ID: 1112142977

View in Genome Browser
Species Human (GRCh38)
Location 13:96666312-96666334
Sequence CTACAATTCAAGGCGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23883
Summary {0: 2, 1: 324, 2: 5701, 3: 9152, 4: 8704}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112142967_1112142977 13 Left 1112142967 13:96666276-96666298 CCAGGTCCCTCTGATGACATGGG 0: 1
1: 2
2: 39
3: 396
4: 1283
Right 1112142977 13:96666312-96666334 CTACAATTCAAGGCGAGATTTGG 0: 2
1: 324
2: 5701
3: 9152
4: 8704
1112142972_1112142977 7 Left 1112142972 13:96666282-96666304 CCCTCTGATGACATGGGGGGATT 0: 1
1: 0
2: 44
3: 584
4: 1724
Right 1112142977 13:96666312-96666334 CTACAATTCAAGGCGAGATTTGG 0: 2
1: 324
2: 5701
3: 9152
4: 8704
1112142965_1112142977 16 Left 1112142965 13:96666273-96666295 CCACCAGGTCCCTCTGATGACAT 0: 1
1: 17
2: 266
3: 1091
4: 3059
Right 1112142977 13:96666312-96666334 CTACAATTCAAGGCGAGATTTGG 0: 2
1: 324
2: 5701
3: 9152
4: 8704
1112142964_1112142977 20 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142977 13:96666312-96666334 CTACAATTCAAGGCGAGATTTGG 0: 2
1: 324
2: 5701
3: 9152
4: 8704
1112142973_1112142977 6 Left 1112142973 13:96666283-96666305 CCTCTGATGACATGGGGGGATTA 0: 1
1: 0
2: 52
3: 581
4: 1892
Right 1112142977 13:96666312-96666334 CTACAATTCAAGGCGAGATTTGG 0: 2
1: 324
2: 5701
3: 9152
4: 8704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112142977 Original CRISPR CTACAATTCAAGGCGAGATT TGG Intronic
Too many off-targets to display for this crispr