ID: 1112142978

View in Genome Browser
Species Human (GRCh38)
Location 13:96666313-96666335
Sequence TACAATTCAAGGCGAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29309
Summary {0: 8, 1: 1395, 2: 9326, 3: 10269, 4: 8311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112142972_1112142978 8 Left 1112142972 13:96666282-96666304 CCCTCTGATGACATGGGGGGATT 0: 1
1: 0
2: 44
3: 584
4: 1724
Right 1112142978 13:96666313-96666335 TACAATTCAAGGCGAGATTTGGG 0: 8
1: 1395
2: 9326
3: 10269
4: 8311
1112142973_1112142978 7 Left 1112142973 13:96666283-96666305 CCTCTGATGACATGGGGGGATTA 0: 1
1: 0
2: 52
3: 581
4: 1892
Right 1112142978 13:96666313-96666335 TACAATTCAAGGCGAGATTTGGG 0: 8
1: 1395
2: 9326
3: 10269
4: 8311
1112142967_1112142978 14 Left 1112142967 13:96666276-96666298 CCAGGTCCCTCTGATGACATGGG 0: 1
1: 2
2: 39
3: 396
4: 1283
Right 1112142978 13:96666313-96666335 TACAATTCAAGGCGAGATTTGGG 0: 8
1: 1395
2: 9326
3: 10269
4: 8311
1112142964_1112142978 21 Left 1112142964 13:96666269-96666291 CCTTCCACCAGGTCCCTCTGATG 0: 1
1: 4
2: 91
3: 647
4: 2214
Right 1112142978 13:96666313-96666335 TACAATTCAAGGCGAGATTTGGG 0: 8
1: 1395
2: 9326
3: 10269
4: 8311
1112142965_1112142978 17 Left 1112142965 13:96666273-96666295 CCACCAGGTCCCTCTGATGACAT 0: 1
1: 17
2: 266
3: 1091
4: 3059
Right 1112142978 13:96666313-96666335 TACAATTCAAGGCGAGATTTGGG 0: 8
1: 1395
2: 9326
3: 10269
4: 8311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112142978 Original CRISPR TACAATTCAAGGCGAGATTT GGG Intronic
Too many off-targets to display for this crispr