ID: 1112144520

View in Genome Browser
Species Human (GRCh38)
Location 13:96682724-96682746
Sequence TGATATTTTAAAATAAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1399
Summary {0: 1, 1: 0, 2: 11, 3: 143, 4: 1244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112144518_1112144520 14 Left 1112144518 13:96682687-96682709 CCTCATTAAAGGCCAGTAAGGAA 0: 1
1: 0
2: 1
3: 16
4: 143
Right 1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG 0: 1
1: 0
2: 11
3: 143
4: 1244
1112144519_1112144520 2 Left 1112144519 13:96682699-96682721 CCAGTAAGGAAAGAAGCTCTTGT 0: 1
1: 0
2: 0
3: 18
4: 246
Right 1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG 0: 1
1: 0
2: 11
3: 143
4: 1244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112144520 Original CRISPR TGATATTTTAAAATAAATGA TGG Intronic
901253657 1:7801832-7801854 TAAAATGTTAAAATAAATGTGGG - Intronic
901739246 1:11331440-11331462 TTTTCTTTTTAAATAAATGAGGG + Intergenic
903613939 1:24638353-24638375 TGTTATTTAAAAAAAAATAAGGG + Intronic
903640407 1:24855908-24855930 TGATCTTTTACAATAGATGGTGG - Intergenic
904154077 1:28467741-28467763 TCTTATGTTAAAATAAGTGATGG + Intronic
905103909 1:35550861-35550883 TCATATTTTAAAAGAAAAGCTGG - Intronic
905151200 1:35929636-35929658 TGATATTTTAAAATTGGGGAGGG + Intergenic
905932275 1:41797501-41797523 TCTTATTTAAAAAAAAATGATGG + Intronic
906071927 1:43023113-43023135 CCATATTTTATAATAAATGCGGG + Intergenic
906742355 1:48195209-48195231 ACAAATTTAAAAATAAATGATGG - Intergenic
906821705 1:48936746-48936768 TGATAATATGAAATAAATAAAGG - Intronic
907055411 1:51362545-51362567 ATATATTTAAAAATAAATAATGG - Intronic
907103615 1:51860072-51860094 TTATATTATAAATTAACTGATGG + Intronic
907195066 1:52679849-52679871 TGATGCTTTAAAAGAAATGTAGG + Intergenic
907359720 1:53904707-53904729 TCAAATTTGAACATAAATGAAGG - Exonic
907362877 1:53934526-53934548 TGGTATTTTAAAATAAAATTGGG + Intronic
907737323 1:57127161-57127183 TTAAAATTTAAAATAAATGAGGG + Intronic
908053016 1:60253352-60253374 TGATTTGTTAAAATAATTGAAGG - Intergenic
908069817 1:60447212-60447234 TTATATTTTAATAAAAATGTTGG - Intergenic
908336491 1:63130344-63130366 TAATATTTTAAAAATAATAAAGG - Intergenic
908425242 1:64000909-64000931 TAATATTTTAAAATAAGCCATGG - Intronic
908433536 1:64082311-64082333 AGGCATTTTAAAATAAATTAAGG + Intronic
908530525 1:65029577-65029599 TGGTATTTGAAAATAAAATATGG + Intergenic
908665781 1:66488798-66488820 TGACATTTTAAAATAATAGTGGG + Intergenic
908692111 1:66793910-66793932 TGATATTATAAAATAATGAATGG - Intergenic
908996326 1:70160611-70160633 AGATATTTTAAAAACAATGCTGG - Intronic
909203373 1:72723301-72723323 TGATTTTTTAAAATACATTTTGG + Intergenic
909236692 1:73161764-73161786 TGAGATTTTAAAATAAAATAAGG + Intergenic
909603459 1:77484919-77484941 AGTTGTTTTAAAATGAATGATGG - Intronic
909653607 1:78004344-78004366 CGTTATTTTAAAATAAGTAAAGG - Intronic
909944444 1:81648125-81648147 AGAGATTTTATAATAAATGCTGG + Intronic
910134660 1:83953302-83953324 AGATATTTTACAAGAACTGAAGG - Intronic
910154880 1:84205064-84205086 TCATATTTCTAAATAAATGAAGG - Intronic
910302524 1:85722618-85722640 TGATATTTAAACAGAAATTATGG + Intergenic
910586157 1:88881663-88881685 GTATATTTTAAAATAAGTGTTGG + Intronic
911026734 1:93444591-93444613 TAATTTTTTAAAATAAGAGATGG + Intergenic
911427985 1:97745613-97745635 GCATATTTTGAATTAAATGAAGG + Intronic
911768153 1:101704158-101704180 TAGTATTTTAAAATAGATGTTGG - Intergenic
911942450 1:104064872-104064894 TGATATTTTGAAATCTATGGAGG - Intergenic
911944282 1:104086425-104086447 TTATATTCTAAAACAAATCAAGG - Intergenic
911945666 1:104105494-104105516 TTAAATTTTAAAATAAATTTGGG - Intergenic
912010923 1:104961299-104961321 TGCTCTATTAAAATAAATGAAGG + Intergenic
912178559 1:107190412-107190434 TAAAATTTTTAAAAAAATGATGG - Intronic
912227872 1:107756161-107756183 AGACATTTTAAAATAGGTGAAGG - Intronic
912250100 1:108002507-108002529 TGTTATATTAATATAAATCATGG + Intergenic
912271364 1:108212540-108212562 TGATATCTTAAAATGAAAGCTGG - Intergenic
912339041 1:108892186-108892208 TACTATTTAAGAATAAATGATGG - Intronic
912453391 1:109781557-109781579 TGATTTTTTAAAATGATTGCTGG - Intergenic
912692013 1:111811718-111811740 TGATTTTTTAAAAATAATGAAGG - Intronic
912923370 1:113891109-113891131 TTATATTTTACAATCCATGAAGG - Intergenic
913103265 1:115589424-115589446 GGATGTTTGAAAAAAAATGATGG + Intergenic
913533413 1:119749150-119749172 TGAGATTTTAGCAGAAATGAAGG - Intronic
913710228 1:121475398-121475420 TGAAATTCTGAAATAAAGGATGG + Intergenic
915204242 1:154257690-154257712 TTAAAATATAAAATAAATGAGGG + Intronic
915822030 1:159034524-159034546 CGATATTTTAAAATAAAACCTGG - Intronic
916016948 1:160758309-160758331 TATTATTTTAAAATAAATGCTGG + Intergenic
916712031 1:167420002-167420024 TTATCTTTCCAAATAAATGAGGG - Exonic
916780931 1:168028274-168028296 TTATTTTTTAAAATAAAATAAGG - Intronic
916977499 1:170096981-170097003 AGATATTTTAAAAAGAAAGAAGG - Intergenic
917161908 1:172066797-172066819 TGATGATGTTAAATAAATGAAGG - Intronic
917569750 1:176252661-176252683 ACATATTCTTAAATAAATGAGGG - Intergenic
917589848 1:176464969-176464991 TTATATTTTTAAATAAAAGTAGG + Intronic
917647547 1:177044144-177044166 TCATTTCTTAAAATTAATGATGG - Intronic
917740430 1:177956963-177956985 TGATATTTTCTATTTAATGATGG + Intronic
917753757 1:178078670-178078692 GAATATTTTAAAATAAATGAGGG - Intergenic
917919467 1:179738758-179738780 TGATATTTTGATATAAATTAGGG - Intergenic
918339800 1:183558866-183558888 GGAAATTTTAAAGTTAATGAGGG - Intronic
918558021 1:185828302-185828324 TGCAAATTTAAAATAAGTGAGGG + Intronic
918760251 1:188395511-188395533 TCATATTTAATGATAAATGATGG + Intergenic
918888466 1:190229796-190229818 AAATATTTTAAAATTATTGATGG - Intronic
918916629 1:190648884-190648906 TGATTTTTTAAAAAAAATTATGG + Intergenic
918940276 1:190985993-190986015 ATATATTTTAACAGAAATGAAGG + Intergenic
919161701 1:193839046-193839068 TGATATTAAAGAATAAATGAAGG + Intergenic
919274026 1:195388924-195388946 TGGTGCTTTAAAATTAATGACGG - Intergenic
919444030 1:197678615-197678637 TGAAAATTTAAAATATCTGACGG - Intronic
919557014 1:199069978-199070000 AGATATTTAAAAATATATGAAGG + Intergenic
919668282 1:200313936-200313958 TGATATTTTAAAATGTACAAAGG - Intergenic
919710703 1:200725066-200725088 TAATACTTTTAAATAAATGTTGG + Intergenic
919733964 1:200933083-200933105 TAGTATTTTAAAATATCTGATGG + Intergenic
920607723 1:207406238-207406260 TGTAATTTTACAATAAATTATGG - Intergenic
921460794 1:215424041-215424063 TCAATTTTTAAAATAAAAGATGG - Intergenic
921654826 1:217722145-217722167 TGATAAAGAAAAATAAATGAGGG + Intronic
921701486 1:218273524-218273546 GGACATTTTAGAATAACTGAAGG + Intergenic
921774382 1:219080332-219080354 TTGTATGATAAAATAAATGAAGG - Intergenic
921827433 1:219688783-219688805 AGAAATTTTAAAAAAAATGTAGG - Intronic
922313312 1:224417019-224417041 TAATATTTTAAGATAAAGTAAGG + Intronic
922432863 1:225572885-225572907 TGGTATTTTAAAATAAAATATGG + Intronic
923117306 1:230954671-230954693 TGGGATTTGAAAATGAATGATGG - Intronic
923246803 1:232140061-232140083 TGTAATTTTAAAATAAAGCAAGG - Intergenic
923516323 1:234700734-234700756 TGATATTTTTAAACAAATCCAGG - Intergenic
924107145 1:240660289-240660311 TGATTTTTTAAAAAAAATCTGGG - Intergenic
924312725 1:242762099-242762121 TGATGTTATAAAATAACTCATGG + Intergenic
924358122 1:243205815-243205837 ACAAATTTTAAAATAAATAATGG + Intronic
924496145 1:244591180-244591202 TGATGTTTTAAAATACATTGTGG + Intronic
1062926797 10:1322085-1322107 TGATATTTCTAAATAACTCAGGG + Intronic
1062986888 10:1777210-1777232 TGATATTTTAAAATCATTTTTGG + Intergenic
1063029827 10:2223300-2223322 TCCTATTTTACATTAAATGAAGG + Intergenic
1063209613 10:3867925-3867947 GGATATGTTAAAAGAAATCATGG + Intergenic
1063320712 10:5050335-5050357 TGAAATTTTAAAATCAAAGAAGG + Intronic
1063568083 10:7189982-7190004 TGTTGTTTTCAAATAAATCAGGG - Intronic
1063854265 10:10229954-10229976 TCAAATTTTAAAAGAAATGGAGG + Intergenic
1063988014 10:11528251-11528273 TGATCTTTTAAAAAAACTTATGG - Intronic
1065050481 10:21786904-21786926 TTATATTTTACAATAAAGGAGGG + Intronic
1065071545 10:22029887-22029909 TGATATTTTGAAATTATTAAAGG - Intergenic
1065103267 10:22352988-22353010 TGATATTTTATCAGAAATGTAGG - Intronic
1065446224 10:25804272-25804294 TGTTATTTTAAAACAAAATAGGG + Intergenic
1065559811 10:26951189-26951211 TCATACTTTGAAAGAAATGATGG + Intergenic
1065659480 10:27990886-27990908 TGAGATTTAAAAATAAAATATGG + Intronic
1065766050 10:29030603-29030625 TGCAATTTGAAAATAAATCAGGG - Intergenic
1066511761 10:36107109-36107131 TGAAATTTTAAAATAGATTTAGG + Intergenic
1066600169 10:37096399-37096421 TGCTGTTTTAAAATAACTCACGG + Intergenic
1067422883 10:46172792-46172814 TGATAATTAAATATAAATGCAGG - Intergenic
1067987058 10:51161609-51161631 TGATTTTTTGAAAAAAAAGATGG - Intronic
1068269889 10:54707622-54707644 TATTATTTTGAAATAAATGCAGG - Intronic
1068277673 10:54823528-54823550 TTTTATGTTAAATTAAATGAAGG + Intronic
1068330792 10:55564852-55564874 GGAAATTTTGATATAAATGAAGG + Intronic
1068412021 10:56668399-56668421 TTCTTTTTTAAAATAAATAAAGG + Intergenic
1068508067 10:57928253-57928275 TGATAATTTAAGATGGATGATGG - Intergenic
1068753946 10:60629483-60629505 TGATATTGAAAAATACATAATGG + Intronic
1068780711 10:60916561-60916583 TGACATTTAAAAATAAATAGAGG - Intronic
1068920706 10:62480729-62480751 TGATTTTATTAAATAAATGCTGG - Intronic
1069017669 10:63448455-63448477 TGATATTTTAAAATGTATTAGGG - Intronic
1069189975 10:65475103-65475125 TGACATTTTAACATCAATGGTGG - Intergenic
1069236786 10:66085858-66085880 CCATATTTTAACATAAATTATGG - Intronic
1069330127 10:67282198-67282220 TAAAATTTTAAAATAAATTTTGG - Intronic
1069409963 10:68143272-68143294 TGATAATTTACATTATATGATGG + Intronic
1070226080 10:74507832-74507854 TGATATTATGAAATAAATGAGGG - Intronic
1070453461 10:76585161-76585183 GGATATTGGGAAATAAATGAGGG - Intergenic
1071223572 10:83498959-83498981 TGATATTTTACAATTGATAATGG + Intergenic
1071513247 10:86280599-86280621 AGCTTTTGTAAAATAAATGAAGG - Intronic
1071683413 10:87730306-87730328 TGAGATTATAGAAAAAATGAAGG + Intronic
1071756448 10:88546409-88546431 TAAAATTGTAAAATAAATAATGG + Intronic
1071965768 10:90851201-90851223 TGATTTTTCAACAGAAATGATGG + Intronic
1072014159 10:91329697-91329719 TAATATTTTAAATTAAATTTGGG - Intergenic
1072330747 10:94349009-94349031 TTATATTTTAAAATAAAAAATGG - Intronic
1072515455 10:96177232-96177254 TGATATTTTTAAAATATTGAAGG + Intronic
1072632441 10:97155581-97155603 GGAGATTTTAAAATCAATGAGGG + Intronic
1073635298 10:105192008-105192030 AGAGATTTTAAATAAAATGATGG + Intronic
1073733129 10:106314597-106314619 GGATATTTGGAAGTAAATGAAGG + Intergenic
1074172672 10:110958644-110958666 TGTGATTTTAGAATAAAGGAGGG - Intronic
1074491182 10:113941053-113941075 TGATTTTATAACATAAATGGGGG - Intergenic
1075478157 10:122754574-122754596 TCTGATTTTAAAACAAATGAAGG + Intergenic
1075769222 10:124918738-124918760 TATTATTTTGAATTAAATGAGGG + Intergenic
1075882414 10:125865118-125865140 TTATGTTTTTAATTAAATGATGG - Intronic
1076099550 10:127764751-127764773 TGATATTTTAAGAATAATAAGGG - Intergenic
1076388613 10:130078036-130078058 TGATATTTACATATCAATGAAGG + Intergenic
1076583115 10:131527685-131527707 AGATATTCTTCAATAAATGAGGG + Intergenic
1076814366 10:132907528-132907550 TTAAATTTGAAAATAAATAAGGG - Intronic
1077831535 11:5877288-5877310 TGATACTATAAAATAAATTATGG - Intronic
1078309476 11:10225642-10225664 TGATAGAATTAAATAAATGAAGG - Intronic
1078482534 11:11691240-11691262 AGATCTTTTTATATAAATGAGGG - Intergenic
1078592121 11:12651273-12651295 TGATATTATTAAATAATTTAGGG + Intergenic
1078738667 11:14045964-14045986 ATAGATTTTAAAATAAATGTAGG + Intronic
1078976881 11:16487194-16487216 TGATTTTTTAAAATATAAGGAGG + Intronic
1078985521 11:16592012-16592034 TAATATTTTAAAATGAATTGTGG - Intronic
1079453256 11:20615945-20615967 TTCTATTTTACAATAAAAGATGG + Intronic
1079620933 11:22552954-22552976 TGATATTTTAATTTAAAATATGG + Intergenic
1079620958 11:22553394-22553416 TGCTTTTTTAAAAAAATTGAAGG + Intergenic
1079644615 11:22847675-22847697 TGCTATTTTAAACTAAAGTAAGG + Intronic
1079768146 11:24420823-24420845 AGATATTTTGAAATAAAGGGAGG - Intergenic
1080370171 11:31629411-31629433 TTATATTTTAAAAAATATAATGG - Intronic
1080940648 11:36914046-36914068 TGATATGAAAAAATAAAGGAAGG + Intergenic
1081010629 11:37807003-37807025 TGATATATTGACATAAATCATGG - Intergenic
1081177257 11:39944383-39944405 GGTTATTTGAAAATACATGAAGG - Intergenic
1081381999 11:42428111-42428133 TGATATTAATAAATAAATCAGGG - Intergenic
1081544374 11:44059651-44059673 TGATATTCAAAAAGAAATCAGGG + Intronic
1081624554 11:44642220-44642242 TGATATTTTAAAAAATATATAGG - Intergenic
1082143921 11:48644328-48644350 CAATTTTTTAAAATAAATGGAGG - Intergenic
1082705777 11:56492865-56492887 TGATATATAAAAATGAATGAGGG - Intergenic
1082706947 11:56503709-56503731 TGATATATAAAAATGAATGAAGG - Intergenic
1082769504 11:57195977-57195999 TCATATTTTTAAATGAATGGAGG - Intergenic
1082979336 11:59105522-59105544 TGATTTTTTAAAATATGTCAGGG + Intergenic
1083108244 11:60379431-60379453 TGGTATATTTAAATAAATGGAGG - Intronic
1084988279 11:72897456-72897478 TGATGATTTACAATATATGAAGG + Intronic
1085293726 11:75418441-75418463 AGTTATTTTAAAATACACGATGG + Intronic
1085370668 11:76001651-76001673 TAGTATTTTAAAAAACATGATGG + Intronic
1085469072 11:76745316-76745338 TTTTATTTTAAAATAAAGTATGG - Intergenic
1085571496 11:77561773-77561795 GTATATTTTAGAATAACTGAGGG - Intronic
1085629229 11:78099589-78099611 ACAGATTTTAAAAAAAATGATGG + Intergenic
1085683075 11:78596260-78596282 AGTCATTTTAAAATGAATGATGG + Intergenic
1085733947 11:79023104-79023126 TAAATTTTTTAAATAAATGAAGG - Intronic
1085832970 11:79921673-79921695 TCATGTTTAAAAATAAATGGGGG + Intergenic
1085933095 11:81109939-81109961 TGATAATTTAAAAACAATTAAGG + Intergenic
1085936317 11:81149947-81149969 TCAGATTTTTAAATAAAAGATGG - Intergenic
1086262494 11:84957393-84957415 TGATATTTAAAGATAAAGTAGGG + Intronic
1086620278 11:88879591-88879613 TGACATTATAAAATAAAGAAAGG - Intronic
1086663077 11:89445869-89445891 TGAAATTTTAATTTTAATGAAGG - Intronic
1087035459 11:93751702-93751724 TCATATTTTTAAAAAAATCAAGG - Intronic
1087595541 11:100249734-100249756 TGACTTTTTAAAATAAATCAGGG - Intronic
1087685384 11:101257017-101257039 GGATATTTTAAAACAACTGCTGG - Intergenic
1087818897 11:102689227-102689249 TAATGTTTTTAAAAAAATGAGGG + Intergenic
1088409782 11:109521459-109521481 TGAGATACTAAAATCAATGAAGG + Intergenic
1088464686 11:110122277-110122299 TGAAATTATAAAATAACTGATGG - Intronic
1088604915 11:111519639-111519661 TGATGTTAGAAAATAGATGAGGG + Intronic
1088852791 11:113719005-113719027 TGATATTTTCAAAAACATCAAGG + Intergenic
1089022351 11:115229365-115229387 TGCTATTTTAACAAATATGATGG + Intronic
1089041603 11:115456050-115456072 TAACTTTTTAAAATTAATGATGG + Intronic
1089904098 11:122020242-122020264 TGATATTTTAAAACCTATGATGG + Intergenic
1090282920 11:125473152-125473174 ACACATTTTAAAATAAATTAGGG + Intronic
1090336115 11:125966773-125966795 TGATTTTTCAACAGAAATGATGG + Intronic
1090486195 11:127114457-127114479 TTATATTTGAAAATAATTGTGGG + Intergenic
1090993776 11:131845704-131845726 AGATATTTTAAAAAAAATCCAGG - Intronic
1091123631 11:133077474-133077496 TGAAATTATAAAATCAATAAAGG + Intronic
1091679702 12:2518306-2518328 TGATCTTTAAAAAAAAATCAGGG + Intronic
1091716395 12:2779816-2779838 ATATATTTCAAAATAACTGACGG + Intergenic
1091741999 12:2965842-2965864 TGATAATTTAAAAAAATTTATGG - Intronic
1092086097 12:5762150-5762172 TGCTAAGTTAAATTAAATGATGG + Intronic
1092623103 12:10295117-10295139 TGCTGTTTTAAAATAAAATATGG - Intergenic
1092626103 12:10330521-10330543 TTAAATTATAAAATAAATGGTGG - Intergenic
1092950242 12:13496190-13496212 TAGTATTTTTTAATAAATGAAGG - Intergenic
1093204514 12:16231412-16231434 TGATTTAGAAAAATAAATGAGGG + Intronic
1093338787 12:17945116-17945138 TGATATTGTAAAATATTTCATGG - Intergenic
1093346905 12:18049087-18049109 TGATATCTTAAAATCAATTATGG - Intergenic
1093467971 12:19469858-19469880 TTCTATTTTAAAATGAATTAAGG - Intronic
1093796870 12:23322625-23322647 AAATATTTTAAAACAAATAAAGG + Intergenic
1093962416 12:25289196-25289218 TGATTTTTTTTAATAATTGAAGG - Intergenic
1094012757 12:25826497-25826519 GTATATTTTAAAATAACTTAGGG - Intergenic
1094440655 12:30472217-30472239 TTCTATTTTAACATTAATGATGG - Intergenic
1094634799 12:32215571-32215593 TGAGATTTTTTAAAAAATGAAGG + Intronic
1095118915 12:38390272-38390294 TGAGCTTTTAAAATATATGATGG - Intergenic
1095159038 12:38893753-38893775 TGAGTTTTTTAAATAAAAGAAGG - Intronic
1095328087 12:40922624-40922646 TGATGTTGTCAAATAAAGGAAGG + Intronic
1095338631 12:41061664-41061686 TGATATTCTCAAATATATTATGG + Intronic
1095472100 12:42548359-42548381 AGAAATTTTAAAATATAGGATGG - Intronic
1095718755 12:45377018-45377040 TAATATTTTTACATAGATGAAGG + Intronic
1095756950 12:45778681-45778703 TTAAATTTTTAAATAAATGACGG + Intronic
1097535529 12:60865405-60865427 AGATTTTTTAAAATGACTGATGG + Intergenic
1097818413 12:64101031-64101053 AGATATTTACAAATAAATGCAGG + Intronic
1097860127 12:64510550-64510572 TGATATTTTAATATTAATTAAGG + Intergenic
1098000496 12:65937108-65937130 TAATTTTTTTAAATAAAAGAAGG - Intronic
1098023493 12:66179000-66179022 TGAAATTTTTCAATAAATGCAGG + Intergenic
1098107633 12:67086717-67086739 TTATATTTTAAAATTATTGTAGG + Intergenic
1098348291 12:69529317-69529339 TGACATTTTAAAATACTAGAAGG + Intronic
1098693626 12:73522944-73522966 TAATATGTTCAAATAAATAAAGG + Intergenic
1098786280 12:74760586-74760608 TATTATTTTAAAAAAATTGAAGG - Intergenic
1098981401 12:76960869-76960891 TGATTTTTTAAAATGAGAGATGG + Intergenic
1099042474 12:77673483-77673505 TGTTGCTTTAAAATAAATGTAGG - Intergenic
1099055291 12:77832929-77832951 TGTTAGTTTAAAATAATTTAAGG + Intronic
1099156248 12:79180199-79180221 TCATATTTTCAAAGAAATAATGG - Intronic
1099562866 12:84200757-84200779 TAATATTTTCAAATTAATAAAGG - Intergenic
1099590858 12:84587800-84587822 TGATAATATAAAATGAAAGAGGG + Intergenic
1099601151 12:84739526-84739548 TGATTTTTTAAAATTAAACATGG - Intergenic
1099679621 12:85808795-85808817 TTTTATTTTAAAATAAATAATGG + Intronic
1099745232 12:86693375-86693397 AAATATTTTTAAACAAATGAGGG + Intronic
1099774882 12:87112908-87112930 TGATATTTTAAAGTACTTGTTGG + Intergenic
1100063108 12:90605723-90605745 TGATGTTTAAAAAATAATGAAGG + Intergenic
1100410484 12:94312816-94312838 GTATATTTTAAAAGAAAAGAAGG + Intronic
1100567448 12:95811300-95811322 TGAAAGTTTAAAATTAATAAGGG + Intronic
1100737161 12:97548883-97548905 TGAATTTTTAAAATAAATAATGG + Intergenic
1100802771 12:98250783-98250805 TAATGTTTTAAAAATAATGAAGG + Intergenic
1101695317 12:107120186-107120208 TTATATTTTTAAATGAATTAAGG - Intergenic
1101788685 12:107909308-107909330 TGATATTTTAACTAAAATAAGGG - Intergenic
1101926350 12:108974838-108974860 TGTAACTTTAAAACAAATGATGG + Intronic
1102090842 12:110186206-110186228 TGATGTTATGAAATAAATAATGG - Intronic
1102799466 12:115718815-115718837 TCTTATATCAAAATAAATGAGGG + Intergenic
1102845631 12:116179299-116179321 TTATATTGTAACATAAATTAAGG - Intronic
1103457572 12:121078369-121078391 TGATATTTTCAAAGAAATTTTGG - Intergenic
1103766335 12:123282860-123282882 AGATATTTTCAAAAAAATAAAGG - Intergenic
1103829106 12:123764167-123764189 TGAATATTTAAAATAAATGAAGG - Intronic
1103986225 12:124769231-124769253 GTATATTTTTAAATAACTGAAGG + Intergenic
1104338753 12:127927410-127927432 TCATATTTTAGAATAAAAGCAGG - Intergenic
1104364619 12:128165786-128165808 TGATATTTAAAAAAAAAAGACGG + Intergenic
1104467337 12:129001303-129001325 TGATATTTTAAAATGAATTAAGG + Intergenic
1104593766 12:130105434-130105456 TGCTTTTATAAAATACATGAAGG + Intergenic
1105371099 13:19802706-19802728 AGATATTTTGAAATATTTGAGGG - Intergenic
1105416225 13:20214228-20214250 TGATATTTTTAAATAAAATGTGG - Intergenic
1105483289 13:20799791-20799813 TGATATTTAAAATTTAATGTTGG - Intronic
1106008801 13:25797849-25797871 TGATATTTCATTATAACTGAAGG + Intronic
1106088960 13:26569807-26569829 TAATAAATTAAAATAAAAGACGG + Intronic
1106385007 13:29276055-29276077 TGCTAATTTAAAACAAATTATGG + Intronic
1106486868 13:30180005-30180027 TAATATTGCAAAATAAATTAAGG + Intergenic
1106943964 13:34804962-34804984 TGACTTTTTAAATTAAATTAGGG - Intergenic
1107063007 13:36181415-36181437 AAATATTTTAAAATGAAGGAAGG - Intronic
1107215471 13:37912866-37912888 TGATCTCATAAAATAAATTAAGG + Intergenic
1107365691 13:39671591-39671613 AAATATTTTGAAATATATGATGG - Intronic
1107437997 13:40398520-40398542 AGTTATTTTAAATTCAATGACGG - Intergenic
1107614956 13:42156766-42156788 TTATAGTTTAAAATCAATTAAGG - Intronic
1107629491 13:42328573-42328595 TAATATTTTAATTTACATGAAGG + Intergenic
1107934607 13:45334957-45334979 TGACATTTGAAAACAAATGAAGG - Exonic
1108148441 13:47504660-47504682 TACTCTTTTAAAATAAAAGAGGG + Intergenic
1108222256 13:48247698-48247720 TTATATCTTAAACAAAATGAAGG - Intronic
1108228066 13:48310178-48310200 AGATATTATTATATAAATGAAGG - Intronic
1108816237 13:54294584-54294606 TGATATTTTAAAATAATTATTGG - Intergenic
1108893045 13:55286368-55286390 TGATATTTTATATAAAATAATGG - Intergenic
1109236954 13:59833888-59833910 TTAAAGTTTAAAATAAGTGAGGG - Intronic
1109414946 13:62026943-62026965 GGATATTTCTAAATAATTGAGGG - Intergenic
1109922192 13:69079873-69079895 TGATATTTTAAAAATAGTTATGG - Intergenic
1109936368 13:69290569-69290591 TTATGTTTTAAAATATATGAAGG - Intergenic
1110126184 13:71944980-71945002 TTATATTTTGGAATAAATCATGG + Intergenic
1110191189 13:72730755-72730777 TGATATTTTAAAAGAGATACAGG + Intronic
1110210789 13:72969891-72969913 TGAAATTTAAACATTAATGATGG + Intronic
1110259985 13:73474219-73474241 TGGCATTTAAAATTAAATGAAGG + Intergenic
1110295916 13:73865710-73865732 TGTTATTTTAAAGTACATGTTGG - Intronic
1110311282 13:74052368-74052390 TTACATTTTAAAATAATTGTTGG + Intronic
1110707191 13:78609102-78609124 TAAAATTTTATAATAAATCAGGG - Intergenic
1110771313 13:79350726-79350748 TCTTTTTTTAAAAAAAATGAAGG - Intronic
1110786115 13:79528450-79528472 AAATATTTTAAAATAAATCTAGG + Intronic
1110886597 13:80645180-80645202 AGATATTTTCAAAGAAGTGATGG + Intergenic
1110931890 13:81229898-81229920 GGATATTTCAAACTATATGATGG - Intergenic
1111032906 13:82630696-82630718 TGATATATTAACATAAATAAAGG - Intergenic
1111063421 13:83055736-83055758 TAATACTATAAAATAAATTATGG - Intergenic
1111071883 13:83180427-83180449 TAAAATTTCAAAATAAATTAAGG - Intergenic
1111124670 13:83898799-83898821 ATATATTTTAAAAGAAATAAGGG - Intergenic
1111279222 13:85997518-85997540 TGACATTTTAAAGTAAATATTGG - Intergenic
1111305462 13:86407361-86407383 ACATATTTTAAAATAACTTAGGG + Intergenic
1111338614 13:86854522-86854544 TAATATTTGAAAATTAATGTTGG - Intergenic
1111538471 13:89636755-89636777 TTATATTTTGACATCAATGAAGG - Intergenic
1111542987 13:89692426-89692448 GTACATTTTAAAATAACTGAAGG + Intergenic
1111781594 13:92733844-92733866 ACATATTTTAAAAGAACTGATGG - Intronic
1111816174 13:93156239-93156261 TTATATTTTAAAAGAGAGGAAGG + Intergenic
1111832756 13:93350565-93350587 TGATATTTTAAAAATAGTGTAGG - Intronic
1112131359 13:96527294-96527316 TGCTATTTTTAAATGAATAAAGG - Intronic
1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG + Intronic
1112367660 13:98769488-98769510 TTATAAATGAAAATAAATGAAGG + Intergenic
1112870461 13:103964586-103964608 TAATTTTTTAAAAAAGATGATGG + Intergenic
1113066380 13:106377252-106377274 TGATAATTTAACATAAATCGGGG - Intergenic
1113089395 13:106601223-106601245 TTATATTTAAAAATATATGTGGG - Intergenic
1113090532 13:106613344-106613366 TGATTTTTTAAAATAAATATTGG - Intergenic
1113363847 13:109657394-109657416 TGATATTTTAAAATCACAGCTGG - Intergenic
1113702681 13:112398974-112398996 TTATATTGTAAAATAAAGCATGG + Intronic
1114187679 14:20415426-20415448 TTATATTTAAAATTAAATTATGG + Intergenic
1114698669 14:24653335-24653357 TGAAATTTAAAAATAAAGGAAGG + Intergenic
1114832087 14:26156699-26156721 TTTTTTTTTAAAATAAATGTAGG - Intergenic
1115003956 14:28457366-28457388 AGATATATTTTAATAAATGAAGG + Intergenic
1115149097 14:30262906-30262928 TGACTTTTTAAAAAAAATGATGG - Intergenic
1115163318 14:30419930-30419952 TAATATTTTAAGATAAAAGTGGG - Intergenic
1115318109 14:32048126-32048148 TGGTATATTAATATAAATCAAGG + Intergenic
1115735384 14:36322150-36322172 TGAAAATTCAAAATCAATGATGG - Intergenic
1116045403 14:39736744-39736766 TGCTATCTTAAAATAAAAGTTGG - Intergenic
1116185052 14:41589700-41589722 TGATATTTTAAATTAAATTTAGG - Intergenic
1116195387 14:41718308-41718330 TGATATTTTAAATTGCAAGACGG - Intronic
1116196275 14:41730261-41730283 TATTATTTAAAAATAAATAAAGG + Intronic
1116201070 14:41796953-41796975 TGAATTTTTAAAATAAGTAAAGG - Intronic
1116226408 14:42159132-42159154 TGACATTGTAAAAAGAATGAAGG + Intergenic
1116371491 14:44139558-44139580 TGATATTTTCAATTAACTGTGGG - Intergenic
1116837622 14:49786340-49786362 TCATATTGTAAAATAAATGGGGG - Exonic
1116861404 14:49998514-49998536 CAATATTTAAAAATAAATAATGG + Intronic
1116968182 14:51036783-51036805 TCTAGTTTTAAAATAAATGATGG - Intronic
1117052103 14:51870934-51870956 GTACTTTTTAAAATAAATGATGG + Intronic
1117179246 14:53175550-53175572 TCATATTTTGAAATAAATTTGGG - Intergenic
1117486881 14:56206615-56206637 TGTTATTTTAAAACATCTGAAGG - Intronic
1118369986 14:65129657-65129679 AGACATTTTATAAAAAATGAAGG + Intergenic
1119284261 14:73438782-73438804 TAATTTTTTAAAATGAATTAGGG + Intronic
1119502476 14:75141877-75141899 TAAAATTTTAAAACAAATCATGG + Intronic
1119625480 14:76171141-76171163 TTATACTTTTAAATAAATCAAGG - Intronic
1119662815 14:76463858-76463880 TAATATTTTAATATAAAAAAAGG - Intronic
1119913739 14:78375857-78375879 TGACAATTTATAATAAATTAAGG + Intronic
1120171875 14:81254496-81254518 TGATATTGTAAAATAAATATTGG + Intergenic
1120339183 14:83197161-83197183 TGAGATTCTAAAAATAATGATGG - Intergenic
1120379481 14:83756732-83756754 TGATGTTTTAAAATATATAGTGG - Intergenic
1120511635 14:85422788-85422810 TGAAATTTTAAAAAAATAGATGG + Intergenic
1120685100 14:87528893-87528915 GGATGTTTAAAAATAAGTGAAGG - Intergenic
1120737390 14:88068213-88068235 TGTTGTTTTTAAATAAACGAGGG - Intergenic
1120949589 14:90028878-90028900 TGATATTTTCAAATATATCGTGG - Intronic
1121069331 14:91002969-91002991 TAGTATTCTAAAATAAACGATGG + Intronic
1121309471 14:92927780-92927802 TGATATTGTTAAAGAAATCAAGG + Intronic
1122010542 14:98742861-98742883 TGATATTTTTCAATATATCATGG - Intergenic
1122236884 14:100335968-100335990 TTTTTTTTTAAAAGAAATGAGGG + Intronic
1122339086 14:101015101-101015123 TGACTTTGTAAAATAAATTAGGG + Intergenic
1122431053 14:101644419-101644441 TTATCTTTTAAAATTAATTAAGG - Intergenic
1123126597 14:105951364-105951386 TGGTATTGTAAAATTAAAGATGG - Intergenic
1123407114 15:20027466-20027488 TGGTATTGTAAAATTAAAGATGG - Intergenic
1123494510 15:20812327-20812349 ATATATTTTACAATAATTGAAGG - Intergenic
1123516444 15:21034122-21034144 TGGTATTGTAAAATTAAAGATGG - Intergenic
1123679473 15:22748844-22748866 TTGTATTTTATAATGAATGAGGG - Intergenic
1124181940 15:27484320-27484342 TGATAATTTAAAATATCTGTAGG + Intronic
1124331688 15:28823296-28823318 TTGTATTTTATAATGAATGAGGG - Intergenic
1124562336 15:30786475-30786497 TAAAATTTAAAAATAAATAAAGG - Intergenic
1125313253 15:38403212-38403234 TATTATTGGAAAATAAATGAGGG + Intergenic
1125360488 15:38859560-38859582 TGATATTTTTCAAGAAATGTAGG - Intergenic
1125400469 15:39296926-39296948 TGACATATTATAATACATGAAGG + Intergenic
1125438219 15:39671477-39671499 TTATATTTTAAAAAACCTGAAGG + Intronic
1125465767 15:39950972-39950994 TGAATTTTTAATATAAATGGGGG - Intronic
1125818775 15:42609739-42609761 TGAAATTTTAATTTAAGTGAAGG + Intronic
1125904958 15:43383161-43383183 TGCTATTTTAATTTAAATGTGGG - Intronic
1125994265 15:44142727-44142749 TGATAGTTTAAATTAAGAGAAGG + Intronic
1126116876 15:45216134-45216156 TGAATTTTTAATATAAATGCAGG + Intergenic
1126224558 15:46255481-46255503 TTATATTTAAAAATCAATTAAGG + Intergenic
1126445166 15:48734783-48734805 GGATATTTTAAAATAATAAAGGG + Intronic
1126693870 15:51309450-51309472 TGATATTTAAAAATAAAGAGTGG - Intronic
1126906257 15:53370069-53370091 TGACTTTTCAAAATAAATCATGG + Intergenic
1126964953 15:54041147-54041169 TTATATTTTAAAATATAGAAAGG - Intronic
1126964954 15:54041152-54041174 CTATATTTTAAAATATAAGATGG + Intronic
1126969187 15:54090648-54090670 TAATATTTCAAAATATCTGAAGG + Intronic
1127492490 15:59478319-59478341 TGATATATTCAATTAGATGAGGG - Intronic
1127568703 15:60219109-60219131 TGATATTATAAAATAGAATATGG - Intergenic
1127594686 15:60467951-60467973 TTCCATTTTAAAAAAAATGACGG + Intronic
1127693508 15:61421012-61421034 TGAGATTTTAAACTTAATCAGGG - Intergenic
1127704303 15:61532080-61532102 TGATATTTTAAAGGAAAAGTTGG - Intergenic
1127746470 15:61980870-61980892 TGACAATTTCAAATATATGAGGG - Intronic
1127853710 15:62937766-62937788 CTATACATTAAAATAAATGATGG - Intergenic
1128121463 15:65150934-65150956 TGTTTTTTTAAAATAAAAAATGG + Intronic
1129030961 15:72617306-72617328 TGACATTCTAAAATATGTGAGGG - Intergenic
1129083398 15:73062241-73062263 TCATATTTTAAAATTATTAATGG + Intronic
1129547650 15:76414513-76414535 TGATTTTTTATAAGAAACGATGG + Intronic
1129609581 15:77042617-77042639 GGATATATGAAAATAAATGAAGG + Exonic
1129836856 15:78713946-78713968 TGACATTCTAAAATATGTGAAGG - Intronic
1130391291 15:83457813-83457835 TGATTTTTTAAAATATCTTAAGG + Intronic
1130545396 15:84853976-84853998 TTATATTTTAAAATTAGAGATGG - Intronic
1130782111 15:87051168-87051190 AGCTAATTTAAAATAAATGCTGG - Intergenic
1131409394 15:92194120-92194142 TGATATTGCAAAACAAGTGATGG + Intergenic
1132158102 15:99510865-99510887 TGAGATTTTAACACAAATTATGG - Intergenic
1132159048 15:99519851-99519873 TGATATTTTAAAATATTTAGGGG - Intergenic
1132363725 15:101240301-101240323 TAATAATTTCAAATAATTGAAGG + Intronic
1132420183 15:101659121-101659143 TTATATTTTGAAATAATTGTAGG - Intronic
1202959348 15_KI270727v1_random:108663-108685 ATATATTTTACAATAATTGAAGG - Intergenic
1133338919 16:5024188-5024210 AGAGATTTTAAAATAAATAAGGG - Intergenic
1133992843 16:10723329-10723351 TAATATGTTAATATAAATAAAGG + Intergenic
1134295462 16:12941541-12941563 TTATATTTTAAAATAACTGAAGG - Intronic
1134369668 16:13611411-13611433 TCATATTTTAAGACAATTGAAGG + Intergenic
1135072365 16:19363193-19363215 TAAGATATTAATATAAATGATGG - Intergenic
1135129691 16:19842791-19842813 AGATAATTTATAATAAAAGATGG - Intronic
1135531901 16:23262039-23262061 TGGTCTTTTAAAATATTTGAGGG - Intergenic
1135988860 16:27204722-27204744 TGATGTTTAAAAATAATTTAAGG + Intronic
1136935548 16:34460253-34460275 AAATATTCTAAAATAAGTGATGG + Intergenic
1136946151 16:34653691-34653713 AAATATTCTAAAATAAGTGAAGG - Intergenic
1136948996 16:34692254-34692276 AAATATTCTAAAATAAGTGAAGG - Intergenic
1136964270 16:34888317-34888339 AAATATTCTAAAATAAGTGATGG - Intergenic
1138023971 16:53508217-53508239 TAAAATATTAGAATAAATGATGG - Intergenic
1138050928 16:53776597-53776619 TGCTATTTTTAAATCAATAAAGG - Intronic
1138566836 16:57839643-57839665 TGAAATTTAAAATAAAATGAAGG - Intronic
1138716083 16:59023850-59023872 TTATATTTTAACATAAATATTGG + Intergenic
1138867191 16:60836242-60836264 TCATTTTTTAAAATAATAGAAGG - Intergenic
1138880082 16:61002542-61002564 TTATATTTTAAAACAAACTAGGG - Intergenic
1140222067 16:73050861-73050883 AAATATTTAAAAATAAATCAGGG + Intronic
1140645106 16:77021401-77021423 TGATATCTTAAAATCATTGGGGG - Intergenic
1140646919 16:77041367-77041389 TGATATTGCAAAATAACTAAAGG + Intergenic
1140647297 16:77046500-77046522 GGATTTTTTAAAATAAAATATGG + Intergenic
1140841767 16:78846142-78846164 TTAAATTTTGAAATAAATGTTGG + Intronic
1140969417 16:79998448-79998470 CAACATTTTAAAACAAATGATGG + Intergenic
1141780374 16:86155783-86155805 AAATGTTTTAAAATCAATGATGG + Intergenic
1141938619 16:87259122-87259144 TGATATTAAAAAATAACTGGAGG - Intronic
1142479449 17:209495-209517 AAATATTTTAAAGTAAATTAAGG - Intergenic
1143716376 17:8773418-8773440 TAATATTTTCAAATGACTGAAGG + Intergenic
1144001668 17:11060768-11060790 AGAAATTTTAAAGTAAATTATGG - Intergenic
1144018130 17:11216310-11216332 GGATATTTTAAAAGAAGTGTAGG + Intergenic
1144201469 17:12946139-12946161 TGAAATTTTTAAAAAAATTATGG + Intronic
1144231485 17:13208833-13208855 TGGGAATTTAAAATAAATGGGGG + Intergenic
1144241081 17:13312622-13312644 AAATATTTTAAAATAAAAGTGGG - Intergenic
1144268152 17:13591415-13591437 TGTTATTTTGTAATAAATGGGGG + Intronic
1144326546 17:14187458-14187480 AGATATATTGAAATAAATCAGGG + Intronic
1144475424 17:15584325-15584347 AGATATATTGAAATAAATCAGGG + Intronic
1145988579 17:29064267-29064289 TCTTATTTTAAATTAAATTAAGG + Intergenic
1146488999 17:33266467-33266489 TGCTTTTTTAAACTAAATGCAGG - Intronic
1147012570 17:37462886-37462908 TGATATTTAATATTATATGACGG + Intronic
1148044724 17:44736282-44736304 TGATATTAAAAAGTAAATGGAGG - Intronic
1148294085 17:46484806-46484828 TCATATTTCATAATAATTGATGG + Intergenic
1148316268 17:46702509-46702531 TCATATTTCATAATAATTGATGG + Intronic
1148883694 17:50755340-50755362 AGATCTTTCAAAATATATGACGG + Exonic
1148940956 17:51210814-51210836 TGGTTTTTTAAAAAAAATTATGG - Intronic
1149222647 17:54433320-54433342 TGATCATTTAAAATAAATGTGGG - Intergenic
1149689205 17:58559965-58559987 TAAGATGATAAAATAAATGATGG - Intronic
1149771228 17:59322732-59322754 ATATATTTTAAAACAAATGATGG + Intergenic
1149776683 17:59363678-59363700 GGATGTTGTAAAATAAGTGATGG - Intronic
1150045707 17:61911374-61911396 TGATTTTTTAAAATATAAGGAGG + Intronic
1150298884 17:64031819-64031841 TGACATCTCAAAATAAATGGGGG + Intergenic
1150430383 17:65111047-65111069 TAATATTCTAAAATCAATCAAGG - Intergenic
1150543929 17:66133389-66133411 TGAAACTTTAAACTACATGAAGG - Intronic
1150694124 17:67389564-67389586 TGCCATTTAAAAATAGATGATGG + Intronic
1151574374 17:74944454-74944476 TGAAATTATAAAATAATTCAGGG + Intronic
1152159217 17:78656972-78656994 TAATATTTTAAAATTAGAGATGG + Intergenic
1152843342 17:82584352-82584374 TGTTTTTTAAAAATCAATGAAGG + Intronic
1152982917 18:295897-295919 TGAGATTTTAGAAAAAAGGAAGG + Intergenic
1153235448 18:2981916-2981938 TTATTTTTTAAAATTAAGGATGG - Intronic
1153430602 18:5012322-5012344 TTACATTTTAAAATAACTAAAGG + Intergenic
1153478808 18:5526345-5526367 AGATATTTTCTAATAAGTGAAGG - Intronic
1153590239 18:6666107-6666129 TGAGGTTTTCAGATAAATGAGGG + Intergenic
1153939628 18:9967225-9967247 TGATATTTTAATTTAGATAAAGG - Intergenic
1153959586 18:10129630-10129652 TGAACTGTAAAAATAAATGAAGG + Intergenic
1154361178 18:13662509-13662531 TGAAAATAAAAAATAAATGAAGG + Intergenic
1155318876 18:24598483-24598505 TGATATTTAAAGCAAAATGATGG + Intergenic
1155612877 18:27687285-27687307 ATATATTTTAAAATAAACAAAGG + Intergenic
1155679148 18:28468076-28468098 TAATCTTTTTAAATAAATGCTGG + Intergenic
1155754653 18:29475973-29475995 TGGTTTTTTAAAAAAAATTAAGG + Intergenic
1155772291 18:29717042-29717064 TTTGATTTTAAAATAAATCAGGG - Intergenic
1155823114 18:30403263-30403285 TGAAATATAAAAACAAATGATGG - Intergenic
1156029685 18:32698044-32698066 AGATTTTTTAAAATAAATTTGGG - Intronic
1156316850 18:35977360-35977382 TTAAATTATAAGATAAATGACGG + Intronic
1156553866 18:38045920-38045942 TTGTTTTTTAAAATTAATGATGG + Intergenic
1156590900 18:38487023-38487045 TGATGTTTTAAAATAACCAAAGG + Intergenic
1156747373 18:40408480-40408502 TCCTATTTTAAAATGAATGAAGG - Intergenic
1156787875 18:40937711-40937733 AGCTATTTTAAAATATATAAAGG + Intergenic
1157458717 18:47864020-47864042 TGACATTTAAAAGTGAATGATGG - Intronic
1157848104 18:51022654-51022676 TCTTATTTTAAAAAAAAGGACGG - Intronic
1157866256 18:51187761-51187783 TGATATATAAGAATGAATGAAGG + Intronic
1158044448 18:53138642-53138664 TGATTTTTCAAAATAACTCATGG + Intronic
1158741546 18:60148099-60148121 TATTATTTTAAAATGATTGATGG - Intergenic
1159303208 18:66605267-66605289 TGATACTGTAAAAAATATGAAGG - Intergenic
1159436948 18:68430479-68430501 TACTTTTTTAAAATAATTGAAGG + Intergenic
1159463161 18:68745436-68745458 TAATTTTTTAAATGAAATGAGGG - Intronic
1159477314 18:68938781-68938803 AGATATTTTAAAACAAATATGGG + Intronic
1159559752 18:69981041-69981063 AGATATTTTAAAAGAAGTTATGG - Intergenic
1159604383 18:70459907-70459929 TGGGATTTTAAAAAAAATCAGGG + Intergenic
1159764877 18:72476778-72476800 TGATATTTAAAGCTAAATGCTGG - Intergenic
1159781432 18:72665071-72665093 TTATATTTTAAAATATAGAAGGG + Intergenic
1159790327 18:72771358-72771380 TAATTTACTAAAATAAATGAGGG + Intronic
1159924925 18:74260321-74260343 TTATATTTGAAGATAAATGTAGG - Intronic
1160165007 18:76503468-76503490 AGATGTTTTAAAATATCTGAAGG + Intergenic
1160171142 18:76556403-76556425 CCATATTTTTAAATAATTGAAGG - Intergenic
1160253042 18:77220778-77220800 TAATATTAAAAAATAAAAGAGGG + Intergenic
1160344248 18:78119168-78119190 TAATCTTTTAAAATATATGCAGG + Intergenic
1161178256 19:2861192-2861214 ACATATTTTAAAATAAAATATGG - Intergenic
1162137823 19:8566812-8566834 ATATATATTAAAATAAATAAAGG - Intronic
1164284767 19:23804191-23804213 TGATACTTTAAGATAAAGAATGG + Intronic
1164378804 19:27713414-27713436 TGTTTTTGTAAAATTAATGAAGG - Intergenic
1164662350 19:29987214-29987236 GTGTATTTGAAAATAAATGATGG + Intronic
1166260902 19:41640203-41640225 TAATATTTTATAAAAAATAAAGG + Intronic
1166523993 19:43499569-43499591 TGATCTTTGAGGATAAATGAGGG + Intronic
1166578522 19:43868388-43868410 TTAAAATTTAAAATAAATGAAGG + Intergenic
1167770844 19:51516305-51516327 ACATATTTTACAATAACTGATGG - Intergenic
1167777524 19:51570154-51570176 TGATGTTTTAAAATAAAAGCAGG + Intergenic
1167837237 19:52084207-52084229 TCATATTTTAAAATCAATGATGG + Intronic
1167841964 19:52129617-52129639 TCATATTTTTAAATCAATGATGG + Intronic
1167846244 19:52167168-52167190 TTATATTTTAAAATCAATGATGG + Intronic
1167966642 19:53153146-53153168 TCATGTATTAAAATAGATGATGG + Intronic
925842738 2:8007637-8007659 TGATATTATAAACTACGTGAGGG + Intergenic
926539535 2:14158270-14158292 TGAAAGTTAAAAATAAATCAGGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
926832612 2:16979914-16979936 TGATATTTTAAAATCAAACCAGG + Intergenic
926904551 2:17793767-17793789 TGCTATGTTAAAGTAAAAGAAGG + Intronic
926981154 2:18570986-18571008 GGAGTTTTTATAATAAATGAAGG - Intronic
927804173 2:26130748-26130770 TTGTATTTTTAATTAAATGAAGG + Intronic
927903845 2:26843405-26843427 TGAAATTTAAAAATAAAAGCAGG + Intergenic
928236223 2:29543585-29543607 TGATATTGAAAAAGGAATGAAGG + Intronic
928282653 2:29962565-29962587 TAATATTTTAAAAGAAACAATGG + Intergenic
928311207 2:30211235-30211257 TGAATTTTTAATATAAATGTGGG + Intergenic
928541615 2:32290297-32290319 TATTCTTATAAAATAAATGATGG + Intronic
928553055 2:32392939-32392961 TGATTTTATAAAAAAAATTATGG - Intronic
928599447 2:32889018-32889040 AGATAGATTAAAATAAAAGATGG + Intergenic
929010428 2:37437425-37437447 TTATATTTTTAACTCAATGATGG + Intergenic
929019277 2:37535458-37535480 TAATATTTTAAAAAATAAGAGGG - Intergenic
929061251 2:37926462-37926484 TGACATTTTAATATAGATTATGG - Intronic
929778059 2:44940894-44940916 TGTTATTTTAAAATACAGGGTGG + Intergenic
929816468 2:45236823-45236845 TGTTTTCTTAAAAAAAATGACGG + Intergenic
930044152 2:47154557-47154579 TTACATTTTAAAATAAATGTGGG - Intronic
930258723 2:49120464-49120486 TGACACTTTAAAATAAGTCAGGG + Intronic
930293322 2:49523133-49523155 CGTTATTTTCAAATAAACGATGG + Intergenic
930356820 2:50331185-50331207 TGATATGATAAAATATATGCTGG + Intronic
930648388 2:53937435-53937457 AAATATTTCAAAATAAGTGATGG + Exonic
930679039 2:54235689-54235711 TTCAATTTTAAAATAAATAAGGG + Intronic
930755828 2:54971046-54971068 TTAAATCTTAAGATAAATGAGGG + Exonic
930892085 2:56401700-56401722 TGATATGTTAAAATATAAGAAGG - Intergenic
930972580 2:57414842-57414864 TTACATTTTAAAATAACTAAAGG + Intergenic
931061524 2:58534778-58534800 TGAGATTTTAAAATGTAAGAGGG + Intergenic
931063625 2:58559303-58559325 TGGCTTTCTAAAATAAATGAAGG - Intergenic
931313892 2:61107979-61108001 TTATATTTTAATATAAATTAAGG - Intronic
931522515 2:63114563-63114585 TGCTTTTTTAAAAAAAATCATGG - Intergenic
932363397 2:71129583-71129605 ACATATTTTAAAAAAAATGAAGG + Intronic
932541276 2:72655846-72655868 AGATATTCTAAAAGAAATTACGG - Intronic
932724673 2:74169199-74169221 TGTTATTTTAAAATGAATTTGGG + Intronic
932887101 2:75558499-75558521 TTATTTTTTAAAAAAAAGGAGGG + Intronic
933007165 2:77009932-77009954 TGAAATTTTAAGTTTAATGATGG - Intronic
933017702 2:77150512-77150534 TGAGATCTTAAAATGAATGAGGG - Intronic
933128392 2:78640783-78640805 AGATATGTTTAAATAAAAGAAGG - Intergenic
933328983 2:80873343-80873365 TGATATTATAAACTATATGCTGG + Intergenic
933334740 2:80943349-80943371 CTATATTTTAAAACAACTGAGGG + Intergenic
933455469 2:82514421-82514443 TGAAATTTAAAAATAAAGCATGG + Intergenic
933457468 2:82534796-82534818 TGAAATTCTAAAATAAATGTTGG - Intergenic
933459096 2:82556325-82556347 TGTTATTTAAAAATAATTTATGG + Intergenic
933472576 2:82744933-82744955 TAATATTGTGAAATAAATTATGG + Intergenic
933744193 2:85558744-85558766 TAATATTTTAAAAAGAATTATGG + Intronic
934077906 2:88443433-88443455 TGAGATTTTAAAACAAAAAAAGG - Intergenic
934911766 2:98264422-98264444 AGATATCTTGAGATAAATGAAGG - Intronic
934930953 2:98422673-98422695 TGATTTCTTATAATAAATTATGG + Intergenic
935197264 2:100824751-100824773 TGATTTTTTAAAATATATTTTGG + Intronic
935515492 2:104031724-104031746 TGAGATTACAAAATAAATTATGG - Intergenic
936632696 2:114220967-114220989 TGATTTTCTAAATTAAATGTTGG - Intergenic
936775953 2:115973443-115973465 TGATATTTAAAAGTTGATGAGGG - Intergenic
936791184 2:116154758-116154780 TGATAATTTATAATAAAAAAAGG + Intergenic
936810266 2:116390432-116390454 AGAAACATTAAAATAAATGAGGG - Intergenic
936997516 2:118430929-118430951 GGATATTTTAAAACAAATCCAGG + Intergenic
937032209 2:118750155-118750177 CTATATTTTAAAACACATGACGG + Intergenic
937187411 2:120057334-120057356 TTAGATTTTAAAATAGACGATGG - Intronic
937631218 2:124103333-124103355 TAATTTTTTAAAATAAGTGTAGG + Intronic
937912733 2:127083568-127083590 TGGTATTTTAAAATACATTTTGG - Intronic
938056261 2:128217225-128217247 TTTTATTTTAAAATAACTGTAGG + Intergenic
938439308 2:131312927-131312949 TGATCTTTTCAAATATATAATGG - Intronic
938446240 2:131381661-131381683 TGATATTTTTAATTGAATAATGG + Intergenic
938642477 2:133295490-133295512 AGATATTTTAAGAAAAATGAGGG - Intronic
939138287 2:138322948-138322970 TTATATTTCAAAATAAAGGCAGG - Intergenic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939440430 2:142242083-142242105 TGATTGTTTAAAAGAAATTAGGG - Intergenic
939517543 2:143188073-143188095 TAATATTTAAAAAGAAAAGAAGG - Intronic
939576877 2:143906644-143906666 TGAAATTTTAAAGAAAATGATGG + Intergenic
939611012 2:144310974-144310996 TGATATATTAAAATCAAATATGG - Intronic
939664659 2:144936252-144936274 TTAAATTTTAAAATTAATGATGG + Intergenic
939772421 2:146337710-146337732 TAATATCTTGAATTAAATGATGG + Intergenic
939911491 2:147988820-147988842 TGGAATTTTAAAATAAAAGTAGG + Intronic
940057445 2:149527598-149527620 TGACATTGTAAAATAGCTGAAGG + Intergenic
940113840 2:150185567-150185589 TGATATTTGAACATAAATGCAGG + Intergenic
940345990 2:152629276-152629298 TAATATTTTTAAATCAATGAAGG - Intronic
940456129 2:153902923-153902945 TTATTTTTTTAGATAAATGATGG - Intronic
940564036 2:155337900-155337922 AGCTATTTTAAATTAAATAATGG + Intergenic
940676410 2:156729076-156729098 TGATATTTTAAAGAAAAATAAGG + Intergenic
941091330 2:161180014-161180036 TGATATTTTAAAATTATTTATGG - Intronic
941190354 2:162373928-162373950 TTACATTTTGAAATCAATGAAGG - Intronic
941194491 2:162431645-162431667 TCTTATATTCAAATAAATGATGG + Intronic
941214764 2:162692631-162692653 TGATATTTTAGAGTATAGGATGG + Intronic
941708266 2:168683134-168683156 TAATTTTTTACAATAAATGCTGG + Intronic
941853240 2:170205387-170205409 AGAAATTTTAAATTAAATGCTGG - Intronic
941865242 2:170327463-170327485 TGATACTTTACAGTAACTGAAGG - Intronic
941967778 2:171316711-171316733 ATAAATATTAAAATAAATGAGGG + Intergenic
942395642 2:175545620-175545642 GTATATTTTAAAATAACTTAAGG + Intergenic
942490158 2:176481958-176481980 GGATGTTTTAAAAGAACTGACGG - Intergenic
942574137 2:177345021-177345043 TGAATTTTTAATATAAATGCAGG + Intronic
942768945 2:179491998-179492020 TCATATTATAAAATAAAAGATGG - Intronic
942797101 2:179834518-179834540 TGATATTTTAAAACGAAAGACGG + Intronic
942863612 2:180645957-180645979 TGATTTTTAAAAATAAAAGAAGG - Intergenic
943228823 2:185217324-185217346 TGAAATTTGAAAATTCATGAAGG + Intergenic
943362712 2:186941682-186941704 TAACTTTTAAAAATAAATGATGG - Intergenic
943671205 2:190663155-190663177 TGATTTTTAAAAATGAATTATGG + Intronic
943789479 2:191916287-191916309 TGGAACATTAAAATAAATGAGGG + Intergenic
943894790 2:193342534-193342556 AAACATTTAAAAATAAATGAAGG - Intergenic
943988722 2:194658229-194658251 TAATATTTTAAAATATAAAAGGG - Intergenic
944638942 2:201702579-201702601 GAATATTTTAAAATTACTGATGG - Intronic
944643218 2:201749626-201749648 CGATATTTTAAAATAAGAAATGG + Intronic
944651804 2:201837812-201837834 TAATTTTTTAAAATCAATTATGG - Intronic
945305694 2:208256515-208256537 TAATTTTTTAAAATAAATTTTGG - Intronic
945431185 2:209767627-209767649 TGAGGTTATACAATAAATGAAGG - Intergenic
945460692 2:210104576-210104598 TGACATATTAAAATAAAAAAAGG + Intronic
945653506 2:212594411-212594433 ATATATTTAAAAATAAATTAAGG - Intergenic
945768292 2:214007672-214007694 TGACATTTTAACAGAAATAATGG - Intronic
945842147 2:214900303-214900325 AGATATTTTATAATAAAGGTTGG + Intergenic
946067828 2:217004647-217004669 TGATATCTTCAAATAATTCAAGG - Intergenic
946555067 2:220847329-220847351 TGAAATGTTAAAATAAAGAAAGG + Intergenic
946792098 2:223311492-223311514 TGAAAGTTTATAATAAAAGATGG - Intergenic
946802439 2:223434262-223434284 TCATATTTTAAAAATAATGTAGG + Intergenic
946897123 2:224335490-224335512 AAATATTTTAATATAAAAGATGG + Intergenic
947012104 2:225577923-225577945 TAATAAATTAAATTAAATGAGGG - Intronic
947022417 2:225694580-225694602 TGCTATTTAAAAATAAATGTGGG + Intergenic
947578897 2:231299174-231299196 TAAAATTTTAAAAAAAATAAAGG + Intronic
947705641 2:232273395-232273417 TGATCTTTTAAAAAAGATGATGG + Intronic
947866976 2:233405029-233405051 TGAAATTTAAAAATAAACCAAGG - Intronic
948618349 2:239215978-239216000 TATTATTTTAAAATAAATTTGGG - Intronic
1169177958 20:3535489-3535511 TGAAACTTTTAAATTAATGAAGG - Intronic
1169398679 20:5260369-5260391 AAATATTTTAAAATAGATAATGG - Intergenic
1169550759 20:6698976-6698998 TGGTAGTTTAAAATCTATGACGG + Intergenic
1170105054 20:12746208-12746230 TGATTTTTTAAAACAAAATAAGG + Intergenic
1170255953 20:14343218-14343240 TAACATTTTAAAACAAGTGAAGG - Intronic
1170687236 20:18580474-18580496 TGCTTTTTAAAAATAAATTAAGG - Intronic
1171202472 20:23253220-23253242 AAATATTTTAAAATAAAAAAAGG - Intergenic
1171244065 20:23595364-23595386 TGAAGTTTTAGAATAAATAAAGG + Intergenic
1171346909 20:24472124-24472146 TGATATTAAAATAAAAATGAAGG + Intronic
1172144886 20:32750081-32750103 GGACATTTTAAAGTGAATGAAGG - Intergenic
1172452607 20:35038276-35038298 TGATATGTTAAAAAAAAAAATGG - Intronic
1173116693 20:40250290-40250312 TGATTTTTTAAAAAAGAAGAAGG + Intergenic
1173237293 20:41258198-41258220 TGATTTTTTAAAAGAAATCTTGG - Intronic
1173493543 20:43502635-43502657 AGAGATTGTAAAATAAATGTGGG - Intergenic
1174123383 20:48284193-48284215 TGATATTTTCAACTTTATGATGG - Intergenic
1174849951 20:53984265-53984287 AGATATTTTAAGATAAGTAATGG + Intronic
1174978173 20:55359035-55359057 AGATGTTTTAAAATCAATAAAGG + Intergenic
1175528358 20:59652928-59652950 AGATTGTTTAAAATAAATGCTGG + Intronic
1175706987 20:61186706-61186728 TGTTCTTAGAAAATAAATGATGG - Intergenic
1176003509 20:62846162-62846184 CGATAATTTAAAAAAAAAGAAGG + Intronic
1176694820 21:9962618-9962640 TTATATTTTAATAGAAATCAGGG + Intergenic
1176879577 21:14174508-14174530 TTTTATTTAAAAAAAAATGATGG - Intronic
1177368047 21:20163678-20163700 TGATATTTGGAAAGATATGATGG - Intergenic
1177432580 21:21009559-21009581 TGAAATATATAAATAAATGAGGG + Intronic
1177593132 21:23199927-23199949 TAATATATTTAAATAAATGATGG - Intergenic
1177642906 21:23866807-23866829 TTATATTATAATATAGATGAGGG - Intergenic
1177813369 21:25949170-25949192 TGAAATTATAAAATAAAACACGG + Intronic
1178332522 21:31711143-31711165 TGAAATTTTAAGAAAAATGTTGG - Intronic
1178934216 21:36847143-36847165 TGAAGCTTTATAATAAATGATGG - Intronic
1179053276 21:37907714-37907736 TGATATTTGAAGATGAAGGAAGG - Intronic
1179130213 21:38629424-38629446 TGATTTTTTAAAAACAATGGTGG + Intronic
1180747305 22:18098663-18098685 TAATATTATAAAGAAAATGAGGG - Exonic
1181846173 22:25710806-25710828 TTATATTTGAAAATTATTGAAGG + Intronic
1182186928 22:28413811-28413833 TGATACAGCAAAATAAATGAAGG + Intronic
1182601766 22:31470624-31470646 TTATATGTTAAAAAAAATGTAGG - Intronic
1182901914 22:33905547-33905569 TGGATTTTTAAAATGAATGATGG - Intronic
1183127393 22:35797166-35797188 TGATATTTTGATTTAAAAGAAGG - Intronic
1183127528 22:35798720-35798742 TGATATTTTGATTTAAAAGAAGG + Intronic
1183572150 22:38661533-38661555 TGTAATTTATAAATAAATGAAGG - Intronic
1184574857 22:45355369-45355391 GAATATTTTTAAATAAATGAAGG - Intronic
949094239 3:66907-66929 TAATATAATAAAATGAATGATGG + Intergenic
949228736 3:1725514-1725536 TGATATCCTAAAATAAATAGGGG + Intergenic
949260026 3:2095404-2095426 TTATATTTTAAAATCAGGGATGG + Intergenic
949588078 3:5463187-5463209 TTATATTTAAAAAGAAAAGATGG - Intergenic
949656179 3:6222879-6222901 TAATTTTTTATAATAAAGGAAGG - Intergenic
950292676 3:11798904-11798926 TTATATTTTAAGATATATTAAGG - Intronic
950971015 3:17187917-17187939 TTGTATTTTAAAATAAGTGGTGG - Intronic
951223801 3:20097349-20097371 TGTTATTTTAAGATGAAGGAGGG - Intronic
951695390 3:25440915-25440937 TGAATTTTTAATATAAATGTGGG - Intronic
951889495 3:27555166-27555188 TTATATTTTAAAGTAAATCATGG - Intergenic
951925322 3:27902769-27902791 TGAAATTTTAAAAAAAATAGTGG - Intergenic
952184300 3:30952359-30952381 TGAGAGATAAAAATAAATGATGG - Intergenic
952278215 3:31898240-31898262 AGCTATTTTAAAATATATAATGG - Intronic
952325735 3:32319010-32319032 TAATATTTTCAAAAAAATTAAGG - Intronic
952410013 3:33039918-33039940 TGATTTTTCAAAAGAAATGATGG + Intronic
952489978 3:33859593-33859615 TTGTATTTTATAATGAATGAGGG - Intronic
952524016 3:34190806-34190828 TGATAATTAAGATTAAATGAGGG + Intergenic
952618562 3:35306406-35306428 TCATATTTTAAAATAAATATAGG + Intergenic
952622331 3:35360845-35360867 TCATATTTTTAAATAAAACAAGG - Intergenic
952670010 3:35955047-35955069 TGATATTATAGGAAAAATGAGGG - Intergenic
952732159 3:36649882-36649904 TTATATATTAGAATAAAGGATGG + Intergenic
953466403 3:43124491-43124513 TGACTTCTTAAAATAAATAATGG + Intergenic
953630077 3:44606896-44606918 TAAAATTTCAAAATCAATGATGG - Intronic
954005321 3:47585980-47586002 TGTTATTTTGGAAAAAATGAGGG - Exonic
954478610 3:50774950-50774972 TAATATTAGAAAATTAATGAAGG - Intronic
955098418 3:55823058-55823080 TTCTATTTTAAAAGACATGAAGG + Intronic
955181017 3:56669699-56669721 TGTTATTTTTAAAATAATGAAGG - Exonic
955270666 3:57495039-57495061 AGATATTTTAAAATAATAAAAGG + Intronic
955295277 3:57729243-57729265 TGACTTTTTAAAATGCATGATGG - Intergenic
955309435 3:57870155-57870177 TGATATTTTAACTTAACTAAAGG - Intronic
955441792 3:58963908-58963930 TTCTATTTTAACATAAATGCTGG - Intronic
955554685 3:60124216-60124238 TGTTGTTTTAAAAAAAATGTAGG - Intronic
955554962 3:60126978-60127000 TGAAATTTCAAGATAAATGCAGG + Intronic
955588202 3:60505166-60505188 TTATCTATTAAAATAAAGGAAGG - Intronic
955603990 3:60679579-60679601 TGAAATTGTTAAATAAATTATGG - Intronic
955834254 3:63036940-63036962 AGATATTTTACAATAAAGTAGGG - Intergenic
955918233 3:63927613-63927635 TGGTATATACAAATAAATGACGG + Intronic
955950204 3:64236098-64236120 TTATATTTTAAAATAATTTTCGG + Intronic
956170320 3:66428442-66428464 GAATTTTTTAAAATAAGTGAGGG + Intronic
956814518 3:72895719-72895741 TCATAATTTGAAATAAATGCTGG - Intronic
956964666 3:74444642-74444664 TGGTACTTTAAACTAAATGTGGG + Intronic
957175361 3:76801388-76801410 GTATATTTTAGAATAACTGAGGG + Intronic
957208031 3:77223260-77223282 TGATATAAAAAAATCAATGAAGG - Intronic
957270360 3:78022945-78022967 AGATATTTTAACATAAAAGGAGG + Intergenic
957338195 3:78859323-78859345 TGAATTTTTAAAAGAAATTATGG + Intronic
957379101 3:79401456-79401478 TAATATTTAATAATAAATGAGGG + Intronic
957617426 3:82548550-82548572 TGATATTGTCCAATACATGACGG - Intergenic
957677090 3:83381478-83381500 GGATATTTTTAAATAAATAGGGG + Intergenic
957836832 3:85605081-85605103 TGGTAATTTCAAATTAATGAGGG + Intronic
957885107 3:86277314-86277336 TGTGATTTTAAAATACATGCTGG + Intergenic
957911825 3:86628384-86628406 TAATATTTTCAAAAAAATGAAGG - Intergenic
958262257 3:91395432-91395454 TGTAATTTTACAATAAATTATGG - Intergenic
958468388 3:94486461-94486483 TTATTTTTAAAAATAAATGTTGG - Intergenic
958585969 3:96087938-96087960 TGATCATTTAAAATAGATAAAGG + Intergenic
958587362 3:96106489-96106511 TCATATTTTAAAATAATTGAAGG - Intergenic
958667209 3:97156673-97156695 TGATATTTTAAGTTATATGATGG + Intronic
958709938 3:97705792-97705814 AGATGATTTAAAATAAAAGAGGG - Intronic
959036114 3:101366248-101366270 CGATATTTTAAAACTCATGAAGG + Intronic
959060036 3:101608257-101608279 TATTATTTTAAAATAAATTTTGG + Intergenic
959134037 3:102394520-102394542 TCATTTTTTTAAATAAAGGAAGG - Intronic
959215236 3:103443740-103443762 TGTTTTTTTAAAAGAAATGGTGG + Intergenic
959230383 3:103642093-103642115 TTAAATTGTAAAATAAATTATGG + Intergenic
959294445 3:104518123-104518145 TGCTAAGTTAAATTAAATGATGG - Intergenic
959559613 3:107764554-107764576 TAATGTTTTAAATCAAATGATGG - Intronic
960001568 3:112736856-112736878 TTATAGTTTAAAAAAAAAGATGG - Intergenic
960100862 3:113742020-113742042 TGATTTTTTAAAAAAACTTATGG + Intronic
960180696 3:114573157-114573179 TGACATTCTAAAGAAAATGAGGG + Intronic
960267228 3:115634089-115634111 TGTTATTTTAAAATGAAAGTTGG + Intronic
960370314 3:116828999-116829021 GTATATTTCAAAATAACTGAAGG - Intronic
960393730 3:117110943-117110965 TGTTTTTTTAAAAAAAGTGACGG - Intronic
960826630 3:121792804-121792826 TGTTATTTAATAATAAATGGGGG - Intronic
961961472 3:130859736-130859758 AAAAATTTTAAAGTAAATGAAGG - Intronic
961972337 3:130982669-130982691 TGTAAGTGTAAAATAAATGAAGG - Intronic
962060753 3:131924528-131924550 AGATCTTTTAAAAAAAATGCTGG + Intronic
962482473 3:135809647-135809669 TGATTTTTTAAGACAAATCAGGG + Intergenic
962484552 3:135829814-135829836 TGATATTTCATAATACATTAGGG + Intergenic
962698454 3:137973869-137973891 AGTTATTTATAAATAAATGATGG + Intergenic
962746618 3:138401799-138401821 TCATAGTTTAAATAAAATGATGG - Intronic
963402900 3:144824084-144824106 TGAGATTTTCAAATTAAAGATGG - Intergenic
963426288 3:145130384-145130406 TGATCTTATTAAATAAATCAAGG + Intergenic
963429259 3:145176554-145176576 TGTTTTTTTAAAATAAAGGCAGG + Intergenic
963495935 3:146061008-146061030 AGAACTTTTAAAATAACTGATGG + Intergenic
963614620 3:147520185-147520207 GCATATTTTTAAATAACTGAAGG - Intergenic
963827892 3:149974149-149974171 TGAAATTTTTAAATAACTGATGG - Intronic
963924646 3:150938615-150938637 TGATATTTCAAAATAAGTATTGG + Intronic
964054011 3:152429757-152429779 CAAAAATTTAAAATAAATGAAGG + Intronic
964704085 3:159600012-159600034 TGATATATTCAAAGAACTGAAGG - Intronic
964938384 3:162123121-162123143 TTATTTTTTAAAACAAATAAAGG - Intergenic
965285175 3:166810701-166810723 GTATATTTTAAAATAACTTAAGG - Intergenic
965294601 3:166927451-166927473 AGATATTTTAAGATAAATTAGGG - Intergenic
965346166 3:167553482-167553504 GGATATCTAAAAATAAATTAAGG + Intronic
965376736 3:167934017-167934039 TCAGATTTTAAAATAATTGTGGG + Intergenic
965408416 3:168299675-168299697 TGATCATTTAAAAGAAAAGAGGG + Intergenic
965442872 3:168737819-168737841 TGATTTTATAAAATATATAATGG - Intergenic
965469165 3:169069154-169069176 TGAAATTTTTAAATAATTGTAGG + Intergenic
965868772 3:173239926-173239948 TGTTATTTTAAAACAAAAAAAGG + Intergenic
965966362 3:174495191-174495213 AGCCATTTTAGAATAAATGAAGG + Intronic
966043076 3:175515979-175516001 TTTTATTTTAAAATAAATAAAGG + Intronic
966116755 3:176473081-176473103 AGAAATTTTAAAATAAATACAGG - Intergenic
966148012 3:176833468-176833490 GTATATTTTAAAATAACTGAGGG + Intergenic
966241861 3:177763145-177763167 TGATATTTTCAACTTAATAATGG + Intergenic
966264688 3:178025409-178025431 TCATATTTCCAAATATATGAGGG + Intergenic
966327045 3:178768384-178768406 TGATGCTTTAAAATACTTGAGGG - Intronic
966411288 3:179648911-179648933 TGAATTTTTAATATAAATGTGGG - Intergenic
966766374 3:183466402-183466424 TGTTATTTTAAATTAAATGTAGG - Intergenic
966889991 3:184400080-184400102 TGAAATTTTGAAATAAATCATGG - Intronic
967244904 3:187476930-187476952 AGATTTTTTAAAAGAAAAGAGGG + Intergenic
967516450 3:190374701-190374723 TTCTTTTTGAAAATAAATGATGG - Intronic
967634327 3:191783313-191783335 TCATATCATGAAATAAATGAAGG + Intergenic
967660365 3:192100860-192100882 TCATATTTTTAAATAAATATGGG - Intergenic
967671707 3:192244036-192244058 TGTAATTTTAAAAAATATGATGG - Intronic
967676660 3:192306929-192306951 AAATATTTTTAAATAAATAAAGG - Intronic
970034096 4:11712431-11712453 TGATTTTTTAAAATAACCCATGG + Intergenic
970040451 4:11791316-11791338 TGCTATTCTAATATATATGATGG + Intergenic
970049999 4:11903511-11903533 TTATATGTAAAAATAAATAATGG + Intergenic
970607328 4:17692932-17692954 TAATATTTTTTAATAAAGGAAGG + Intronic
970879468 4:20911560-20911582 TCATCTTTTAAAATGAATAATGG - Intronic
971118228 4:23673405-23673427 TGATTTTTAAACAGAAATGATGG - Intergenic
971284650 4:25276104-25276126 AGATATTTTCAAATACCTGAAGG + Intronic
971673133 4:29590530-29590552 TCAGATTTTAGAATAAATAAGGG + Intergenic
971867003 4:32185331-32185353 TGATATTTTAATGTCAATCAGGG - Intergenic
971908497 4:32761660-32761682 TGATGTTTTAAATGAAATGAAGG + Intergenic
971939599 4:33198332-33198354 TGATATTTAAAAAGACGTGAAGG + Intergenic
972037300 4:34541909-34541931 TAATATTTATAAATAATTGAAGG + Intergenic
972710052 4:41586565-41586587 TTTTATTCTAAAATAAGTGAAGG + Intronic
972735532 4:41837440-41837462 TCAGATTTTAAAATAAATGTTGG - Intergenic
972911618 4:43823595-43823617 TGATAATTTAAAATATCTGGAGG - Intergenic
973342092 4:49016243-49016265 TGTTATTTTAAAACAAATTTAGG + Intronic
973948599 4:55987189-55987211 TGAGATTTTCAAATGACTGATGG + Intronic
974178156 4:58351204-58351226 TGATATTTGAAAATGAATGACGG + Intergenic
974310552 4:60203722-60203744 GGATATTTTAAAATATCAGAGGG + Intergenic
974405110 4:61457117-61457139 TGATTTTTTAAAAAACATAATGG - Intronic
974412109 4:61555255-61555277 TAATATTCTAAAGTATATGAAGG - Intronic
974457810 4:62150337-62150359 AGATTTTTTAAAATGAATTAAGG + Intergenic
974700669 4:65441366-65441388 TCATTTTTTCAAATAAATTATGG - Intronic
974701395 4:65453330-65453352 AGATATGTGAAAATAAATTAAGG + Intronic
974832610 4:67207896-67207918 TAATTTTTTAAAAGAAATAAAGG + Intergenic
974963689 4:68734842-68734864 TAAAATTATAAAATAAATAAGGG + Intergenic
975202790 4:71610736-71610758 TGATTTTTTAAAATAAATTTAGG - Intergenic
975256383 4:72240649-72240671 TGATCTCATAAAATAAATAATGG + Intergenic
975388814 4:73792177-73792199 AGATATTTTATAATAAAAAAAGG - Intergenic
975411250 4:74053742-74053764 AGAAATTTTCAAATAAATAAAGG + Intergenic
975464222 4:74691404-74691426 TAATCTTTTAAAATATATCATGG - Intergenic
975865615 4:78720897-78720919 TTATATTCTAAAATAATGGAAGG + Intergenic
976030568 4:80748150-80748172 AGAAATTTGAAAATAAATAAGGG - Intronic
976492089 4:85682976-85682998 TGGTACATTACAATAAATGAGGG + Intronic
976559660 4:86487006-86487028 TGATATTTTCAAATATAAGACGG - Intronic
976596024 4:86895598-86895620 TATTATTTTAAAATACATGTGGG - Intronic
976867856 4:89752498-89752520 TCAAATTTTAACATAAATGTGGG - Intronic
976880070 4:89910709-89910731 TGATTTAGTGAAATAAATGAGGG + Intronic
976950544 4:90824371-90824393 TGATTTTTGAAAAAAATTGAAGG + Intronic
976968108 4:91070278-91070300 TAATGTTTTAAAATTAAAGAAGG - Intronic
977007294 4:91585041-91585063 TGAAATTTTAAATCAAATGAAGG - Intronic
977126766 4:93179008-93179030 TGATATATGAAATTAAATGATGG + Intronic
977349253 4:95859928-95859950 TGAAATTTCAAAAGCAATGATGG - Intergenic
977736902 4:100427658-100427680 TGAAATCTCCAAATAAATGAGGG - Intronic
977999914 4:103545483-103545505 AAATATTTTTAAATAAATGTTGG - Intergenic
978178304 4:105761633-105761655 TTATATTATGAAAAAAATGATGG - Intronic
978389636 4:108211895-108211917 TGATGTTTAATAATACATGAAGG - Intergenic
978468292 4:109032587-109032609 TTATCTGTTAAAATAAATTAAGG - Intronic
978570408 4:110130818-110130840 TGATATCCTAAAATGACTGATGG - Intronic
978661064 4:111126869-111126891 TGATATTTTAAGTTAAATTCAGG + Intergenic
978826543 4:113031183-113031205 TTTTAATTTAAAATAAATGGAGG + Intronic
978927962 4:114273187-114273209 TAATTTTTTAAAAAAAATTATGG + Intergenic
979067028 4:116150492-116150514 TTACCTTTTAGAATAAATGAGGG - Intergenic
979209580 4:118083122-118083144 TGGTGTTTTAAAATAATTCATGG - Intronic
979243690 4:118473666-118473688 ACAAATTTTAAAATAAATAATGG - Intergenic
979422190 4:120518446-120518468 TTACATTTTAAAAGAAATTAAGG + Intergenic
979442715 4:120770327-120770349 TCATATTTAAAAATAAATAGGGG - Intronic
979571820 4:122236070-122236092 TAATATTTTTAAATTAATTAAGG - Intronic
979614300 4:122724968-122724990 GGATATTTAAAAAAAAATCATGG - Intergenic
979630383 4:122894862-122894884 TTATGTTTGAAAATAAATTATGG + Exonic
979644263 4:123049390-123049412 TAATATTTCAAAAAAAATGAAGG - Intronic
979879481 4:125937073-125937095 GTATATTTTAAAATAACTTAAGG + Intergenic
979907319 4:126311617-126311639 ATATATTTTAAAATAATTTAGGG + Intergenic
980013966 4:127627358-127627380 TCATATTTTAAAAATAATTATGG + Intronic
980225094 4:129973009-129973031 TTCTACTTTAAAATTAATGATGG - Intergenic
980226773 4:129997721-129997743 TGATATTTAAAAATAAAAATAGG + Intergenic
980345826 4:131617391-131617413 TGATTTGTTTTAATAAATGAAGG - Intergenic
980367446 4:131822839-131822861 TTATATTTTAATAGAAATCAGGG + Intergenic
980367518 4:131823707-131823729 AGACATTTAAAAAGAAATGAAGG + Intergenic
980521699 4:133944883-133944905 TGGTACTTGAAATTAAATGATGG - Intergenic
980599996 4:135010468-135010490 TCATTTTTTCCAATAAATGAAGG + Intergenic
981018142 4:139996500-139996522 TGATATTTCATAATAATTAAAGG - Intronic
981052134 4:140319673-140319695 TAAAATTCTAAAATAAATAATGG + Intronic
981735280 4:147943155-147943177 TGATGTTTTAAACTAAAGTAGGG - Intronic
981819628 4:148870873-148870895 TGCAATTCTAAAATAAAGGAAGG + Intergenic
981849800 4:149216941-149216963 TGAGAGTTTAAAATAAAGTAAGG + Intergenic
981900573 4:149857174-149857196 TGATATATAAAAAGAAATGATGG - Intergenic
981982639 4:150812891-150812913 TGATATTTTAACATACAAGAAGG + Intronic
982286520 4:153741728-153741750 TGAAATTTTAAAAAATAGGAAGG - Intronic
982422726 4:155215807-155215829 TGAAATTAGAAATTAAATGATGG - Exonic
982586854 4:157252579-157252601 TGATATTGTATAATGAATTATGG + Intronic
982924922 4:161324111-161324133 CTATATTTTAAAATAAAATATGG + Intergenic
983036344 4:162871686-162871708 TGATATTTTAAAAGAAGAGAAGG - Intergenic
983093121 4:163529492-163529514 TTACATTTTAAAATAAATGAGGG - Intronic
983175079 4:164578803-164578825 TGATATTTTGATAGAAATAAGGG + Intergenic
983207694 4:164928287-164928309 TGATATTCTAAGATGAAAGATGG - Intergenic
983211093 4:164958657-164958679 TGATATTCTAAGATGAAAGATGG + Exonic
983296094 4:165871197-165871219 TAATATTTAAAAATAAATCAGGG + Intergenic
983297057 4:165879557-165879579 TAATATTCTAAAATGAATGATGG - Intronic
983352725 4:166613782-166613804 TTATATTTTTATATTAATGAGGG + Intergenic
983726125 4:170928665-170928687 TGAGGTTTTAAACCAAATGATGG - Intergenic
983777288 4:171623671-171623693 TGATGTTATAAAATAATTGTAGG + Intergenic
983895444 4:173076469-173076491 TTATAATTTAAAAGAAATGATGG - Intergenic
983905810 4:173181603-173181625 TTCTATTTTAAAATAAATGTAGG + Intronic
984027974 4:174568083-174568105 TAATATTTTCAACTTAATGATGG + Intergenic
984043109 4:174762183-174762205 TCAAATTTTAAAATAAATAATGG + Intronic
984079539 4:175228904-175228926 TCATATTTCTAAATAAATGAAGG - Intergenic
984217653 4:176934239-176934261 TTATATTATAAAATAAATTTTGG + Intergenic
984233876 4:177133157-177133179 TGACATTGTAAAGTAAATTACGG - Intergenic
984330902 4:178316533-178316555 TTCTGTATTAAAATAAATGAGGG - Intergenic
984824326 4:183910934-183910956 TGTTATTTTAAGAGACATGAGGG + Intronic
984993781 4:185408060-185408082 TTATATTTTTAAATACATCAAGG - Exonic
985028577 4:185764796-185764818 TTCTATTTTAAGATAAATGATGG - Intronic
985342758 4:188972884-188972906 TGCTGTTTCAAATTAAATGAGGG + Intergenic
985481963 5:118574-118596 TAATATTTTAAAGTTCATGAGGG + Intergenic
986036375 5:3944227-3944249 TCATATCTGAAGATAAATGATGG - Intergenic
986293459 5:6418382-6418404 GGATATTTTAAGATTCATGAAGG + Intergenic
986458606 5:7945304-7945326 TGATATTATAAAAGCAATGTAGG - Intergenic
986508519 5:8478202-8478224 TGCTCTTTTAAAAAAAATCAAGG - Intergenic
987091304 5:14510167-14510189 TAATTTTTTAAAATAACTGATGG - Exonic
987549767 5:19363896-19363918 AGAAATTTTAAAATATATGTAGG + Intergenic
987582821 5:19818914-19818936 AGATCTTTTAAAATAATTGAAGG - Intronic
987589478 5:19904847-19904869 TGATATTTTTGAAGAAATTAAGG - Intronic
987599970 5:20055146-20055168 TACTATTATAAAATATATGAGGG + Intronic
987826055 5:23032004-23032026 TAACTTTTTAAAATAAATAATGG + Intergenic
987958306 5:24768849-24768871 TTGTATTTTAAAGTAAATAAAGG - Intergenic
988002809 5:25370641-25370663 TCAAATTTTAAAAAAAATCAAGG + Intergenic
988075524 5:26349138-26349160 TGATGTTTCAAAAAAAATTAAGG - Intergenic
988089111 5:26512796-26512818 TAATATTTAAAAAATAATGAGGG + Intergenic
988244497 5:28661755-28661777 TTACATTTTAACATAAAAGAAGG - Intergenic
988286465 5:29224718-29224740 TAATATTTTAAAATATCTGTTGG - Intergenic
988463273 5:31461843-31461865 TGATGTTTTAAGTTCAATGAAGG + Intronic
988533556 5:32046165-32046187 TGTTATTTTAAAATAATTTAAGG - Intronic
988543891 5:32138555-32138577 TTATATTTTAAAAGAAAAAAAGG + Intronic
988574246 5:32404618-32404640 TGCTTATTTAAAATACATGAGGG + Intronic
988691872 5:33580586-33580608 TAATATTTTAAAACAGAAGATGG + Intronic
988872860 5:35410376-35410398 TGATTTTTTAAAAATAATAAAGG + Intergenic
988938064 5:36110077-36110099 TGATAATTTAAAAGAAATACTGG - Intronic
988938126 5:36111125-36111147 TTGTCTTTTAAAATAAATGAAGG - Intronic
988996879 5:36723448-36723470 TCATTTTTTAAAAAAAATAAGGG + Intergenic
989025776 5:37066315-37066337 TGAAATTGGCAAATAAATGAAGG + Exonic
989316976 5:40092737-40092759 AGATTTTTTAAAAGAAAAGAGGG + Intergenic
989761032 5:45016905-45016927 TAATACTTGATAATAAATGATGG + Intergenic
989795094 5:45459287-45459309 TTATATTTGAACATACATGACGG + Intronic
989966638 5:50473035-50473057 TGATATTCTGAAATAAAGGATGG - Intergenic
990000439 5:50885666-50885688 TAATATTTTAAAAAAACTGTTGG + Intergenic
990096100 5:52115559-52115581 TGATATTTTAAACCAAATATGGG - Intergenic
990173112 5:53077374-53077396 TTATATTGTAAAAAAAATGATGG + Intronic
990204929 5:53418336-53418358 TGAAATTTAAAAATTAATTATGG - Intergenic
990422699 5:55652537-55652559 TTAAATTTTGAAAAAAATGAAGG + Exonic
990539835 5:56761123-56761145 TGAATTTTAAGAATAAATGAAGG + Intergenic
990582601 5:57179953-57179975 TGATATGTTAAAATTGAGGAAGG + Intronic
990647750 5:57863701-57863723 TGTTTTATTAAAATAAATAAAGG + Intergenic
991098837 5:62769479-62769501 TGATTTTTGAAAAAAAATGCAGG + Intergenic
991226264 5:64276688-64276710 AAAAATTTAAAAATAAATGAGGG + Intronic
991287286 5:64991876-64991898 AGTGGTTTTAAAATAAATGAAGG - Intronic
991423128 5:66461984-66462006 AGTTATATTAAAAAAAATGAAGG + Intergenic
991460539 5:66853952-66853974 TCATAGTTTAAAATAAGTTAGGG + Intronic
991933356 5:71778006-71778028 TGAAATTATAAAATAAAAAAAGG + Intergenic
992070350 5:73142528-73142550 TTATATTATACAATAAATCAAGG - Intergenic
992129940 5:73682160-73682182 TGATATTTTAAATAAAATTGAGG + Intronic
992246259 5:74826873-74826895 GGATATATTAAACTAAATGCAGG - Intronic
992535111 5:77693115-77693137 CTATATTTTAAAATAATTAATGG - Intronic
992556966 5:77913463-77913485 TTCTATTTTAAACTAAATAATGG + Intergenic
992637721 5:78740966-78740988 TGATTCTTTCAAATAGATGATGG - Intronic
992732530 5:79687838-79687860 AGAAATTTTTAATTAAATGATGG + Intergenic
992987565 5:82248878-82248900 GAATATATTAAAATGAATGATGG - Intronic
993026006 5:82647409-82647431 AGCTTTCTTAAAATAAATGAAGG + Intergenic
993135306 5:83953550-83953572 TGATATTTAATAATAATTAAAGG - Intronic
993446816 5:88023187-88023209 TTTTTTTTTAAAAAAAATGAAGG - Intergenic
993736647 5:91484699-91484721 TTATATTATCAAATAAATAAGGG + Intergenic
993859025 5:93111938-93111960 GGATATTTTACATTAAATGAGGG - Intergenic
993870615 5:93249772-93249794 TGATATATTCACATAAATGATGG + Intergenic
994045150 5:95300083-95300105 TTTTGTTTGAAAATAAATGATGG + Intergenic
994123654 5:96146197-96146219 TGATGTTTGAAAAAAAATGAGGG + Intergenic
994147886 5:96414806-96414828 TTAATTTTTAAAAAAAATGAAGG - Intronic
994212001 5:97097392-97097414 TGATGTGTTAAAATAAAACAAGG + Intronic
994260191 5:97649205-97649227 AGACATTTAAAAATAAAAGAAGG + Intergenic
994396369 5:99228665-99228687 GGATATTTTAAAAAATATCATGG + Intergenic
994540074 5:101083683-101083705 TGAATTTTTCAAGTAAATGAGGG - Intergenic
994541495 5:101104272-101104294 TTACAATTTAAAATAAATAATGG - Intergenic
994587273 5:101725060-101725082 TGATTTTAAAAAATAAAGGATGG + Intergenic
995504507 5:112845765-112845787 TGATCTTTTAAAACAAATCAGGG - Exonic
995701802 5:114943925-114943947 TTAAAATTCAAAATAAATGAAGG - Intergenic
995928468 5:117405820-117405842 TGATTTTTAAAATGAAATGATGG + Intergenic
995939299 5:117560044-117560066 AGATATTTGAAAATAATTGTTGG - Intergenic
995941849 5:117595410-117595432 TTATATTTTACATTAAATGAAGG + Intergenic
996063989 5:119061648-119061670 CGAAATGTTAAAATATATGATGG - Intronic
996283879 5:121766033-121766055 TGAAATTATAAAATATATCAGGG + Intergenic
996307407 5:122064568-122064590 TTATTTTTAAAAATAAATTATGG + Exonic
996344000 5:122470314-122470336 TTGAATTTTAAAATATATGATGG - Intergenic
996385738 5:122908490-122908512 AGATGTTTTAAAATAACTTAAGG + Intronic
996443608 5:123518767-123518789 GGATATTTTAAAAAAATTGTGGG + Intronic
996628017 5:125593779-125593801 AGATATTTTAAATTTAATGAGGG + Intergenic
996693250 5:126364361-126364383 TGAAATATTATAATTAATGATGG + Intronic
996812947 5:127540701-127540723 TGACTTTTTAACAGAAATGACGG - Intronic
996972727 5:129392152-129392174 TAATATTTTAAATTCAAAGAAGG + Intergenic
997397253 5:133572439-133572461 TCATAAGGTAAAATAAATGAAGG + Intronic
998201105 5:140122256-140122278 TGATAGTTTAAAAAGAATAATGG - Exonic
998210268 5:140191786-140191808 TGTGATTTAAAAATAAATAATGG + Intronic
998713776 5:144857194-144857216 TGATGTGTTCACATAAATGAGGG + Intergenic
998867214 5:146517465-146517487 TGAAATTTTAAAATAAGCAATGG + Intergenic
998899449 5:146837374-146837396 AGATATTTTCAACTTAATGATGG + Intronic
998947171 5:147352226-147352248 TTATTTTTAAAAATAAATAAAGG + Intronic
999018334 5:148134084-148134106 TAATATTTTAAAATATTTAATGG + Intronic
999046437 5:148474621-148474643 AGATATTTTACAATACGTGAGGG - Intronic
999884370 5:155904519-155904541 TTTTATTTTAAAATATATAATGG + Intronic
1000152388 5:158516194-158516216 TGATATTCTAAAATAAAAAGAGG + Intergenic
1000501820 5:162061432-162061454 AGACATTTTCAAATAAATGAAGG - Intergenic
1000639195 5:163681188-163681210 TGATATTTAAAAAGAAAAGAAGG - Intergenic
1000789706 5:165590376-165590398 TGATATTTAAGAGTAAGTGATGG - Intergenic
1001466029 5:171967086-171967108 TAAAATTTGAAAATAAATCAGGG - Intronic
1002772522 6:301906-301928 TTATCTTTAAAATTAAATGAGGG - Intronic
1002816054 6:681512-681534 TAATATTTTAAAATTTATTAGGG - Intronic
1003680835 6:8253582-8253604 AGATATTTAAAAATGAATAATGG + Intergenic
1003728763 6:8796288-8796310 TGTTATTTAAAAGTTAATGAAGG - Intergenic
1003740181 6:8928140-8928162 TGACTTTTTAAAATAAAATAGGG - Intergenic
1003771665 6:9310845-9310867 TGAATTTTTAATATAAGTGATGG + Intergenic
1003849939 6:10211157-10211179 GGACATTTTATTATAAATGAAGG - Intronic
1004539860 6:16539607-16539629 TAATAGTTTTAAAGAAATGATGG - Intronic
1005193021 6:23248811-23248833 TGATTTTTGCAAATAAATCACGG - Intergenic
1005395131 6:25374404-25374426 TGATTTTTTAAAATTTATCAAGG + Intronic
1005452207 6:25984361-25984383 TGAGATTTTAAAATATTTCAAGG - Exonic
1005602322 6:27440487-27440509 TGCTTTTTTAAATTAATTGAGGG + Intergenic
1005711240 6:28504598-28504620 TAATATATTAAAATACATAATGG - Intronic
1005725568 6:28644284-28644306 TGTAAATGTAAAATAAATGATGG + Intergenic
1006064352 6:31452835-31452857 TAATAAATTAAAATAAATGAAGG - Intergenic
1006574518 6:35034930-35034952 GGATATTTTACAAAAAGTGAGGG + Intronic
1007279066 6:40696944-40696966 AGATAATTTAAATTAAAAGATGG + Intergenic
1007518702 6:42434454-42434476 TGACTTTTTAACAGAAATGAAGG + Intronic
1007888850 6:45265569-45265591 TGATATATTTAAATACATTAAGG + Intronic
1007959778 6:45948195-45948217 TAAAACTTTAAAATAAATGCAGG + Intronic
1008001581 6:46365740-46365762 TGATGATTTACAATAAAAGAGGG - Intronic
1008039751 6:46784560-46784582 TGTTTTTTTAAAAAAAATAAAGG - Intergenic
1008376450 6:50797109-50797131 GCATATTTTAAAATAACTAAGGG + Intergenic
1008558498 6:52699569-52699591 AAATATTTTTAAATAAATAAGGG - Intergenic
1008706403 6:54165796-54165818 TCATATGTTGAAATATATGAAGG + Intronic
1008809471 6:55477531-55477553 TAATATATATAAATAAATGATGG + Intronic
1008832377 6:55781192-55781214 TACTTTCTTAAAATAAATGAGGG - Intronic
1008852465 6:56039451-56039473 TGATTTTTTGAAAGATATGAAGG - Intergenic
1009266815 6:61566362-61566384 ATGTATTTTAAAATAACTGAAGG + Intergenic
1009318860 6:62259455-62259477 TGAAATTATAAATTGAATGATGG - Intronic
1009398192 6:63227374-63227396 TTCTATTTTAAAATAAAGGGTGG + Intergenic
1009507864 6:64507744-64507766 TGGAATTTTTAAATAAATGTGGG - Intronic
1009521902 6:64693739-64693761 TGATTTTTTAAAAAAATTAATGG - Intronic
1009555960 6:65167300-65167322 TCATCTTTTAAAATAACTGTTGG - Intronic
1009560480 6:65234970-65234992 TGATGTGTTAAAATAACTAAAGG + Intronic
1009620550 6:66070124-66070146 TGACATTTGAAAATAAATTGAGG + Intergenic
1009646404 6:66408400-66408422 TGATATTTCAACATAAATATAGG - Intergenic
1009757155 6:67955103-67955125 TGAAAATGTAAAAGAAATGAAGG - Intergenic
1009813719 6:68703503-68703525 TGATTTTGTAAATTAAATTATGG + Intronic
1010095750 6:72042548-72042570 AGAAATTTAAAAATAAATTACGG - Intronic
1010309160 6:74363020-74363042 TTATATTTTAAAATTAACGTAGG + Intergenic
1010332237 6:74636829-74636851 TGTTATTTTAGAAAAAATCAGGG - Intergenic
1010561393 6:77355765-77355787 AGATATTATCAAGTAAATGAAGG + Intergenic
1010724232 6:79314472-79314494 TAAAATTTTAAAATTAATAAAGG - Intergenic
1010880421 6:81162111-81162133 TGAGTTTTTAAAGTGAATGAAGG - Intergenic
1011000848 6:82586851-82586873 ATATATTTTAAAATAATTTAGGG - Intergenic
1011057960 6:83226753-83226775 TGATATTTTAAAGTCTTTGAAGG + Intronic
1011068022 6:83350226-83350248 TAAGATTTTTAAATAAAAGAGGG + Intronic
1011297050 6:85837629-85837651 TGATATTTTAAAATGTGTTAAGG - Intergenic
1011472410 6:87721218-87721240 TACTATTTTAAAATTAAAGAAGG + Intergenic
1011502868 6:88010440-88010462 AGATATTTTATAATAAATATGGG - Intergenic
1011681583 6:89788675-89788697 TGATTTTCTAAAATAAAAAATGG - Intronic
1011808870 6:91106125-91106147 TTATATTTTATTAAAAATGAAGG + Intergenic
1011888009 6:92121776-92121798 TGATATTTTATAATGACTGCTGG + Intergenic
1011912797 6:92463981-92464003 TGATATTTTAATAAATATGAAGG - Intergenic
1012021957 6:93933993-93934015 TCAGAGTTTAAAATATATGATGG - Intergenic
1012153699 6:95789663-95789685 TGCTATTTTAGGATAAATGTAGG + Intergenic
1012378145 6:98587235-98587257 TGATCTTTTAACAGAAGTGAAGG + Intergenic
1012681661 6:102190334-102190356 TTCATTTTTAAAATAAATGAAGG - Intergenic
1012700003 6:102444085-102444107 TGAGATTAAAAAATACATGAAGG + Intergenic
1012726125 6:102812870-102812892 TGACATTTTAAAAAAATTGCAGG + Intergenic
1012741766 6:103025492-103025514 CTATATTTTAAAATAAATACAGG + Intergenic
1012756986 6:103244416-103244438 TGAAAATTTAAAAGAAAAGAGGG + Intergenic
1012759123 6:103275320-103275342 TGCTCTTTAAAAATAAATTAAGG - Intergenic
1012798784 6:103798511-103798533 TCATTTTTTAAAATAAAGGTGGG - Intergenic
1012821161 6:104086470-104086492 TGACATTGTAGACTAAATGATGG - Intergenic
1013090515 6:106896430-106896452 TGATATTTTAAAAGAGATGCTGG + Intergenic
1013139159 6:107313653-107313675 TCATATTATAAAACAAATGTAGG - Intronic
1013169322 6:107621984-107622006 TGTTATTTTAAAAAAAGAGAGGG - Intronic
1013911742 6:115283552-115283574 TGACATTTTTAATTAAAGGAAGG + Intergenic
1014138161 6:117911186-117911208 TAATTTTTTAAAATAATTAATGG + Intronic
1014155495 6:118104637-118104659 TGATTTTTTAAAGTAAATAAAGG + Intronic
1014364022 6:120518020-120518042 TAAAATTTTAAAATAATTTAAGG + Intergenic
1014420431 6:121237096-121237118 AGAAATTTTAAAATAAACAAAGG - Intronic
1014599471 6:123391618-123391640 TGGAATTTTAAAATAATTTAAGG - Intronic
1014633384 6:123814770-123814792 TGAAATATTAAATTAAAAGATGG - Intronic
1014662995 6:124197166-124197188 CAGTATTTTAAAATAAAAGATGG - Intronic
1014922072 6:127224872-127224894 TCATCTTTTAAAATTAATAATGG + Intergenic
1014936806 6:127395016-127395038 TTATATTATAAAATATAAGAGGG - Intergenic
1014976821 6:127896811-127896833 TTATATTTTAAAATCAATCCAGG + Intronic
1015080243 6:129215551-129215573 TGATATCATAGAATGAATGATGG + Intronic
1015146499 6:129993489-129993511 TTTTTTTTTAACATAAATGAAGG + Intergenic
1015259146 6:131214828-131214850 TAATATTTTAAAGTAAATAATGG + Intronic
1015297497 6:131614497-131614519 TGATATTTTAAACAAAATAGTGG - Intronic
1015324976 6:131914714-131914736 AGATATTTTAAAGTTATTGATGG - Intergenic
1015359161 6:132317086-132317108 TGACATTTCATCATAAATGATGG + Intronic
1015428715 6:133103944-133103966 TAATAGGTTAAAATAAAAGAAGG + Intergenic
1015547644 6:134377647-134377669 TAATTTTCTAATATAAATGAGGG + Intergenic
1015876038 6:137823684-137823706 TGACATCCCAAAATAAATGAAGG - Intergenic
1016159040 6:140853224-140853246 AGATAAAGTAAAATAAATGATGG - Intergenic
1016211593 6:141541811-141541833 GGATCTTTTGAAATAAGTGAAGG + Intergenic
1016223380 6:141704104-141704126 TAATATTTTAAAACTATTGAAGG - Intergenic
1016399040 6:143658237-143658259 TGTGATTTTAAAATAAATTTGGG + Intronic
1016597903 6:145821880-145821902 TGATATACTCAAATAAATGTTGG + Intergenic
1016723926 6:147337534-147337556 TCATATTTTCAAATACAAGAAGG - Intronic
1017057607 6:150452333-150452355 TGATATTTTGAAATGAAAAAAGG + Intergenic
1017158819 6:151346269-151346291 TGTAATTTTAAAATCACTGAGGG - Intronic
1017230875 6:152072365-152072387 TGATATTTTAAGAAAGAGGAGGG + Intronic
1017366458 6:153646998-153647020 AGTTATTTAAAAATAAATTATGG + Intergenic
1017418846 6:154251377-154251399 TGGTTTTTTAAAATAAGAGATGG - Intronic
1017659800 6:156662659-156662681 TGAATTTTTAATATAAATGCAGG + Intergenic
1017739566 6:157394892-157394914 TGAGAATTTTAAAAAAATGATGG + Intronic
1017831161 6:158130242-158130264 AGAAATTTAAAAATAAGTGAAGG + Intronic
1018797107 6:167194778-167194800 TGATATTTCAAATTCAGTGAGGG - Intronic
1018819234 6:167360310-167360332 TGATATTTCAAATTCAGTGAGGG + Intronic
1019677952 7:2326747-2326769 TAATATTTCAAAATAAATCAAGG + Intronic
1020368907 7:7411813-7411835 GGATAGGATAAAATAAATGACGG + Intronic
1020408237 7:7861415-7861437 TTATATTTCAAAATAGAAGATGG - Intronic
1020466540 7:8486038-8486060 TGGGATTTTAAAACATATGATGG + Intronic
1020718390 7:11709017-11709039 TCATGTTTCAAAATAAATCAAGG - Intronic
1020720317 7:11736638-11736660 TTACATTTCAACATAAATGATGG - Intronic
1020754063 7:12179066-12179088 TGAGATAGTAAAAAAAATGAGGG + Intergenic
1020866293 7:13568290-13568312 AAATATTTTAAAATATAAGATGG - Intergenic
1021680959 7:23131403-23131425 TGATCTTTGAAAATGAATCAAGG + Intronic
1021896691 7:25243223-25243245 AGGTTTTTTAAAATGAATGAAGG - Intergenic
1021951213 7:25776796-25776818 TAAGATTTAAAAAAAAATGAAGG - Intergenic
1022564301 7:31382151-31382173 AGATTTTTCAGAATAAATGAAGG + Intergenic
1022791852 7:33697133-33697155 TGAGAATTAAAATTAAATGATGG + Intergenic
1022865268 7:34411431-34411453 TGATATTATTAGATATATGAGGG - Intergenic
1022991361 7:35711192-35711214 TTAAATATTCAAATAAATGAGGG + Intergenic
1023097640 7:36678375-36678397 AGATATTCCAAATTAAATGAAGG + Intronic
1023301685 7:38779590-38779612 AGACATTTTAGAATAAATGGTGG + Intronic
1023480424 7:40627937-40627959 TGTTATATTCAAATAAATGCAGG - Intronic
1023570775 7:41569157-41569179 TGTTGATTTAAAATAAATGATGG - Intergenic
1023571290 7:41574983-41575005 CTCTATTTTAAAATAAATGTGGG - Intergenic
1023629799 7:42152852-42152874 GCATATTGTAAAATAAAGGAAGG + Intronic
1023668426 7:42550869-42550891 TCATATTTTAAAACAAAAAAAGG - Intergenic
1023735958 7:43236034-43236056 TGAGAAATTAAAATTAATGAAGG + Intronic
1024187857 7:46971678-46971700 TTATATTTTACAATAACTTATGG - Intergenic
1024337114 7:48220260-48220282 TGATATTTGTTAATAAATGGGGG + Intronic
1024376685 7:48646817-48646839 ATATATTTTAAAATAAACTACGG - Exonic
1024798208 7:53044576-53044598 TTATATTTTAAAATAATTGTAGG + Intergenic
1024883969 7:54120996-54121018 TGATATTTGAACATCATTGAAGG + Intergenic
1025321708 7:58101384-58101406 AAATATTCTAAAATAAGTGACGG - Intergenic
1025713752 7:63934058-63934080 GCATATTTTTAAATAAATAAGGG + Intergenic
1026002886 7:66576205-66576227 TGATGTTAAAAATTAAATGATGG - Intergenic
1026579505 7:71602162-71602184 TGATTTTTTAAAATTAGGGATGG - Intronic
1026644788 7:72158190-72158212 TGATAATGTAAACTACATGACGG - Intronic
1026684350 7:72495380-72495402 TGCTATTTTTAACTAACTGAAGG - Intergenic
1027561289 7:79733953-79733975 GGAAATTTAAAAATAAATGGAGG + Intergenic
1027721383 7:81746244-81746266 TAATGTATTAATATAAATGAAGG - Intronic
1027832475 7:83197300-83197322 TGTTATTTTAATACAAAGGAAGG - Intergenic
1028060608 7:86309717-86309739 TTATATATTGACATAAATGATGG - Intergenic
1028128708 7:87145378-87145400 TTAAATTTTCAAATAAATAAAGG + Intergenic
1028166781 7:87547348-87547370 TTATATTTTAAAATACTTTAGGG - Intronic
1028292177 7:89078865-89078887 TGATATTATAAGATATATAAAGG + Intronic
1028303598 7:89233530-89233552 CCATATTATGAAATAAATGAAGG + Intronic
1028489547 7:91395519-91395541 TGATTTTTTTAAATAAAAAATGG + Intergenic
1028498894 7:91496110-91496132 TGTAATTTTGAAATAAAAGAAGG - Intergenic
1028935918 7:96463879-96463901 TTATTTTTAAAAATAAATAAAGG + Intergenic
1029049106 7:97665125-97665147 TGATTTTTTAAATTAATTAATGG - Intergenic
1030239818 7:107309948-107309970 TTATATTTTTAAAAAACTGAAGG - Intronic
1030354521 7:108527275-108527297 TGATTTTTTTAAATCAAGGAGGG + Intronic
1030378346 7:108780808-108780830 TGAAATGATAAAATTAATGAGGG + Intergenic
1030616690 7:111744672-111744694 AGATCTTTAAAAATCAATGAAGG + Intronic
1030889141 7:114976714-114976736 GCATATTTTAAGAAAAATGATGG - Intronic
1030912479 7:115268517-115268539 TTATATTTAAAAACAGATGAAGG + Intergenic
1030961959 7:115934622-115934644 TAGTATTTTAAAATAAAGTATGG + Intergenic
1031045248 7:116880126-116880148 TTTTTTTTTAAAGTAAATGAAGG + Intronic
1031166730 7:118238202-118238224 TTGTATTTTAAAATTAATGATGG - Intronic
1031317933 7:120280660-120280682 TATTAATTTTAAATAAATGATGG - Intronic
1031327333 7:120418080-120418102 TGACCTTTTATATTAAATGAAGG - Intronic
1031523973 7:122801493-122801515 AGATATTTTTTATTAAATGAAGG - Intronic
1031588755 7:123564827-123564849 TGATATTTTCAATTTTATGATGG + Intergenic
1031650862 7:124288109-124288131 TGGTATTTTAAAATAACTTTTGG + Intergenic
1031798475 7:126210078-126210100 TGATATAAACAAATAAATGATGG + Intergenic
1032551608 7:132789649-132789671 TGATAATTTAAGAGAAATGATGG + Intronic
1032959872 7:137019182-137019204 TGATATTCTAAAAATAATGCAGG - Exonic
1033722012 7:144070412-144070434 TGAAATTGTATAATAAATAAAGG - Intergenic
1033824618 7:145174323-145174345 TGATTTGTTCAAAAAAATGAAGG + Intergenic
1034438055 7:151072589-151072611 TGCTGTTTGAAAATAAATTAAGG - Intronic
1036112870 8:5924069-5924091 TGATTTCTTAACAGAAATGATGG + Intergenic
1036194614 8:6702939-6702961 TGATATTTTAAAATGATGAATGG - Intergenic
1037004606 8:13761203-13761225 AGATATTTAAAAAGAAATGTTGG + Intergenic
1037074089 8:14691279-14691301 TGAAATTTTAAATAAAATGTTGG + Intronic
1037079091 8:14760827-14760849 TGAAATTCTAAATTAATTGAGGG + Intronic
1037233082 8:16683968-16683990 AGATCTTTTAAAATAATTGGTGG - Intergenic
1038087487 8:24216174-24216196 TCACATTCTAAAATGAATGAAGG + Intergenic
1038112147 8:24511493-24511515 TGATATTTGAGAATAATTGCTGG - Intronic
1038353410 8:26803202-26803224 TTATATTGTAGAATAACTGAGGG + Intronic
1038614845 8:29083867-29083889 TGAAAGTTTAAGAAAAATGAAGG + Intronic
1038916121 8:32025467-32025489 TGATATTTTAATTTAACAGAAGG + Intronic
1039200481 8:35086480-35086502 TGAGAGTTTAAAATAAAGAATGG - Intergenic
1039561869 8:38518890-38518912 TGTAAATTTAAAATAAATTATGG - Intronic
1039691456 8:39869255-39869277 TAATATTAGAAAATGAATGAAGG + Intergenic
1040034554 8:42857717-42857739 TCACATTTTAAAAATAATGAAGG + Intronic
1040035077 8:42862138-42862160 AGATATTTGAAGATAAAAGAAGG + Intronic
1040624319 8:49128954-49128976 TCATCTTTTAAAATGCATGAAGG + Intergenic
1041434122 8:57818586-57818608 TATTATTTTAAAATAAATCCTGG + Intergenic
1041439635 8:57880659-57880681 ACATAATTTAAAATAAAAGAAGG + Intergenic
1041529369 8:58846225-58846247 TTTTTTTTTAAAATAAATAAGGG + Intronic
1041608137 8:59809642-59809664 AGATATGAGAAAATAAATGATGG - Intergenic
1041823026 8:62061601-62061623 TGAAATTTTACAATTAATGATGG + Intergenic
1042135614 8:65630324-65630346 AAATGTTTTAAAATAAATCAGGG + Intronic
1042210906 8:66379363-66379385 TGATATTTTAAAATTTTTAAAGG + Intergenic
1042320476 8:67469990-67470012 TCATATTTTTGAATAAATGGAGG + Intronic
1042323492 8:67503633-67503655 TGGTATTTTTAAATAACTAATGG - Intronic
1042358380 8:67854619-67854641 GGATTTTTTAAAATAATTAATGG + Intergenic
1042464623 8:69113661-69113683 TGTTAGTTTAATATCAATGATGG - Intergenic
1042467635 8:69146317-69146339 TTTCATTTTAAAATAAGTGATGG - Intergenic
1042494723 8:69443040-69443062 TGACATTTTAAATTTAGTGAGGG + Intergenic
1042523437 8:69739003-69739025 GGAAATGTTTAAATAAATGATGG + Intronic
1043028897 8:75106500-75106522 TAATGCTTTAAAAGAAATGATGG - Intergenic
1043197555 8:77316838-77316860 TTACATTTTAAAATAACTAAAGG - Intergenic
1043326795 8:79062214-79062236 TGCTATTTTTAAATTAAAGAGGG - Intergenic
1043350822 8:79359263-79359285 TGATATTAGATAATAAATTATGG + Intergenic
1043624539 8:82239744-82239766 TAAAATTTTAAAACAAATGCAGG - Intergenic
1043722724 8:83566166-83566188 TTATATTTTTAAACAAATAAAGG + Intergenic
1043773713 8:84237645-84237667 AGATAATTTAAAATAAATAGAGG + Intronic
1044013815 8:87026526-87026548 TTATATTTCAAAATAAAATATGG + Intronic
1044014113 8:87030117-87030139 TGTTATTTTAAAATGCTTGATGG + Intronic
1044027154 8:87187327-87187349 AGATATTTTCCCATAAATGATGG + Intronic
1044036936 8:87317434-87317456 TGATATTTTCAAGTAAACCATGG - Intronic
1044110805 8:88270904-88270926 TGATATTTTCAAATAGTTGCTGG - Intronic
1044134063 8:88561949-88561971 TGATATCTTCAAGTAATTGAAGG - Intergenic
1044173780 8:89090776-89090798 TTACATTTTAAAATATATTAAGG - Intergenic
1044410924 8:91881765-91881787 TAAAATTTCAAAAGAAATGAGGG + Intergenic
1044500077 8:92944095-92944117 TGATATTTTAATATAACTGTTGG - Intronic
1044562461 8:93626692-93626714 TTATATTTTAAAAAGAATAAGGG - Intergenic
1044634865 8:94312364-94312386 TGATTTTTAAAAATAACTTAAGG + Intergenic
1045341639 8:101260224-101260246 TTATATTTATAATTAAATGAGGG - Intergenic
1045719542 8:105092153-105092175 TCATTTTTTAAAACAATTGATGG + Intronic
1045719776 8:105094903-105094925 TGATATTTGAAATTAAATCTTGG + Intronic
1045911302 8:107413727-107413749 TAATTTTTTAAAATTCATGATGG + Intronic
1046006873 8:108496817-108496839 TGTTATTTTAAACTAAAAGTAGG + Intergenic
1046103399 8:109640317-109640339 ATATATTTTAGAATATATGAAGG - Intronic
1046161440 8:110371541-110371563 TAAAATTCTAAAATATATGAAGG + Intergenic
1046213180 8:111106018-111106040 AAATATTTTCAAATAATTGAGGG + Intergenic
1046296334 8:112223849-112223871 AAATATTGTAAAATAAAGGATGG + Exonic
1046402864 8:113729858-113729880 TGATTTGCTAAAATATATGAAGG + Intergenic
1046700921 8:117400400-117400422 TTACATTTTTTAATAAATGAAGG + Intergenic
1046731648 8:117732556-117732578 TGTTATTTAAAAATAAATAAAGG - Intergenic
1046950699 8:120016973-120016995 TCATATTCTAAAAAATATGATGG - Intronic
1047081466 8:121466443-121466465 TTATATTTTAAAAGGTATGAAGG + Intergenic
1047284460 8:123475077-123475099 TGATATAAAAAAATAAATGAGGG - Intergenic
1048652679 8:136496493-136496515 GTACATTTTAGAATAAATGAGGG + Intergenic
1048691936 8:136975697-136975719 TTATCTTTTAAAATGAATGGAGG + Intergenic
1048813717 8:138311407-138311429 TGCTATGTTAAAATTAAGGAAGG - Intronic
1048922055 8:139240208-139240230 TGATATTTTAAGTCAAATTAGGG - Intergenic
1049020951 8:139957383-139957405 TTTCTTTTTAAAATAAATGAAGG + Intronic
1049026736 8:139996629-139996651 TGCCATTTTTAAATAAATAATGG + Intronic
1049139259 8:140937187-140937209 CCATTTTTTAAAATAAGTGATGG + Intronic
1050164601 9:2751078-2751100 TGGAATTTTAAAACAAAAGATGG - Intronic
1050458187 9:5853971-5853993 TAATATTTTTACATAAATGGGGG + Intergenic
1050490503 9:6183333-6183355 TGACTTCATAAAATAAATGAAGG - Intergenic
1050495537 9:6237711-6237733 TTATATTTTCAAATAAATATGGG - Intronic
1050713736 9:8496047-8496069 TGACAATTTGATATAAATGAAGG - Intronic
1050741803 9:8828875-8828897 TATTATTTTAAAATAACTTAGGG + Intronic
1050769390 9:9177625-9177647 TGATCTTTTAAAAATAATTATGG + Intronic
1051044514 9:12857128-12857150 TTATTTTTTAAAATAAATTGTGG - Intergenic
1051263348 9:15287614-15287636 TTACATTTTAACTTAAATGAAGG - Intronic
1051709692 9:19919006-19919028 AGAAAATTTAAATTAAATGAAGG + Intergenic
1051881304 9:21842243-21842265 TGAAATTTTAAAAGAAATTTGGG + Intronic
1052058353 9:23928213-23928235 GTATATTTTAAAATAACTAAAGG - Intergenic
1052202595 9:25801069-25801091 TAATATTTATAGATAAATGATGG + Intergenic
1052275710 9:26674038-26674060 TTTTATTTAAAAATAAGTGAGGG - Intergenic
1052453263 9:28660746-28660768 AAACATTTTAAAATATATGATGG - Intronic
1052488596 9:29133586-29133608 TTGCATTTTAAAAAAAATGATGG - Intergenic
1052506799 9:29365545-29365567 AGAAATTTAAAAAAAAATGAAGG + Intergenic
1052539998 9:29798574-29798596 GTTTATTTTAAAATAAATGTTGG - Intergenic
1052555143 9:30003233-30003255 TTATCTTTCAAAATAATTGAAGG + Intergenic
1052583748 9:30396324-30396346 TAATCTTTTTAAATATATGATGG - Intergenic
1052713626 9:32088571-32088593 TGCTATTAGAACATAAATGAAGG - Intergenic
1052725233 9:32221234-32221256 TCATATTTTAATCTAAAAGATGG - Intergenic
1052836521 9:33254287-33254309 TAATTTTTTAAAAACAATGATGG + Exonic
1053332653 9:37229129-37229151 TAATATATTAAAATACATGCTGG - Intronic
1053550173 9:39069513-39069535 TCACATTTTAAAATATATAATGG + Intergenic
1053631791 9:39948559-39948581 TTATATTTTAATAGAAATCAGGG + Intergenic
1053773970 9:41514970-41514992 TTATATTTTAATAGAAATCAGGG - Intergenic
1053814284 9:41889619-41889641 TCACATTTTAAAATATATAACGG + Intergenic
1054212096 9:62302139-62302161 TTATATTTTAATAGAAATCAGGG - Intergenic
1054312888 9:63546691-63546713 TTATATTTTAATAGAAATCAGGG + Intergenic
1054616312 9:67297821-67297843 TCACATTTTAAAATATATAACGG - Intergenic
1054827717 9:69589873-69589895 TGCAATTTTAAGAGAAATGATGG + Intronic
1054829902 9:69612301-69612323 TAATTTTTAAAAATAAATTAGGG + Intronic
1054840629 9:69734982-69735004 TGTTATTTTAAAACAAATCTGGG + Intronic
1054949134 9:70830229-70830251 TGAAATTTTCAAATGAATAAAGG + Intronic
1055191087 9:73525014-73525036 TTATATTTTAAAATATATGCAGG + Intergenic
1055214673 9:73844643-73844665 TGCTATTATGTAATAAATGAAGG - Intergenic
1055413808 9:76061371-76061393 TGATATTTTTAAATATATGTGGG - Intronic
1055461077 9:76520770-76520792 TTATGTTTTAAAATCTATGAGGG + Intergenic
1055492604 9:76821015-76821037 TAGTATTTTAAATTAATTGAGGG - Intronic
1055753708 9:79534579-79534601 TGATAATTTAAAATACAAAATGG + Intergenic
1055779876 9:79808849-79808871 TAATTTTTTGAAAAAAATGATGG - Intergenic
1055861765 9:80759068-80759090 TGATATTTCATAATAAAATAAGG - Intergenic
1056081569 9:83099964-83099986 TGATATCTTAAATAAGATGATGG - Intergenic
1056208868 9:84346276-84346298 TCATATTTTAATAAAAATGGAGG - Intergenic
1056489050 9:87086959-87086981 TTATATTTTAAAATCAAAGTTGG + Intergenic
1057770406 9:97962504-97962526 TGATATTCAAAAGTACATGATGG + Intergenic
1057823940 9:98358066-98358088 TGGTATTTTCAAAGAAAGGAAGG - Intronic
1058064719 9:100536040-100536062 TAATATATCAAAATAAAAGAAGG - Intronic
1058093531 9:100832905-100832927 TGAGTTTTTAAATCAAATGAGGG + Intergenic
1058179740 9:101782259-101782281 TGAAATTTGAAACTCAATGAAGG - Intergenic
1058301991 9:103386791-103386813 TGATAGTTCAAAATCAATGGTGG - Intergenic
1058360341 9:104138821-104138843 TGACATTTTAATATCAAAGAAGG - Intronic
1059198075 9:112389762-112389784 TGAGATTCTAAAATATATGTGGG + Intronic
1059327838 9:113515008-113515030 TTTTATTTGAAAATAACTGAGGG + Intronic
1059406937 9:114106667-114106689 TATTAATTTAAAATTAATGATGG + Intergenic
1059624137 9:116042892-116042914 GTATATTTTAAAATAACTTAAGG - Intergenic
1059724717 9:116995456-116995478 TGATGTTTAAAAATGAATGGTGG - Intronic
1059845010 9:118265586-118265608 TGATCTTTTTATTTAAATGATGG - Intergenic
1060009527 9:120031442-120031464 TGGCTTTTTAAAAAAAATGATGG - Intergenic
1060078433 9:120617326-120617348 TGAAATGGTAAAATAAATAAAGG - Intronic
1060126675 9:121054161-121054183 TGATATTTTAACTTGAATGCTGG - Intergenic
1060172159 9:121470757-121470779 TGTTCTTGTAAAATGAATGAAGG + Intergenic
1060333817 9:122702965-122702987 TAAAATTTTAAATTAAATGATGG + Intergenic
1060637721 9:125212559-125212581 TGTTACTTGCAAATAAATGATGG - Intronic
1060658767 9:125390449-125390471 TGACATTTTAAAATAACTAAAGG - Intergenic
1060715520 9:125924168-125924190 TGTTATTTTTAAATTAATTAGGG - Intronic
1060718261 9:125955051-125955073 TGATTTTTTAAAATTAATTTAGG + Intronic
1060785021 9:126444711-126444733 TTAAATGTTAAAAAAAATGAAGG - Intronic
1060806087 9:126578120-126578142 AAATGTTTTAAAAGAAATGATGG + Intergenic
1061501501 9:131005781-131005803 TAATATTTTTTAATAAATAAAGG - Intergenic
1061840186 9:133354168-133354190 TGAAATTTTAAAAAATATGTGGG + Intronic
1203566789 Un_KI270744v1:98640-98662 AGTTGTTTTAAAATAAGTGAAGG + Intergenic
1185477407 X:423680-423702 TGATATTTTAAAAATGCTGAAGG - Intergenic
1185785320 X:2885949-2885971 TGATCTATTAAAAAAAATGGGGG - Intergenic
1185808596 X:3083206-3083228 TGATAGATACAAATAAATGATGG - Intronic
1185808597 X:3083292-3083314 TGATAGATAAAAATAAATTATGG - Intronic
1185948036 X:4400103-4400125 TAAAATTTTAAAATAAAGCAAGG + Intergenic
1186007725 X:5092868-5092890 TCATCTTTTAAAATAGTTGACGG + Intergenic
1186125478 X:6409316-6409338 TAATATATAAAAACAAATGATGG - Intergenic
1186494857 X:10004508-10004530 ATATATTTTAAAATGCATGAAGG - Intergenic
1186513127 X:10145990-10146012 TGTTATTTTAAAATATAAGCAGG + Intergenic
1186791771 X:13006625-13006647 TGATATGTGAAAACAAATCAGGG + Intergenic
1187054214 X:15726552-15726574 GTATATTTTAATATAAAAGAGGG - Intronic
1187469728 X:19558509-19558531 TGATATTTTAAAATGGATGATGG - Intronic
1188168837 X:26895388-26895410 TGATTTTTTAAAATTTATTAAGG - Intergenic
1188207568 X:27379362-27379384 ATATTTTTTAAAATAACTGAAGG + Intergenic
1188233981 X:27703553-27703575 TGATTTTTGAAAATCAATCACGG + Intronic
1188380116 X:29481334-29481356 TGCTTTTTTAAAATGACTGAAGG - Intronic
1188414782 X:29919244-29919266 TGAAATGCTAAAATAAATGAAGG + Intronic
1188690458 X:33122618-33122640 TGTTATTTGAAAATACATTATGG - Intronic
1188705532 X:33324540-33324562 TGATATTTTTAATTGATTGAAGG - Intronic
1189264977 X:39707995-39708017 TGATATTTTAAAATAACTTTTGG + Intergenic
1189453943 X:41166643-41166665 TGATATTTTTAAATACCTGGGGG + Intronic
1189714463 X:43851471-43851493 TGGTATTTTAGAATAACTGAGGG - Intronic
1190029518 X:46958508-46958530 TGATAGATTAAAAAAAATGCAGG - Intronic
1190462315 X:50690222-50690244 TGAGATTTTCAAATATATTAAGG + Intronic
1190818408 X:53949510-53949532 TGATATTAAGAAATAAATGTTGG + Intronic
1191772716 X:64779661-64779683 TGGTATTGTAGAATAAATTAGGG + Intergenic
1191775122 X:64805245-64805267 TAATAATTTAAAAAAAAAGAAGG + Intergenic
1191875708 X:65793800-65793822 TTATATTTTAAAATAATAAATGG - Intergenic
1191979233 X:66907712-66907734 TTATATTTGAAAAAAAATCATGG - Intergenic
1192018045 X:67353037-67353059 TGCTATTTTAAAATGTATGTTGG - Intergenic
1192024082 X:67429691-67429713 TGATATATTAAAAATACTGAAGG - Intergenic
1192622059 X:72687713-72687735 TGATATTTTAACAAATATTAAGG + Intronic
1192708287 X:73551157-73551179 TGATATATTTAAATTATTGAAGG + Intergenic
1192981433 X:76348664-76348686 TTATACTATAAAATATATGATGG + Intergenic
1193254735 X:79334281-79334303 GTATATTTTAAAATAACTGAAGG + Intergenic
1193576415 X:83202903-83202925 AGATTTTTTAAAAGAAATAATGG - Intergenic
1193664118 X:84295178-84295200 TTATATTTTAAAATAACTAGAGG - Intergenic
1193678764 X:84490560-84490582 TGAAATTTTAACATACATAATGG - Intronic
1193927735 X:87509168-87509190 TGACATTTTAAAATTAATTTTGG + Intergenic
1193991903 X:88318692-88318714 TTAAATTTTAAGTTAAATGATGG - Intergenic
1194062386 X:89220374-89220396 TAATATTTTAAAATAAAACATGG + Intergenic
1194126734 X:90027617-90027639 TGATGTTATAAAATATATGATGG + Intergenic
1194192402 X:90853990-90854012 TCATATATTAAAACAAATGAAGG - Intergenic
1194307980 X:92271986-92272008 TGAAATTTGACAATACATGATGG + Intronic
1194341245 X:92708716-92708738 AAATATTTTAAAAGAAAGGAGGG - Intergenic
1194576901 X:95624439-95624461 TGCTTTTTTAAAAAAAATGGGGG - Intergenic
1194784067 X:98060481-98060503 TGATTTATTAAAATAAAAAATGG - Intergenic
1194935726 X:99945779-99945801 TGATATTTTAAATTTAAGGTGGG - Intergenic
1194938186 X:99977009-99977031 AGATATTTTAAAAAAAAAGATGG + Intergenic
1194941692 X:100017712-100017734 TGCTAATTTCAAATAAATGATGG + Intergenic
1195171675 X:102274695-102274717 GTATATTTTAAAATAACTTAAGG - Intergenic
1195187185 X:102412398-102412420 GTATATTTTAAAATAACTTAAGG + Intronic
1195591481 X:106633098-106633120 TAGAATATTAAAATAAATGAAGG - Intronic
1196170756 X:112586552-112586574 TAAAATTTTAAATTAAACGATGG + Intergenic
1196222114 X:113123901-113123923 TTATATTATAAAATAAAAAATGG + Intergenic
1196245590 X:113395405-113395427 TGATTTTTTAAAATGAAGGATGG - Intergenic
1196316251 X:114228065-114228087 TGAATTTTAAAAATTAATGAAGG + Intergenic
1196329455 X:114453334-114453356 TGTTAATTTATAGTAAATGAAGG - Intergenic
1196396292 X:115265237-115265259 TGATAATGTGAAATGAATGAGGG + Intergenic
1196470888 X:116025071-116025093 TTACATTTTAAAATAACTCAAGG + Intergenic
1196672188 X:118380627-118380649 TGATATTGTAATATAAAGGAAGG + Intronic
1196991232 X:121330725-121330747 AGGTATTTTAAAGAAAATGAAGG + Intergenic
1197071978 X:122310188-122310210 TTAAATTTTAAAAAAAATGCTGG - Intergenic
1197263677 X:124343604-124343626 TGACATTTTACAATAACTTAAGG - Intronic
1197357805 X:125457967-125457989 TGATGTTTTGATATACATGATGG + Intergenic
1197419124 X:126216190-126216212 TAATATTATAAAATAAAATATGG - Intergenic
1197498052 X:127210064-127210086 TGATACATTGAAATAAATGGTGG - Intergenic
1197525113 X:127551686-127551708 TGATGTTTAAAATTAAATGGTGG - Intergenic
1197548488 X:127857801-127857823 GCATATTTTAAAATAACTAAAGG + Intergenic
1197652006 X:129075383-129075405 TGATTTTTTAAATAACATGATGG - Intergenic
1197780706 X:130157368-130157390 TGACATTTTCAGATAAAGGAAGG + Intronic
1197894485 X:131296898-131296920 TAATATTTTTGAATAAATGCAGG - Intronic
1197963075 X:132026805-132026827 TCATATTTAAAGATACATGAAGG - Intergenic
1198002861 X:132457670-132457692 TGTTATTTTAAATAGAATGAAGG - Intronic
1198117818 X:133561119-133561141 TGGTATTTTAAAATAAGTGATGG - Intronic
1198195688 X:134358919-134358941 TAATATTTTAAAATGTATTAAGG - Intergenic
1198620769 X:138506528-138506550 AGAAATTTTAAAATAAACCATGG + Intergenic
1198736746 X:139793870-139793892 TGATATTTTTAAAAACTTGAGGG + Intronic
1198882880 X:141300256-141300278 TCAAATACTAAAATAAATGATGG - Intergenic
1198965320 X:142222438-142222460 AGTTATTTAAAAATAAATGTAGG - Intergenic
1199169988 X:144724299-144724321 TGAAATTTTAAAACAAATAATGG + Intergenic
1199295638 X:146155014-146155036 TGATATTCTAAATTACATTAAGG + Intergenic
1199341829 X:146688451-146688473 TTAAATTTTAAAATAAAACATGG + Intergenic
1199447481 X:147942615-147942637 TGTTCTTTTAAAACAAAAGATGG + Intronic
1199479959 X:148287637-148287659 TCAGATGTTAAATTAAATGATGG - Intergenic
1199532205 X:148862427-148862449 AGATATTTTTTAAAAAATGATGG + Intronic
1199556246 X:149112406-149112428 TATTATTTTAGAAGAAATGAAGG + Intergenic
1200539040 Y:4436440-4436462 TCATATATTAAAACAAATGAAGG - Intergenic
1200645305 Y:5775762-5775784 TAATAATTTAAAAAAAATGTTGG + Intergenic
1200649596 Y:5825430-5825452 AAATATTTTAAAAGAAAGGAGGG - Intergenic
1200716255 Y:6549341-6549363 TAATATTTTAAAATAAAACATGG + Intergenic
1201607103 Y:15799161-15799183 TAATATATAAAAACAAATGATGG - Intergenic
1201970201 Y:19784196-19784218 TGAGACTTTAAAATAAAATAAGG - Intergenic
1202268047 Y:23041632-23041654 TGTTATTTTGAAATCTATGAGGG + Intergenic
1202421039 Y:24675376-24675398 TGTTATTTTGAAATCTATGAGGG + Intergenic
1202449747 Y:24994706-24994728 TGTTATTTTGAAATCTATGAGGG - Intergenic