031-10941053 ATTATAGGAACTACAATTCAAGG - Intergenic
970057782 4:11994639-11994661 ATTATGGGGATTACAAGTCAAGG - Intergenic
970174840 4:13329196-13329218 ATTATGGGAGCTAAAATTCAAGG + Intergenic
970273568 4:14372668-14372690 ATTATGGAGATTACAATTCAAGG - Intergenic
970351512 4:15206385-15206407 ATTATGGGGATTACAATTCCAGG - Intergenic
970499460 4:16662561-16662583 ATTATGAGAGCTACAATTCAAGG - Intronic
970552733 4:17199267-17199289 ATTATGGGAGCTACAATTCAAGG + Intergenic
970749833 4:19345168-19345190 ATTATGGGGATTACAATTCAAGG - Intergenic
970780751 4:19734652-19734674 TATATAGGGATTACAATTCAAGG + Intergenic
971036620 4:22700502-22700524 ATTATGGGATCTCCAATTCAAGG - Intergenic
971063278 4:22997381-22997403 GTTATGGGAGCTACAATTCAAGG - Intergenic
971078130 4:23174327-23174349 TTTATGGGGATTATAATTCAAGG - Intergenic
971499637 4:27304535-27304557 ATTATGGGAGCTATAATTCAAGG + Intergenic
971565085 4:28129172-28129194 ATTATGGAAACTACAAATCAAGG - Intergenic
971677580 4:29653458-29653480 ATTATGGGCATTACAATTCAAGG + Intergenic
971681383 4:29705909-29705931 ATTATGGGGATTAAAATTCAAGG + Intergenic
971683807 4:29738012-29738034 ATTATGGGAGCTACAATTCAGGG - Intergenic
971912231 4:32809546-32809568 ATTATAAGAATTACAATTAAAGG + Intergenic
971912481 4:32811457-32811479 ATTATGGGGATTGCAATTCAAGG + Intergenic
972213301 4:36865067-36865089 ATTATGGGAGCTACAATTCAAGG - Intergenic
972752995 4:42011367-42011389 ATTATGGGGATTATAATTCAAGG + Intronic
972900966 4:43682725-43682747 ATTATTGGAACTACAATTCAAGG + Intergenic
972913041 4:43842141-43842163 ATTATGGAAGCTACAATTCAAGG + Intergenic
973022738 4:45224059-45224081 ATTTTAGGAGTTACAATTCAAGG - Intergenic
973163294 4:47045941-47045963 TTTATGGGAACTAAAATTCAAGG - Intronic
973674859 4:53254194-53254216 ATTATGGGGATTACGATTCAAGG - Intronic
973695091 4:53483055-53483077 ATTATGGGAGCTACAATTCAAGG - Intronic
973710388 4:53624248-53624270 ATTATGGGAGCTGCAATTCAAGG - Intronic
973855521 4:55006940-55006962 ATTATGGGAACTACAATTCAAGG - Intergenic
974134616 4:57799391-57799413 ATTATGGAAACTACAATTCAAGG + Intergenic
974259430 4:59505890-59505912 ATTATAGGGATTGCAATTTGAGG + Intergenic
974320019 4:60334832-60334854 ATTATGGGGATTGCAATTCAAGG - Intergenic
974528748 4:63080111-63080133 ATTATAGGAGCTACAATTCAAGG - Intergenic
974570891 4:63647679-63647701 ATTTTGGGAACTACAACTCAAGG - Intergenic
974588394 4:63912144-63912166 ATAATGGGGATTACAATTCAAGG - Intergenic
974724291 4:65778425-65778447 ATTGTAGGAGTTACAATTCAAGG - Intergenic
974763511 4:66308837-66308859 ATTATGGAAACTACAATTCAAGG - Intergenic
974843515 4:67324094-67324116 ATTATGGGAACTATAATTCAAGG - Intergenic
974857911 4:67482897-67482919 ATTATGGCAGCTACAATTCAAGG - Intronic
974953059 4:68604689-68604711 ATTATGGGAGCTACAATTCAAGG - Intronic
975266445 4:72374827-72374849 ATTATAGTCACTAGAATTAAAGG - Intronic
975335966 4:73175391-73175413 ATAATGGGGATTACAATTCAAGG + Intronic
975361450 4:73476260-73476282 ATTATGGGGATTACAATTCTAGG + Intergenic
975388069 4:73781741-73781763 ATTATGGGGATTACAATTCAAGG + Intergenic
976042871 4:80907759-80907781 ATTATGGGAACTACAATTCAAGG + Intronic
976075920 4:81298825-81298847 ATTATGGGGATTACAATTCGAGG - Intergenic
976197781 4:82550072-82550094 ATTATGGGGATTACAGTTCTAGG - Intronic
976427864 4:84927553-84927575 ATTATGGGGATTACAATTCAAGG - Intronic
976863680 4:89698070-89698092 ATTATGGGGATTATAATTCAAGG - Intergenic
977015873 4:91692939-91692961 ATTACGGGGATTACAATTCAAGG + Intergenic
977046355 4:92072730-92072752 ATTATGGAGATTATAATTCAAGG + Intergenic
977176376 4:93825712-93825734 ATTATGGGGATTACAATTCAAGG - Intergenic
977178805 4:93847341-93847363 AATATAGGAACTAAATTTCAAGG - Intergenic
977360654 4:96000137-96000159 ATTATGGGGATTACAATTCAAGG + Intergenic
977422324 4:96817604-96817626 ACTATAGAGAATACAATTGATGG + Intergenic
977641036 4:99358867-99358889 ATCATCGGGATTACAATTCAAGG - Intergenic
978010888 4:103682579-103682601 ATTATGGGGATTACAATTTGAGG + Intronic
978235088 4:106447944-106447966 ATTATGGGGATTATAATTCAAGG + Intergenic
978905037 4:113995515-113995537 ATTATGGGGATTATAATTCAAGG + Intergenic
978984605 4:114996116-114996138 ATTATGGGGATTACAATTCAAGG - Intronic
978994969 4:115139555-115139577 ATTATGGGAACTACAATTCAAGG - Intergenic
979152136 4:117332236-117332258 ATTATGGGGATTACAAATCAAGG + Intergenic
979236174 4:118402710-118402732 ATTATGGGGATTATAATTCAAGG + Intergenic
979346566 4:119594044-119594066 ATTATGGGGATTATAATTTAAGG + Intronic
979464427 4:121020325-121020347 ATTACATGGAATTCAATTCATGG - Intergenic
979509185 4:121532154-121532176 ATTATATTGAATACACTTCAGGG + Intergenic
979952679 4:126913856-126913878 ATTATGGGAACTACAATTCAAGG + Intergenic
980161153 4:129164456-129164478 ACTATGGGAACTACAATTCAAGG + Intergenic
980242110 4:130190676-130190698 ATTATGGGGATTGCGATTCAAGG + Intergenic
980403662 4:132327634-132327656 ATTATTGTGTCTAAAATTCAAGG + Intergenic
980559810 4:134458917-134458939 GTTATGGGAACTACAATTCAAGG - Intergenic
980674035 4:136051084-136051106 ATTATGGGAATTACAATTCAAGG - Intergenic
980956062 4:139430492-139430514 ATTATGGGGATTACCATTCAAGG + Intergenic
981261087 4:142719688-142719710 ATTATATGTACTATAATCCATGG + Intronic
981724483 4:147833204-147833226 CACATAGGGATTACAATTCAAGG - Intronic
981795231 4:148588400-148588422 ATTATTGGAGCTATAATTCAAGG - Intergenic
981865037 4:149407196-149407218 ATTATGGAGGCTACAATTCAAGG + Intergenic
981934371 4:150223248-150223270 GTTATAGGGAGAACAATTTAAGG + Intronic
982364216 4:154557621-154557643 ATTATGGGAACTAGAATTCAAGG + Intergenic
982593745 4:157351630-157351652 ATTATAGGGATTGCAATTCAAGG - Intronic
983116303 4:163820808-163820830 ATAACATGGACTAGAATTCATGG - Intronic
983146861 4:164227385-164227407 ATCATAGGGATCACAAATCAAGG + Intronic
983417808 4:167480581-167480603 ATTATGGGAACTACAATTCAAGG - Intergenic
984080636 4:175245432-175245454 ACTATGGGGATTACAATTCAAGG - Intergenic
984346689 4:178537317-178537339 ATTATGGGAGCTACAATTCAAGG + Intergenic
984447157 4:179851164-179851186 ATTATGGGAGCTACAATTCAAGG - Intergenic
984700027 4:182813184-182813206 ATTATGGGAACTACAAGTCAAGG + Intergenic
985362952 4:189194698-189194720 ATTATGGGAACTACAATTCAAGG - Intergenic
985431706 4:189887634-189887656 ATTATGGAAACTAAAATTCAAGG + Intergenic
985802834 5:2017000-2017022 ATTATGGAGATTATAATTCAAGG - Intergenic
985931511 5:3061482-3061504 ATTATGGCAGCTACAATTCAAGG + Intergenic
986067487 5:4249565-4249587 ATTATAGGGATTACAATTTGAGG - Intergenic
986116949 5:4784615-4784637 ATTATGGGAATTACAGTTCAAGG + Intergenic
986194751 5:5527609-5527631 ATTATGGGAACTGCAATTCAAGG - Intergenic
986273931 5:6257190-6257212 ATTATGGGAGCTACAATTCATGG - Intergenic
986277484 5:6290404-6290426 ATTATCGGGATTACAATTCCAGG + Intergenic
986661167 5:10061606-10061628 ATTATGGGAGCTACAATTCAAGG - Intergenic
986777051 5:11025723-11025745 ATTATAAGCACTACAACTCAAGG + Intronic
986861295 5:11929306-11929328 ATTATAAGAACTACAATTCAAGG - Intergenic
986871162 5:12048607-12048629 ATTATGGGAGCTACAATTCAAGG - Intergenic
986912000 5:12568910-12568932 AATGTGGGGATTACAATTCAAGG + Intergenic
986985767 5:13499610-13499632 ATTATGGGAATTATAATTCAAGG + Intergenic
987008820 5:13739217-13739239 ATTGTGGGGATTACAATTCAAGG - Intronic
987254804 5:16139151-16139173 ATTATGGAAGCTACAATTCAAGG - Intronic
987431753 5:17843340-17843362 ATTATGGGGATTACAATTCAAGG + Intergenic
987461844 5:18222217-18222239 ATTATGGGAGCTATAATTCAAGG - Intergenic
987798652 5:22664538-22664560 ATTATGGGGATTGCAATTCAAGG + Intronic
987843151 5:23246792-23246814 ATTATGAGAATTACAATTCAAGG - Intergenic
987882740 5:23770174-23770196 ATTATGGAAACTACAATCCAAGG + Intergenic
987982199 5:25100392-25100414 ATTACAGGAACTAGAATTCAAGG + Intergenic
988018797 5:25596726-25596748 ATTATGGTAATTACAATTCAAGG + Intergenic
988155967 5:27449122-27449144 ATTATGGGGATTACAATTCATGG - Intergenic
988337528 5:29925917-29925939 ATTATAGGAGCTATAATTCAAGG - Intergenic
988408488 5:30855391-30855413 ATTATTGGAATTACAATTCAAGG - Intergenic
989220814 5:38960724-38960746 ATTATGGGAACTACAATTCAAGG - Intronic
989422751 5:41258955-41258977 ATTATGAGGATTACAATTCAAGG + Intronic
989436652 5:41421339-41421361 ATTATAAGAAATATAATTCATGG - Intronic
989501762 5:42176718-42176740 ACTATGGGAACTATAATTCAAGG + Intergenic
989502024 5:42178563-42178585 ATTATGGGAATTACAATTCAAGG + Intergenic
990031941 5:51271979-51272001 ATTATAGGAATTACAATTCGAGG + Intergenic
990143227 5:52729980-52730002 ATTATGGGGATTACAATTCACGG - Intergenic
990484076 5:56241121-56241143 ATTATGAGGATTACAATTCAAGG - Intergenic
990623608 5:57587327-57587349 ATTATGGGGATTACAATTCAAGG - Intergenic
991037813 5:62145441-62145463 ATTACGGGAGCTACAATTCAAGG - Intergenic
991183516 5:63781842-63781864 ATTATGGGGGTTACAATTCAAGG + Intergenic
991226831 5:64283508-64283530 ATTATGAGGATTATAATTCAAGG - Intronic
991270903 5:64779729-64779751 ATTATGGGGTTTACAATTCAAGG - Intronic
991286754 5:64985930-64985952 ATTATGGGGATTACAATTCAAGG - Intronic
992075866 5:73192174-73192196 ATTATGGGGATTATAATTCAAGG - Intergenic
992380937 5:76236830-76236852 ATTATGGGGATTACAATTTGAGG - Intronic
992903567 5:81322950-81322972 ATTATAGGGATTACAATTCAAGG + Intergenic
993258013 5:85617907-85617929 TTTATAAGGATTACAATTTAAGG + Intergenic
993258029 5:85618010-85618032 TTTATGAGGATTACAATTCAAGG + Intergenic
993316422 5:86412300-86412322 ATGATAGGCTCTTCAATTCAAGG - Intergenic
993753039 5:91693505-91693527 ATTATGGGAGCTACAATTCAAGG - Intergenic
993787148 5:92156552-92156574 ATTATAGGAACTACAGTTCAAGG + Intergenic
993792432 5:92223818-92223840 GTTATAGGAACTACAATTCAAGG + Intergenic
993884111 5:93396532-93396554 ATTATGGGCATTACAATTCAAGG - Intergenic
994271859 5:97787033-97787055 ATTATGGGGATTACAATTCAAGG - Intergenic
994348187 5:98713544-98713566 ATTATGGAAACTGCAATTCAAGG - Intergenic
994708136 5:103231137-103231159 ATTATGGGGATTACAATTCGAGG + Intergenic
994760369 5:103844347-103844369 ATTGTAGGAGCTACAAATCAAGG + Intergenic
994833149 5:104811335-104811357 ATTATGAGAACTACAATTCAAGG + Intergenic
995050234 5:107694909-107694931 ATTATAGGGACTACAATTTAAGG + Intergenic
995696916 5:114889168-114889190 ATTATGGGGATTACAACTCAAGG + Intergenic
995807923 5:116075229-116075251 ATTATGGGAGCTACAATTCAAGG - Intergenic
996616220 5:125444452-125444474 ATTATGGGGATTACAATTCAAGG - Intergenic
996685882 5:126280229-126280251 ATTATGGGGATTACAATTTGAGG + Intergenic
996809847 5:127504746-127504768 ATTATGGGAGCTACAATTCAAGG - Intergenic
997059287 5:130481166-130481188 ATTCTAGGGAGTGCAATTTAAGG + Intergenic
997630610 5:135365926-135365948 ATTATGGGGATTACAATTTGAGG - Intronic
997775732 5:136602554-136602576 ATTATGGGAACTACAATTTAAGG - Intergenic
998294605 5:140955314-140955336 ATTATGGGAACTACAATTCAAGG - Intronic
998361898 5:141595442-141595464 ATTATGGGGATTACATTTCAAGG - Intronic
998597264 5:143545115-143545137 ATTATGGAAATTACAATTCAAGG + Intergenic
999053272 5:148546826-148546848 ATTATAGGAAATACAATGTAAGG - Intronic
999540871 5:152571463-152571485 ATTATGGGAGCTAAAATTCAAGG - Intergenic
999806195 5:155083518-155083540 ATTATGGGGATTATAATTCAAGG + Intergenic
1000443591 5:161292987-161293009 ATTATAGGGACAAAAATTGCAGG + Exonic
1000516138 5:162238034-162238056 ATTGTGAGGATTACAATTCAAGG + Intergenic
1000534772 5:162466396-162466418 ATTATCGGGAGTACAATGGAAGG - Intergenic
1001358567 5:171057908-171057930 ATTATGGGGATTACAATTGGAGG + Intronic
1001832798 5:174803594-174803616 ATTATGGGAACTACAATTCAAGG - Intergenic
1002553794 5:180018544-180018566 ATTATAGGGATTGCAATTCAAGG + Intronic
1004091624 6:12508673-12508695 ATTATGGGGATTACAACTGAAGG - Intergenic
1004163345 6:13233706-13233728 ATTATGGGGATTAGAATTCAAGG + Intronic
1005196541 6:23293395-23293417 ATTATGAGGATTACAATTCAAGG + Intergenic
1006216886 6:32452113-32452135 ATTGTGGGAGCTACAATTCAAGG - Intergenic
1006217182 6:32454330-32454352 ATTACGGGACCTACAATTCAAGG - Intergenic
1007035959 6:38674049-38674071 ATTATGGGAACTTCAATTCAAGG + Intergenic
1007793776 6:44330675-44330697 ATTATGGGAACTACAATTCAAGG - Intronic
1008174624 6:48252256-48252278 ATAATAGGAACTATAATTCAAGG + Intergenic
1008191306 6:48461691-48461713 ATTATGGGAATTACAATTCAAGG + Intergenic
1008315855 6:50039591-50039613 ATTATGGCAGCTACAATTCAAGG - Intergenic
1008852143 6:56035108-56035130 GTTCTTGGGACTAAAATTCAAGG - Intergenic
1009242559 6:61199570-61199592 ATTATGGGAACTACAACTCAAGG - Intergenic
1009377698 6:62992067-62992089 ATTATGGGAACTACAATGAAAGG + Intergenic
1009415854 6:63415634-63415656 ATTATGAGGACTATAATTCAAGG + Intergenic
1009482930 6:64182971-64182993 ATTATGGGAACTACAATTCAAGG - Intronic
1009684854 6:66944031-66944053 ATTATGGGAATTACAATTCAAGG + Intergenic
1009780812 6:68267241-68267263 ATTATGGGAACTAAAATTCAAGG - Intergenic
1009801477 6:68542769-68542791 ATCATATGGTCTTCAATTCAAGG + Intergenic
1010027177 6:71232921-71232943 ATTATGGGAACTACAATCCAAGG - Intergenic
1010712963 6:79196405-79196427 ATTATGGGAACTACAATTCAAGG + Intergenic
1010850480 6:80770059-80770081 ATTATAGGGACTAGTAGTAAAGG - Intergenic
1010882560 6:81197887-81197909 ATTTTTGGGATTACAATTCAAGG + Intergenic
1011221067 6:85054980-85055002 ATTATGGGGATTACAATTCAAGG + Intergenic
1011252958 6:85392496-85392518 ATTATGGGGATTACAATTCATGG - Intergenic
1011385933 6:86797720-86797742 ATTATGAGGATTACAATTCAAGG + Intergenic
1011754161 6:90482417-90482439 CCTATGGGGATTACAATTCAAGG - Intergenic
1011844889 6:91551560-91551582 ATTATAGGGATTACAATTTAAGG + Intergenic
1011845147 6:91553474-91553496 ATTATGGGGATTACAATTTAAGG + Intergenic
1012126075 6:95429230-95429252 ATTATGGGGACTACAATTGAAGG - Intergenic
1012810306 6:103948566-103948588 ATTAGGGGAACTACATTTCAAGG + Intergenic
1012820129 6:104076492-104076514 ATTATGGGAACTACAATTCAAGG - Intergenic
1012835100 6:104254701-104254723 ATTATGCGAACTACAATTCAAGG + Intergenic
1013461208 6:110377070-110377092 ATTATGGGAGCTACAATTCAAGG - Intergenic
1013603492 6:111726743-111726765 ATTATAGGGATTACAATTTGAGG - Intronic
1013675985 6:112463760-112463782 ATTATGGGAGCTACAATTCAAGG - Intergenic
1014139603 6:117926117-117926139 ATTATAGGGATTACAATTCAAGG - Intronic
1014154328 6:118093404-118093426 ATTATGGGAACTACAATTCAAGG - Intronic
1014255006 6:119152148-119152170 AGTTTAGGGGATACAATTCAAGG + Intergenic
1014348897 6:120313682-120313704 ATTATGGGGATGACAATTCAAGG + Intergenic
1014419053 6:121218377-121218399 ATTATGGGAACTACAGTTCAAGG - Intronic
1014562859 6:122912734-122912756 ATTACAGGAACTACAATTCAAGG - Intergenic
1014918578 6:127184125-127184147 ATTATAGGAACTATAATTCAAGG + Intronic
1015487564 6:133789802-133789824 ATTATGGGAACTACAATTCAAGG + Intergenic
1015717808 6:136210178-136210200 ATTATAGGGATTACAATTCAAGG + Intergenic
1015723020 6:136265414-136265436 TTTATGGGGACTTGAATTCAGGG - Intronic
1016077628 6:139816135-139816157 ATTATGGGAACTACAATTCAAGG + Intergenic
1016141467 6:140617115-140617137 ATTATGGGAGCTACAATTCAAGG - Intergenic
1016143791 6:140645085-140645107 ATTATGGGAGCTACAATTCCAGG + Intergenic
1016347046 6:143124905-143124927 ATTATGGGGATTACAATTCAAGG + Intronic
1016355106 6:143210004-143210026 ATTATGGGAACTACAATTCAAGG - Intronic
1016574455 6:145553008-145553030 ATTATGGGGATTACAATTCAAGG - Intronic
1016750156 6:147623040-147623062 ATTATGGAAGCTACAATTCAAGG + Intronic
1016788079 6:148035377-148035399 ATTATAGGAGCTACAATCCAAGG + Intergenic
1017053795 6:150419556-150419578 ATTATGGGAGCTACAATTCAAGG - Intergenic
1017348016 6:153407001-153407023 ATTATGGGGATTACAATTTGGGG - Intergenic
1017468629 6:154718172-154718194 ATTATGGGAACTACAATTTAAGG - Intergenic
1017951829 6:159141647-159141669 ATTATAGGAACTACAATTCAAGG + Intergenic
1018182781 6:161238686-161238708 ATTATGGGAACTACAATTCAAGG - Intronic
1018257268 6:161934025-161934047 ATTACAGGGATTACAATTCAAGG - Intronic
1018485969 6:164241507-164241529 ATTTTGGGAACTATAATTCAAGG + Intergenic
1018489826 6:164280309-164280331 ATTATGGAAACTACAATTCAAGG - Intergenic
1018527863 6:164734260-164734282 ATTATGGGAGCTACAAATCAAGG - Intergenic
1018539658 6:164864513-164864535 ATTATGGGGAGTACAATTCAAGG + Intergenic
1018922576 6:168185709-168185731 ATTATGGGGATTATAATTCAAGG + Intergenic
1019766307 7:2853598-2853620 ATTATGGGAGCTACAATTCAAGG - Intergenic
1019925355 7:4188125-4188147 ATTATGGGAGCTACAATTCAAGG + Intronic
1020431090 7:8116951-8116973 ATCATGGGGATTACAGTTCAAGG - Intronic
1020493957 7:8823390-8823412 ATTATGGGAGCTACAATTCAAGG + Intergenic
1020562966 7:9754392-9754414 ATTATGAGAACTACAATTCAAGG + Intergenic
1020837958 7:13177842-13177864 ATTATGGGAACTACAATTCAAGG + Intergenic
1021280449 7:18710242-18710264 ATTATGAGAGCTACAATTCAAGG + Intronic
1021878156 7:25067975-25067997 ATTAAAGAGACTACAATTTTTGG + Intergenic
1022612980 7:31895655-31895677 ATTATGGGAGCTACAATTCAAGG - Intronic
1022810764 7:33866165-33866187 ATTATGGAGATTATAATTCAAGG - Intergenic
1023527441 7:41119262-41119284 ATTACGGGAACTACAATTCAAGG + Intergenic
1023608871 7:41954646-41954668 ATTATAAAGACTACAACTCAGGG - Intergenic
1023893684 7:44414083-44414105 AATATAGCAACTACACTTCATGG + Intronic
1024113393 7:46169898-46169920 ATTATGGGAGCTACAATTCAAGG - Intergenic
1024169478 7:46769112-46769134 ATTATGGGAACTATAATTCTAGG + Intergenic
1024191722 7:47018581-47018603 ATTATGGGAGCTACAATTCAAGG + Intergenic
1024191841 7:47019956-47019978 ATTATGGGAGCTACAATTCAAGG + Intergenic
1024684816 7:51733855-51733877 ATTATGGGAGCTACAATTCAAGG + Intergenic
1024721344 7:52140217-52140239 ATTATAAAAACTACAATTCAAGG + Intergenic
1025718034 7:63982178-63982200 ATCATAGGGACTGCTATGCATGG - Intergenic
1026288949 7:68988601-68988623 ATTATGGGAGCTACAATTCAAGG - Intergenic
1026502412 7:70953892-70953914 ATTATGGGAACTACAATTCAAGG + Intergenic
1026600459 7:71773397-71773419 ATTATGGGAGCTGCAATTCAAGG + Intergenic
1026686620 7:72515629-72515651 ATTATGGGAGCTACAATTCAAGG - Intergenic
1026697807 7:72611351-72611373 ATTATGGGAACTGCCATTCAAGG - Intronic
1027392417 7:77718130-77718152 ATTATATGAACTAATATTCATGG + Intronic
1027471345 7:78578052-78578074 AATATAGAGAATACAATTGAAGG - Intronic
1027507866 7:79040577-79040599 ATTATGGGGATTACAATTCAAGG - Intronic
1027972767 7:85106945-85106967 ATTACGGGAACTACAATTCAAGG + Intronic
1028305270 7:89255317-89255339 ATTATGGGGATTACAATTCGAGG + Intronic
1028516163 7:91680267-91680289 ATTATGGGGATTATAATTCAAGG + Intergenic
1028516425 7:91682243-91682265 ATTATGGGGATCATAATTCAAGG + Intergenic
1028614031 7:92744465-92744487 ATTATAGGAGCTACAATTCAAGG + Intronic
1030411150 7:109182050-109182072 ATTGTGGGAACTACAATTTAAGG + Intergenic
1030611393 7:111693334-111693356 ATTATGGGAATTACAATTCCAGG + Intergenic
1030729686 7:112971893-112971915 ATTATGGGGATTACAATTGATGG - Intergenic
1030752091 7:113241189-113241211 ATTATGGGGATTACAATTGGAGG - Intergenic
1030916315 7:115318416-115318438 ATTACGGGGATTACAATTCAAGG - Intergenic
1030942377 7:115669570-115669592 ATTTTATGGATTACATTTCATGG + Intergenic
1031214090 7:118868697-118868719 ATTATAGAGAATAGATTTCAAGG - Intergenic
1031282327 7:119819512-119819534 AGTATGGGAGCTACAATTCAAGG - Intergenic
1031515585 7:122694228-122694250 AAGATAGGGACAACAATTAAGGG + Intronic
1031617009 7:123893839-123893861 ATTATGAGGATTACAATTCAAGG - Intergenic
1031648827 7:124260390-124260412 ATTATGGAAACTACAATTTAAGG - Intergenic
1031755612 7:125638088-125638110 ATTATGTGGATTACAGTTCAAGG + Intergenic
1031760285 7:125705560-125705582 ATTATAGGGATTACAATTTGAGG - Intergenic
1031788455 7:126065998-126066020 ATTATGGGAACTACAATTCAAGG + Intergenic
1031987505 7:128172584-128172606 ATTATAAGGCCCACAATGCAAGG - Intergenic
1032925700 7:136602761-136602783 ATTATGGGAACTACAATTCAAGG - Intergenic
1032976710 7:137232723-137232745 ATTATGGGGATTACAATTCAAGG - Intronic
1032988905 7:137368594-137368616 ATTATGAGAACTACAATCCAAGG + Intergenic
1033423612 7:141223955-141223977 ATTATGGGAGCTACAATTTAAGG - Intronic
1033577529 7:142700675-142700697 ATTATGGAGATTATAATTCAAGG + Intergenic
1033780192 7:144659457-144659479 ATTATGGGGATTACAACTCGAGG + Intronic
1033852817 7:145517778-145517800 ATTATGGGGATTACAATTCAAGG + Intergenic
1033905079 7:146192654-146192676 ATTATGGGAGCTACAATTCAAGG + Intronic
1034012560 7:147545800-147545822 ATTATGGGAGCTACAATTTAAGG - Intronic
1034229569 7:149511185-149511207 ATTATGGGGATTACAATTCAAGG - Intergenic
1034298979 7:149998694-149998716 ATTATGGGAGCTACAATTCAAGG + Intergenic
1034321143 7:150183796-150183818 ATTATGGGGATTACAACTCAAGG - Intergenic
1034510577 7:151531502-151531524 ATTATGGGCATTACAATTCAAGG + Intergenic
1034510945 7:151534143-151534165 ATTATGGGGATTAAAATTCAAGG + Intergenic
1034677341 7:152901390-152901412 ATTCTGGGAGCTACAATTCAAGG + Intergenic
1034731136 7:153388455-153388477 ATTATGGGAACTACAATTCAAGG + Intergenic
1034736757 7:153436295-153436317 ATTATGGGGATTACAATTCAAGG - Intergenic
1034807036 7:154098079-154098101 ATTATGGGAGCTACAATTCAAGG - Intronic
1035077987 7:156193621-156193643 ATTATGGGAGCTACAATTCAAGG + Intergenic
1035869925 8:3126550-3126572 ATTCTGTGGACTACCATTCATGG - Intronic
1035884773 8:3279912-3279934 ATTATGAGCATTACAATTCAAGG + Intronic
1035981543 8:4378010-4378032 ATTAGAGGGAATACAAATAAAGG - Intronic
1036106621 8:5847281-5847303 ATTATGGGAACTACAATTCAAGG + Intergenic
1036176790 8:6546800-6546822 ATCATAGAGATTACAATTAAAGG - Intronic
1036939343 8:13036611-13036633 ATTATGGGAGCTACCATTCAAGG + Intergenic
1036993836 8:13631349-13631371 ATTACAGGAGCTACATTTCAAGG + Intergenic
1037019490 8:13951912-13951934 ATTATGGGAGCTACAATTCAAGG + Intergenic
1037249922 8:16879525-16879547 ATTATGAGGATTACAATTCAAGG - Intergenic
1037311319 8:17559705-17559727 ATTATGGGAACTACAATTCAAGG + Intronic
1037614976 8:20510805-20510827 ATTATGGGAGCTACAATTCAAGG - Intergenic
1037635624 8:20699155-20699177 ATTATGGGGATTACAGTTCGAGG + Intergenic
1037677082 8:21060089-21060111 ATTATGGGAGCTACAATTCAAGG + Intergenic
1038087130 8:24211195-24211217 ATTATGGAGATTACAATTCAAGG - Intergenic
1038356661 8:26835662-26835684 ATTATGGGAACTACAATTCAAGG + Intronic
1038652461 8:29417981-29418003 ATTATGGGAGCTAAAATTCAAGG + Intergenic
1038951563 8:32420800-32420822 ATTATGAGGACTACAACTCAAGG - Intronic
1039018814 8:33183021-33183043 ATTATGGAAACTACAATTCAAGG - Intergenic
1039214244 8:35251428-35251450 ATTATGGGAACTACAATTCAAGG + Intronic
1039220142 8:35321305-35321327 ATTATGGGGATTACAATTCAAGG - Intronic
1039758701 8:40550521-40550543 AATATGAGGATTACAATTCAAGG - Intronic
1039858643 8:41437694-41437716 ATTATGGGAGCTACAATTCAAGG - Intergenic
1039956670 8:42212787-42212809 ATTATGGGGATTAAAATTAAAGG - Intergenic
1040554717 8:48468550-48468572 ATTATGGGAACTACAATTCAAGG + Intergenic
1040644855 8:49386781-49386803 ATTATGGGAACTACAATTCAAGG - Intergenic
1040945219 8:52877021-52877043 ATTATGGGAACTACAATTCAAGG + Intergenic
1041487931 8:58399463-58399485 ATTATGGGGACTACAATTCAAGG + Intergenic
1041823680 8:62067724-62067746 ATTATGGAAACTACAATTCAAGG - Intergenic
1042032758 8:64494722-64494744 ATTATGGGAACAACAATTTAAGG - Intergenic
1042147446 8:65744961-65744983 ATTATGGGAACTACAATTCAAGG - Intronic
1042407425 8:68422051-68422073 ATTATGGGGATTACAATTCAAGG + Intronic
1043114419 8:76232535-76232557 ATTAAAGGCAATTCAATTCAAGG + Intergenic
1043122062 8:76338633-76338655 ATTATGGGGATTATAATTCAAGG + Intergenic
1043365394 8:79527064-79527086 ATTATGGGGATTATAATTCAAGG - Intergenic
1043570730 8:81599798-81599820 ATTATGGAGATTACAATTCAAGG - Intergenic
1043644194 8:82497672-82497694 GATATGGGGATTACAATTCAAGG - Intergenic
1043644466 8:82499566-82499588 ATAATGGGGATTACAATTCAAGG - Intergenic
1043663421 8:82776535-82776557 ATTGTGGGAGCTACAATTCAAGG - Intergenic
1043704518 8:83331501-83331523 ATTATGGGGATTACAATTCAAGG + Intergenic
1043708717 8:83385550-83385572 ATTATGGGAACTACAATTCAAGG + Intergenic
1044067508 8:87717199-87717221 ATTATGAGGATTACAATTCAAGG - Intergenic
1044188560 8:89284695-89284717 ATTATGGAAACTACAATTAAAGG - Intergenic
1044325029 8:90849075-90849097 ATTATGGAAGCTACAATTCAAGG + Intronic
1045489970 8:102660700-102660722 ATTATGGGGATTACAATTCAAGG - Intergenic
1045602232 8:103731157-103731179 ATTGTGGGAGCTACAATTCATGG + Intronic
1045884565 8:107079987-107080009 ATTATGGGAACTATAATTCAAGG + Intergenic
1045922567 8:107548202-107548224 ATTGTGGGAACTACAATTCAAGG + Intergenic
1046159286 8:110338928-110338950 ATCATAGGAGCTACAATTCAAGG + Intergenic
1046244266 8:111538432-111538454 ATTATGGGAACTACAATTCAAGG - Intergenic
1046270975 8:111898052-111898074 ATTATAGGAACTATAATTGAAGG + Intergenic
1046403332 8:113737488-113737510 ATTTTAGGAAGTACAATTTAAGG + Intergenic
1046689471 8:117266919-117266941 ATTATGGGGATTACAATTCAAGG + Intergenic
1046942374 8:119943561-119943583 ATTATGAGGATTACAATTCGAGG + Intronic
1047056769 8:121173751-121173773 ATTATGGGAGCCACAATTCAAGG + Intergenic
1047325822 8:123834933-123834955 ATTATGTGGATTACAATTAAAGG - Intergenic
1047556257 8:125934030-125934052 ATTATAGGTACTGTAGTTCAAGG + Intergenic
1047572990 8:126121464-126121486 ATTATGTGAACTACAATTCAAGG + Intergenic
1047831448 8:128635038-128635060 ATTATGGGAGCTACAATTCAAGG + Intergenic
1047969456 8:130072264-130072286 ATTATGGGGGCTACAATTCAAGG - Intronic
1047980052 8:130171582-130171604 ATTATGGAAATTACAATTCAAGG + Intronic
1048077907 8:131093687-131093709 ATTATGAGAGCTACAATTCAAGG + Intergenic
1048114558 8:131507230-131507252 ATTATGGAGATTACAATTCAAGG - Intergenic
1048673202 8:136747128-136747150 ATTATGGGGATTACAATTCAAGG - Intergenic
1048760556 8:137789772-137789794 ATTATGGGAAGTACAATTCAAGG + Intergenic
1048792152 8:138114080-138114102 ATTATGGAGGCTACAATTCAAGG - Intergenic
1048917560 8:139199383-139199405 ATTCTAGAAAATACAATTCAAGG - Intergenic
1049489445 8:142887038-142887060 ATTATGGGAATTACAATTCAAGG + Intronic
1049539959 8:143203961-143203983 ATTATAGGAGCTGCCATTCAAGG - Intergenic
1050721698 9:8598993-8599015 ATTATGGGAGCTACAATTCAAGG - Intronic
1050777788 9:9288733-9288755 ATTATGGGAACTACAATTCAAGG - Intronic
1050903993 9:10980750-10980772 ATTATGGGAGCTTCAATTCAAGG + Intergenic
1051267658 9:15324126-15324148 ATTATGGGAATTACAATTCAAGG - Intergenic
1051743770 9:20275992-20276014 ATTATGGGAGCTACAATTCAAGG + Intergenic
1051885960 9:21893215-21893237 ATCATGGGGATTACAATTCAAGG + Intronic
1051886631 9:21899752-21899774 ATTATGCAGATTACAATTCAAGG + Intronic
1051940619 9:22501311-22501333 ATTATGGGAACTACAATTTAAGG + Intergenic
1052273440 9:26651804-26651826 ATTATGGGGATTACAGTTCAAGG + Intergenic
1052467959 9:28853836-28853858 ATTATGGGGATTATAATTCAAGG + Intergenic
1052891025 9:33700498-33700520 ATTATAGAGATTATAATTCAAGG + Intergenic
1052969308 9:34367240-34367262 ATTATGGGAGCTACAATTTAAGG + Exonic
1053184160 9:36001021-36001043 ATTATGGGAACTACAGTTCAAGG + Intergenic
1053671610 9:40370499-40370521 ATTATGGAGATTACAATTCAAGG + Intergenic
1053720873 9:40945674-40945696 ATTGTGGAAACTACAATTCAAGG + Intergenic
1053921420 9:42996868-42996890 ATTATGGAGATTACAATTCAAGG + Intergenic
1054345117 9:63906482-63906504 ATTATGGAAACTACAATTCAAGG - Intergenic
1054382725 9:64510548-64510570 ATTATGGAGATTAGAATTCAAGG + Intergenic
1054513008 9:66005811-66005833 ATTATGGAGATTACAATTCAAGG - Intergenic
1054850428 9:69841920-69841942 ATTATGGGTGCTACAATTCAAGG + Intronic
1054968778 9:71060620-71060642 ATTAAAGAGACCACAACTCATGG - Intronic
1055142108 9:72887534-72887556 ATTACGGGAACTACAATTTAAGG - Intergenic
1055147684 9:72956187-72956209 ATTATGGGAACTACAATTCAAGG + Intronic
1055168725 9:73228372-73228394 ATTATGGGAGCTACAATTCAAGG - Intergenic
1055262284 9:74451186-74451208 GTTATGGGGATTACAATTCAAGG + Intergenic
1055324880 9:75118862-75118884 ATTATGGGACCTACAATTCAAGG + Intronic
1055366985 9:75555131-75555153 ATTGTTGGGATTAAAATTCAAGG + Intergenic
1055725315 9:79221627-79221649 ATTATGGGAGCTACAATTCAAGG - Intergenic
1055885801 9:81062202-81062224 ATTATGGGAGCTACAATTCAAGG - Intergenic
1056240528 9:84642119-84642141 ATTATGGGAGCTACAATTCAAGG - Intergenic
1057823586 9:98353737-98353759 ATTATCGGGATTACCATTCAAGG - Intronic
1058194834 9:101959499-101959521 ATTATGGGAGCTACAATTCAAGG + Intergenic
1058200095 9:102028374-102028396 ATTATGGGAGCTACAATTCAAGG + Intergenic
1058320352 9:103622306-103622328 ATTATGGGAGCTTCAATTCAAGG + Intergenic
1058779501 9:108318851-108318873 ATTATGGTAACTACAGTTCAAGG - Intergenic
1059766241 9:117386512-117386534 ATTCTAGGGCCAACATTTCAGGG + Intronic
1059843724 9:118247471-118247493 ATTATGGGAGCTACAATTCAAGG - Intergenic
1059866463 9:118519980-118520002 ATTATGGGGATTACAATTCGAGG + Intergenic
1060048926 9:120362966-120362988 ATTATGGGGATTGCAATTCAAGG + Intergenic
1060879175 9:127105734-127105756 ATGTTAGGGACTAGAAATCATGG + Intronic
1061363908 9:130160588-130160610 ATTATGGGAACTACAATTCAAGG + Intergenic
1062719780 9:138033865-138033887 ATTATAGGGATTACAATTTGAGG + Intronic
1203454274 Un_GL000219v1:150202-150224 ATTATGGAAACTAAAATTCAAGG - Intergenic
1185655265 X:1679364-1679386 ATTATGGGAGCTATAATTCAGGG - Intergenic
1185924217 X:4128495-4128517 ATTATGGGAGCTATAATTCAAGG + Intergenic
1186062041 X:5719447-5719469 ATTATGGGAGCTACAGTTCAAGG + Intergenic
1186062163 X:5720565-5720587 ATTAAAGGGTCTATAATCCATGG - Intergenic
1186273753 X:7918494-7918516 ATTATGGGAACTACAATTCAAGG + Intronic
1186603650 X:11065882-11065904 ATTATGGGGACTACAATTCAAGG - Intergenic
1186688457 X:11950026-11950048 ATTATGGGGATTACAATTCAGGG - Intergenic
1186777049 X:12875532-12875554 ATTATGGGAGCTACAATTCAAGG - Intronic
1187029538 X:15471511-15471533 ATTATAGGGTCTAAAATTTTAGG - Intronic
1187290767 X:17951150-17951172 ATTATGGGAGCTACAATTCAGGG + Intergenic
1187435620 X:19266315-19266337 ATTATGGGGATTACAATTCCAGG - Intergenic
1187500793 X:19836766-19836788 ATTATGGGAACTACAATTCAAGG - Intronic
1187615927 X:20992916-20992938 ATTATTAGAACTACAATTCAAGG + Intergenic
1188041536 X:25375391-25375413 ATTATGGGGATTACAATTCCAGG - Intergenic
1188115131 X:26233043-26233065 ATTGCAGGGATTACAATTCAAGG + Intergenic
1188223108 X:27564335-27564357 ATTATGGGAACTACAATTCAAGG + Intergenic
1188587833 X:31799531-31799553 ATTTTGGAGATTACAATTCAAGG + Intronic
1188588101 X:31801393-31801415 ATTACAGGGATTACAATTCAAGG + Intronic
1188758476 X:33995126-33995148 ATTATGGGGATTACAATTCAAGG - Intergenic
1189119872 X:38383182-38383204 ATTATATGGACTCCATTTCATGG - Intronic
1189482474 X:41403491-41403513 AATCTAGGCACTACCATTCAGGG - Intergenic
1189743193 X:44142712-44142734 ATTATAGGGATTACAACTCAAGG + Intergenic
1190531980 X:51387369-51387391 ATTATGGGGATTACAATTCGAGG + Intergenic
1190629082 X:52367725-52367747 ATTATGGGAACTACAATTCAAGG + Intergenic
1190950787 X:55140795-55140817 ATTATTGGGATTACAGTTAAAGG - Intronic
1191140818 X:57114807-57114829 ATTACGGGGATTACAATTCAAGG + Intergenic
1191694866 X:63979044-63979066 ATTATGGGAGCTACAATTCAAGG - Intergenic
1191803534 X:65107573-65107595 GATATGGGAACTACAATTCAAGG - Intergenic
1191820288 X:65299040-65299062 ATTATGGGAATTATAATTCAAGG + Intergenic
1191965570 X:66753324-66753346 ATTATGGGGATTACAATTCAAGG + Intergenic
1192378960 X:70594657-70594679 ATTATGGGAACTACAATTCAAGG - Intronic
1192416674 X:70987220-70987242 ATTATGGGGATTACAATTCAAGG + Intergenic
1193545897 X:82828576-82828598 ATTATGGGAACTACAATTCAAGG - Intergenic
1193881606 X:86929715-86929737 ATTACAGGGATTATAATTCAAGG - Intergenic
1193890829 X:87044615-87044637 ATTATGAGAGCTACAATTCAAGG - Intergenic
1193897869 X:87135503-87135525 ATTATGGGGATTACAATTCAAGG + Intergenic
1194032625 X:88835465-88835487 ATTATGGGGATTACAATTCAAGG + Intergenic
1194032873 X:88837372-88837394 ATTAGGGGGATTACAATTCAAGG + Intergenic
1194443026 X:93955739-93955761 ATTATGGGAGCTAAAATTCAAGG - Intergenic
1194540127 X:95159524-95159546 ATTATGGAGATTACAATTCGAGG - Intergenic
1194582688 X:95696428-95696450 ATTATGGGGATTACAATTCAAGG - Intergenic
1194745907 X:97628141-97628163 ATTATGGGAGCTACAATTCAAGG - Intergenic
1194779677 X:98009784-98009806 ATTATGGGAATTATAATTCAAGG - Intergenic
1194870341 X:99124124-99124146 ATTATGGGAGCTACAATTCAAGG - Intergenic
1195326010 X:103759110-103759132 ATTATGGAGATTACAATTCAAGG + Intergenic
1195807355 X:108790090-108790112 ATTATGGGAGCTGCAATTCAAGG - Intergenic
1196062870 X:111430386-111430408 ATTATGGGAAGTACAATTCAAGG - Intergenic
1196156415 X:112435142-112435164 ATTATGAGAATTACAATTCAAGG + Intergenic
1196625600 X:117873595-117873617 ATTATGGGAACTACAATTCAAGG + Intergenic
1196967650 X:121076214-121076236 ATTATGGGAACTACAATTAAAGG - Intergenic
1197072130 X:122312596-122312618 ATTATGGGAGCTACAATTCAAGG - Intergenic
1197341361 X:125270132-125270154 ATTATGATTACTACAATTCAAGG - Intergenic
1197341823 X:125284504-125284526 ATTATGGGGATTACAATCCAAGG + Intergenic
1197544737 X:127811180-127811202 ATTATGGGAGCTACAAATCAAGG - Intergenic
1197581743 X:128293026-128293048 ATTATGCAGATTACAATTCAAGG - Intergenic
1197582013 X:128295063-128295085 ATTATGGGGATTACAGTTCAAGG - Intergenic
1197689906 X:129487682-129487704 ATTACAAGGAATACAATACATGG + Intronic
1198477050 X:137005200-137005222 ATTATGGGAACTACAATTCAAGG + Intergenic
1198835184 X:140796897-140796919 ATTATGGGAGCTACAATTTAAGG + Intergenic
1198835980 X:140805347-140805369 ATTATGGGAACTACAACTCAAGG + Intergenic
1198836239 X:140807394-140807416 ATTATGGGAACTACAATTCAAGG + Intergenic
1198951953 X:142081841-142081863 ATTATGGGTATTATAATTCAAGG + Intergenic
1199117911 X:144014339-144014361 ATTATGCGGATTACAATTCAAGG + Intergenic
1199170830 X:144732878-144732900 ATTACGGCGATTACAATTCAGGG + Intergenic
1199171106 X:144735097-144735119 ATCGTGGGGATTACAATTCATGG + Intergenic
1199176248 X:144791020-144791042 AATATGGGAACTACAATTCAAGG + Intergenic
1199200978 X:145088528-145088550 ATTATGGGGATTACAATTCCAGG - Intergenic
1199280131 X:145991758-145991780 ATTATGGGAACTATGATTCAAGG + Intergenic
1199318129 X:146404477-146404499 ATTATGGGGATTACAATTCAAGG - Intergenic
1199346384 X:146746152-146746174 ACTATGGGGATTACAGTTCAAGG + Intergenic
1199346748 X:146749126-146749148 ACTAGGGGGATTACAATTCAAGG + Intergenic
1199911040 X:152287320-152287342 ATTATGGGGATTACAATTCAAGG - Intronic
1200276928 X:154741968-154741990 ATTATGGGGATTACAATTCAAGG + Intronic
1200290510 X:154868159-154868181 ATTATGGGGATTACGATTCAAGG - Intronic
1200390810 X:155945062-155945084 ATTATAGGGATTAAAATTCAAGG - Intergenic
1200417258 Y:2925418-2925440 ATTATAGGGATTACAATTTGAGG + Intronic
1200641036 Y:5718391-5718413 ATTATGGGAGCTACAATTCAAGG - Intronic
1201261450 Y:12162811-12162833 ATTATGGGGATTACAATTTGAGG + Intergenic
1201382022 Y:13391436-13391458 ATTATGGGAACTACAATTCAAGG - Intronic
1201545965 Y:15162361-15162383 ATTATGGGAGCTATAATTCAAGG + Intergenic
1202589952 Y:26472375-26472397 ATTATGGGAGCTACAATTCAAGG + Intergenic