ID: 1112150148

View in Genome Browser
Species Human (GRCh38)
Location 13:96750395-96750417
Sequence CCTCACTGGGTGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 245}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112150140_1112150148 -8 Left 1112150140 13:96750380-96750402 CCCAGACCACTCCTTCCTCACTG 0: 1
1: 0
2: 5
3: 58
4: 506
Right 1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG 0: 1
1: 0
2: 0
3: 20
4: 245
1112150136_1112150148 30 Left 1112150136 13:96750342-96750364 CCGTGACACTGAACTGGTGGTCA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG 0: 1
1: 0
2: 0
3: 20
4: 245
1112150139_1112150148 -3 Left 1112150139 13:96750375-96750397 CCTGTCCCAGACCACTCCTTCCT 0: 1
1: 0
2: 5
3: 32
4: 422
Right 1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG 0: 1
1: 0
2: 0
3: 20
4: 245
1112150138_1112150148 4 Left 1112150138 13:96750368-96750390 CCTTGGTCCTGTCCCAGACCACT 0: 1
1: 0
2: 1
3: 24
4: 288
Right 1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG 0: 1
1: 0
2: 0
3: 20
4: 245
1112150141_1112150148 -9 Left 1112150141 13:96750381-96750403 CCAGACCACTCCTTCCTCACTGG 0: 1
1: 1
2: 24
3: 151
4: 522
Right 1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG 0: 1
1: 0
2: 0
3: 20
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112150148 Original CRISPR CCTCACTGGGTGAAGGAGAC AGG Intronic
900412839 1:2520644-2520666 CCTCGCTGTGTGCAGGAGCCAGG - Intronic
900462637 1:2808899-2808921 CCTCACTGGGCCACGGAGACAGG + Intergenic
900702335 1:4056006-4056028 CCTCACTGGTGGAAGGGGCCAGG - Intergenic
901782124 1:11601176-11601198 CTTGACTGGGTAAAGGTGACTGG + Intergenic
903211459 1:21821655-21821677 CCTCTCTAGGTGATGGGGACGGG + Intronic
903692266 1:25182984-25183006 GCTCACTGGCAGAAGGAAACAGG + Intergenic
904702269 1:32364899-32364921 TCTCACTGGGACAAGGAGTCGGG - Intergenic
904914010 1:33956724-33956746 AGACACCGGGTGAAGGAGACTGG - Intronic
906557748 1:46728073-46728095 TCTCACTGGGAGATGCAGACCGG - Intergenic
906626531 1:47330399-47330421 CATAACTGGCAGAAGGAGACAGG + Intergenic
906772481 1:48497327-48497349 CCTCTCTGGGTGGAGCAGGCTGG + Intergenic
908903755 1:68985118-68985140 CCTCACTGGGAGCTGCAGACCGG - Intergenic
909131486 1:71742392-71742414 CCCCACTGGGTTTGGGAGACAGG + Intronic
912966132 1:114239295-114239317 CCTCACTGGATGCTGCAGACCGG - Intergenic
914235161 1:145802880-145802902 CGTCACTAGGTCAAAGAGACTGG + Intronic
915962410 1:160278330-160278352 CCTCAGTTGGCAAAGGAGACTGG - Exonic
920264616 1:204712444-204712466 CCTCCCTGGGTGAAGGGGAGGGG - Intergenic
920829196 1:209449933-209449955 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
921600063 1:217097213-217097235 CCTCATGGGTTGAAGGAGAAGGG - Intronic
924535833 1:244935017-244935039 CTTAACTGGGTGAAGGTGGCAGG - Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063348595 10:5334719-5334741 CCACAGTGGGTGAAGGAGTTTGG + Intergenic
1064664006 10:17631476-17631498 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1065974547 10:30830905-30830927 CTTCCCTGGGTGGAGGAGGCTGG + Intronic
1067451754 10:46385950-46385972 AGTCCCTGGGTGAGGGAGACAGG - Intronic
1067532570 10:47085336-47085358 TCTCACAGGGTGAAGGGGGCAGG - Intergenic
1067585484 10:47473805-47473827 AGTCCCTGGGTGAGGGAGACAGG + Intronic
1068369606 10:56095815-56095837 CCTCACAGTGCTAAGGAGACTGG - Intergenic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1070368436 10:75758327-75758349 CCTCACAGTGGGCAGGAGACTGG - Intronic
1072499579 10:95999845-95999867 CTTCTCTGGGTGAAGCAGGCTGG + Intronic
1073007929 10:100339026-100339048 CCTGCCTGAGTGAAGGAGATAGG + Intergenic
1073283839 10:102375257-102375279 CTTCACTGGCCTAAGGAGACTGG + Intronic
1074535674 10:114327068-114327090 TCTCACAGGGTTAAGGAGAAAGG + Intronic
1076469995 10:130711662-130711684 CTCCACTGGGTGAAAGAGACAGG - Intergenic
1077107478 11:848396-848418 CCTCGCTGGGGGAAGGGGACAGG - Intronic
1079969684 11:27020875-27020897 CATCACTGGTTCAAGGAGAGTGG + Intergenic
1083276061 11:61597774-61597796 CCTCACTGGCTGGAGGGGAACGG - Intergenic
1084355344 11:68634687-68634709 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
1084439625 11:69165208-69165230 CTCCACTGGGAGAAGGAGATTGG + Intergenic
1088720436 11:112587461-112587483 CCTCACTGGGCAAAGGGGATGGG + Intergenic
1089088511 11:115845415-115845437 CCTCCATTGGTAAAGGAGACTGG + Intergenic
1090879409 11:130820532-130820554 CATCACCTGGTGCAGGAGACAGG + Intergenic
1091158126 11:133392942-133392964 CCTCACTGGGACAATGAGATTGG - Intronic
1093389673 12:18602741-18602763 GCTCACTGGGTGAATGAACCCGG + Intronic
1097717302 12:62980504-62980526 CTTCAGTGGGTGAAGGAGCTTGG + Intergenic
1098009718 12:66037621-66037643 CTTCTCTGGGTGGAGCAGACTGG - Intergenic
1099044325 12:77697058-77697080 CTTCTCTGGGAGAAGGAAACTGG - Intergenic
1099071466 12:78049617-78049639 TCTCACTGGGAGCAGCAGACTGG + Intronic
1099758825 12:86892665-86892687 CCTCACCTGGTGAAGAAGAGTGG - Intergenic
1101938829 12:109083755-109083777 CCTAACTGGGGGCAGCAGACAGG - Intronic
1102204604 12:111081970-111081992 CCTCTCAGGGTGAGGGAGCCGGG - Intronic
1102823409 12:115926822-115926844 CTTCTCTGGGTGACGGAGAGAGG - Intergenic
1103153624 12:118663900-118663922 CCTCAGTGGGTGCAGGACAGTGG - Intergenic
1103965743 12:124638296-124638318 CCTCACGCGGTGAAAGGGACGGG - Intergenic
1106208927 13:27622895-27622917 CCTCAATGGCTGAAGGCGAGAGG + Exonic
1107432380 13:40351715-40351737 CCTGCCTGGCTGAAGGACACAGG + Intergenic
1112150148 13:96750395-96750417 CCTCACTGGGTGAAGGAGACAGG + Intronic
1112775832 13:102843378-102843400 CCTCTGCAGGTGAAGGAGACAGG - Intronic
1116009367 14:39332828-39332850 CCTCACTGGGAGCTGAAGACCGG + Intronic
1116703530 14:48267298-48267320 CCGCTCAGGGTGAAGGAGAAGGG + Intergenic
1117591327 14:57271189-57271211 CATCACTAGGTAAAGGGGACAGG - Intronic
1117932180 14:60855095-60855117 CCTGACAGTGTTAAGGAGACTGG - Intronic
1122925806 14:104899246-104899268 CCCCACTGGCTGAGGGAGAAAGG + Intergenic
1123670744 15:22654404-22654426 CCTCACTTGGTGAAAGGGGCAGG - Intergenic
1124089167 15:26581586-26581608 CCTGGCTGGGTGAATGAGAAAGG - Intronic
1124636870 15:31371204-31371226 CCTCACTCGGAGCGGGAGACAGG - Intronic
1125605545 15:40937936-40937958 CCTCCCTGGGAGAAGGCGATGGG - Intronic
1128153206 15:65376520-65376542 CCTCCCTGGCTGAGGGAGATGGG + Intronic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1128996988 15:72304630-72304652 CCTCCCTGGGTCAAGGGGACAGG - Intronic
1129111295 15:73338876-73338898 CCATCCTGGGTGCAGGAGACAGG + Intronic
1129921571 15:79323629-79323651 CCTCAGAGGGTGAAGGAGAAGGG - Intronic
1132340205 15:101073492-101073514 CCGCTCAGGGTGAAGGAGAAGGG - Intronic
1132830528 16:1925842-1925864 CCACACTGTGTGAAGGTGCCTGG - Intergenic
1133383998 16:5354146-5354168 CCTGCCTGGCTCAAGGAGACAGG - Intergenic
1136136411 16:28259203-28259225 CCTCGGTGGGTGGAGGAGCCGGG - Intergenic
1136564370 16:31061279-31061301 CCGCACTGGGTGCAGGGGAAGGG + Exonic
1138562630 16:57810973-57810995 CCTCCCTGGGTAAAGGAGGAGGG + Intronic
1139519403 16:67471992-67472014 CCTCACTGGGTGAAGAAAAGGGG - Intronic
1141137725 16:81477543-81477565 CCTCCCTGTGTGAAGGCGGCTGG + Intronic
1141143066 16:81509818-81509840 CCTCCCTGGTTAAGGGAGACAGG - Intronic
1142491722 17:283932-283954 CCTCTCTGGGTAAAGGGGAGAGG + Intronic
1142703902 17:1682129-1682151 CCCCACTGGGAGATGTAGACAGG + Exonic
1143795007 17:9329470-9329492 AGTCACTGGGTGAGGGACACTGG + Intronic
1144136470 17:12300198-12300220 CCTCACTTGGAGTAGGAGATGGG - Intergenic
1146915657 17:36676758-36676780 CCCCACTGGGAGAAGGTGCCTGG - Intergenic
1148570759 17:48666988-48667010 TCTCACTGAGTTTAGGAGACAGG - Intergenic
1150265025 17:63826835-63826857 TATCACTTGGCGAAGGAGACGGG - Exonic
1151512214 17:74567756-74567778 CTTCACTGGATGGATGAGACTGG + Intergenic
1151620185 17:75240505-75240527 CATCAATGGGTGAAGGCGCCGGG + Intronic
1151819713 17:76490942-76490964 GCTCACTGGGTGCAGGATCCTGG - Intronic
1152103861 17:78317848-78317870 CTCCCCTGGGTGAAGGAGCCAGG + Intergenic
1152242879 17:79169393-79169415 CCGCAGTGGGTGAAGGAGCAGGG - Intronic
1153698067 18:7664215-7664237 CCTCACTGTGTGGAGGAGCCAGG + Intronic
1155999307 18:32367277-32367299 TCTGACTGGTTGAAGGACACTGG + Intronic
1156979391 18:43266183-43266205 TCTCACTGGGAGCTGGAGACTGG + Intergenic
1162043911 19:7986281-7986303 CCTCACTGAGAGACAGAGACTGG + Intronic
1162530941 19:11236198-11236220 CTTCTCTGGGTGCAGGGGACTGG + Intronic
1163482080 19:17562782-17562804 CGTCACGAGGTGAAGGAGACAGG + Intronic
1164032508 19:21420123-21420145 CCTGTGTTGGTGAAGGAGACAGG - Intronic
1164459429 19:28434581-28434603 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1164611441 19:29635164-29635186 CCTCACTGTGTGCTGGAGTCAGG + Intergenic
1164707580 19:30331857-30331879 CCCCACTGGGTGAAGGGCAGCGG - Intronic
1167353854 19:48991899-48991921 CCTCACTGGGTTTTGGAGCCTGG - Intronic
1167452973 19:49583270-49583292 CCTCACTGGGTGAAGTATCCAGG - Exonic
926984371 2:18605911-18605933 CCGGACTGGGTGAAGAGGACTGG + Intergenic
927869032 2:26612192-26612214 CCTCACTGGGTCTGGGAGCCAGG - Intronic
928069205 2:28197933-28197955 CCTAATTAGGTGTAGGAGACAGG + Intronic
929076900 2:38085552-38085574 CCGCTCAGGGTGAAGGAGAAGGG + Intronic
929446838 2:42008795-42008817 CCTCAGTGGGGGATGGAGAAGGG + Intergenic
930212131 2:48652146-48652168 CCTCACTGATTGAAGGAAAATGG + Intronic
931042486 2:58315111-58315133 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
932854407 2:75218490-75218512 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
933324255 2:80815490-80815512 CCTGACTGTGCTAAGGAGACAGG + Intergenic
937186840 2:120051768-120051790 CTACACTGGGTGATGTAGACTGG + Intronic
937508186 2:122560792-122560814 CTTTACAGGGTGAAGCAGACTGG - Intergenic
937562623 2:123244506-123244528 CCTCACTGGGAGCTGCAGACTGG - Intergenic
938322997 2:130377656-130377678 TCTCCCGGGATGAAGGAGACTGG - Intergenic
938450598 2:131415731-131415753 CCACCATGAGTGAAGGAGACAGG - Intergenic
940529981 2:154868279-154868301 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
940676024 2:156724865-156724887 CCACTCAGGGTGAAGGAGAAGGG + Intergenic
944150233 2:196549943-196549965 ATTCAGTGGTTGAAGGAGACAGG + Intronic
944212224 2:197218411-197218433 GTTCACTGGGTGAAGGGGAGTGG - Intronic
944483416 2:200179783-200179805 CCTCCATGGGTGAAGGAAAATGG - Intergenic
946090042 2:217213808-217213830 CCTCCTTGGGGGAAGGAGATTGG + Intergenic
946315476 2:218908763-218908785 TCTCACTGGGTGCCGGACACCGG - Intergenic
946476136 2:220008244-220008266 CCACACAGAGTGAGGGAGACAGG + Intergenic
946580677 2:221125116-221125138 CCTGAGTGGGTGGTGGAGACAGG - Intergenic
946818013 2:223598953-223598975 ATTCACTGAGTGAAGAAGACTGG - Exonic
947816995 2:233044350-233044372 CCCCTCTGGGAGAAGAAGACAGG - Intergenic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
948485626 2:238279114-238279136 CATCACTGGGTGAAGAAGGGAGG - Intronic
1169075663 20:2758650-2758672 CCACCCTGGGAGAAGGAGCCTGG + Intronic
1169263998 20:4156661-4156683 CCTCACTGGGTGAATGAGGAAGG + Intronic
1169417416 20:5429383-5429405 CCTGACTGGGAGAAAGAGGCAGG - Intergenic
1170266497 20:14471331-14471353 TCTCACTGGGAGATGTAGACCGG + Intronic
1170969650 20:21105107-21105129 CCTCTCTGGGTGAAGGAAAGCGG + Intergenic
1172605061 20:36208439-36208461 CCTGGCCGGGTGAAGGTGACTGG - Intronic
1173789198 20:45816667-45816689 TCTCAGTGAGTGATGGAGACAGG - Intronic
1174945424 20:54980117-54980139 CTCCACTAGGAGAAGGAGACAGG - Intergenic
1175623086 20:60467272-60467294 CCTCCCTTGGTGAAGGACAGGGG + Intergenic
1175898955 20:62352498-62352520 GCTCACTGGCTGAAGGGGCCTGG + Intronic
1175915301 20:62423265-62423287 TCCCACTGGGTGACTGAGACGGG - Intronic
1175984274 20:62756147-62756169 CATCACTGGCTGAAGGTGCCTGG - Intronic
1176309144 21:5140589-5140611 TGTCACTGGGAGAAGGACACAGG - Intronic
1177102058 21:16910506-16910528 CCACACTGAGTGCAGCAGACAGG - Intergenic
1177430705 21:20988941-20988963 CCTCACTCGGTGGAAGGGACAGG - Intergenic
1178393462 21:32219209-32219231 TCTCACTGGGTGCTGCAGACTGG - Intergenic
1179580491 21:42340333-42340355 CCTCACTGGGGCTGGGAGACAGG + Intergenic
1179815731 21:43904789-43904811 CCACAGTGGGAGAAGGACACAGG - Intronic
1179847917 21:44121444-44121466 TGTCACTGGGAGAAGGACACAGG + Intronic
1181439424 22:22928076-22928098 ACTCAGTGGGTGAAAGAGGCAGG + Intergenic
1184417400 22:44360292-44360314 CCTCACTGCCTGCAGGACACAGG + Intergenic
1185114089 22:48921256-48921278 CCACACTGCGTTCAGGAGACTGG - Intergenic
950562084 3:13736793-13736815 TCTCACTGGGAGATGCAGACCGG + Intergenic
952341877 3:32454119-32454141 CGGCACTGGGTGGAGGACACAGG + Intronic
952884442 3:38003866-38003888 CCAGGCTGGGAGAAGGAGACGGG - Intronic
953219115 3:40951356-40951378 TCTCACTGGGTGCTGCAGACCGG + Intergenic
954013254 3:47662417-47662439 CCTGACTGACTGAAGGGGACAGG + Exonic
954205709 3:49057462-49057484 CTTCACTGGTTGGAGGACACTGG + Exonic
955874668 3:63476546-63476568 CATTTCTGGGTGAAGAAGACTGG + Intronic
956028656 3:65012042-65012064 CCTCACTAAGTAGAGGAGACAGG + Intergenic
956718722 3:72100084-72100106 CATCACTGGGTAAACGAGAGAGG - Intergenic
958071948 3:88625801-88625823 CCTCAGTGGGGGAAAGAGAGAGG + Intergenic
959919487 3:111855188-111855210 CCTGAGAGGGTGAAGGACACAGG + Intronic
961497849 3:127307089-127307111 CCTGACTGTGGGAGGGAGACTGG - Intergenic
961540159 3:127593950-127593972 CATCACAGTCTGAAGGAGACTGG + Intronic
961655415 3:128439026-128439048 CCTCCCTTGGTGAAGGGGAGAGG - Intergenic
962453072 3:135538086-135538108 CCCCAATGGGAGAAGGAGCCAGG - Intergenic
963663098 3:148152500-148152522 CCACTCAGGGTGAAGGAGAAAGG - Intergenic
963998662 3:151740400-151740422 CCTCACTGGGAGCTGCAGACCGG + Intronic
966278980 3:178208140-178208162 CCTCTAAGGGTGAAGGAGAAGGG - Intergenic
967309051 3:188089003-188089025 CCTCCCTGGGTGCAGGGAACTGG + Intergenic
967958928 3:194902699-194902721 AATCACAGGGTGAGGGAGACTGG - Intergenic
968057546 3:195704011-195704033 TCTCACTCGGTGCAGCAGACTGG - Intergenic
968281385 3:197479451-197479473 CCAGACAGGGTGAAGGACACTGG + Intergenic
970178143 4:13359827-13359849 CCTCACTGGGTGCAGGGCTCTGG - Intergenic
970787247 4:19814138-19814160 CCTCTCTGGGTGGAGCAGGCTGG - Intergenic
971422220 4:26484011-26484033 CCTCACAGGGTCATGGAGAATGG - Intronic
975212963 4:71722456-71722478 CCTGACTGTGCTAAGGAGACAGG - Intergenic
976169551 4:82288750-82288772 CCTCTCTTGGTGAAGCATACAGG + Intergenic
976261522 4:83149689-83149711 TCTGGCTGGGTAAAGGAGACTGG + Intergenic
978496662 4:109366715-109366737 CCTCATTTGGTGAATGAGGCTGG + Intergenic
978503421 4:109433421-109433443 CCTCAGTGGGTGAAGGGACCGGG - Intergenic
980388703 4:132119132-132119154 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
980583741 4:134787014-134787036 TCTCACTGGGAGATGCAGACTGG + Intergenic
982288562 4:153758888-153758910 CCTCACGGGTTGGAGGAGAAGGG + Intronic
982619875 4:157691534-157691556 TCACACTGGGTGCAGTAGACTGG - Intergenic
982822902 4:159966724-159966746 CTTCCCTGGGTGAAGGGCACTGG + Intergenic
988847383 5:35141911-35141933 CCTCACAGAGTGGAGGAGACGGG - Intronic
990730154 5:58799668-58799690 CCTCACTCAGGGAAGGAGAAAGG + Intronic
992162510 5:74016694-74016716 ACTCCCTGTGTGAGGGAGACAGG - Intergenic
992254990 5:74912178-74912200 TCTCACTGGGAGATGCAGACTGG + Intergenic
993447186 5:88027610-88027632 TCTCTCTGGGGGAAGGAGAGGGG + Intergenic
993649713 5:90504983-90505005 CCTGAGTGGGTTAAGCAGACAGG + Intronic
994142192 5:96354160-96354182 TCTCACTTGGTTCAGGAGACTGG - Intergenic
994532744 5:100988968-100988990 CCGCAAAGGGTGAAGGAGAAGGG + Intergenic
998004626 5:138648864-138648886 TTTCAGTGGGGGAAGGAGACAGG - Intronic
999556709 5:152751700-152751722 TCTCACTGGGAGATGAAGACTGG - Intergenic
999928607 5:156406505-156406527 AATCACTGGGTGAACGAGACTGG - Intronic
1002313222 5:178327420-178327442 CCTCACTGGTTCTGGGAGACAGG - Intronic
1003330046 6:5122197-5122219 CATCACCGGATGAAGGTGACAGG - Intronic
1003850160 6:10213953-10213975 CTTCTCTGGGTGGAGCAGACTGG + Intergenic
1004575017 6:16886932-16886954 CCGCTCAGGGTGAAGGAGAAGGG - Intergenic
1005014881 6:21366248-21366270 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1006104282 6:31707252-31707274 CCTCACTGGCTGGGGGAGAGAGG + Intronic
1006984962 6:38169963-38169985 GCTCGCTGGGTGCAGCAGACTGG + Exonic
1013575261 6:111477539-111477561 CCTCACTGTGGGAAGGAGCATGG + Intronic
1013708200 6:112864652-112864674 CCTCACTGGGATAACCAGACGGG + Intergenic
1018388748 6:163327534-163327556 CCTCAGTGGGGGAAGGACACAGG + Intergenic
1019398989 7:840357-840379 CGCCACTGGGAGACGGAGACTGG - Intronic
1021327794 7:19296231-19296253 CCTCACTGGGGGAAGCAGAGGGG - Intergenic
1021387552 7:20050446-20050468 CTTCACTGGGGGAATGAGGCTGG - Intergenic
1021637104 7:22704276-22704298 CCACTCAGGGTGAAGGAGAAGGG - Intergenic
1021928948 7:25560809-25560831 CCTCACTGGGTGCAGTAGGGGGG + Intergenic
1022520865 7:31006161-31006183 CTTTTCTGGGTGAAGGAGAGAGG - Intergenic
1023219404 7:37903500-37903522 CCACCCTGAGTGAAGGAGAGAGG - Intronic
1023809570 7:43901661-43901683 CCACACTGGGGGAAGGGGAAAGG - Intronic
1023870218 7:44259207-44259229 TCTCTCTGGCAGAAGGAGACAGG - Intronic
1024856851 7:53793037-53793059 CCAAGCTGGGTGAAGGAGACTGG + Intergenic
1024984280 7:55182050-55182072 CCTGCCTGGGTGCTGGAGACAGG + Intronic
1027878753 7:83804453-83804475 CCTCTCCGAGTCAAGGAGACAGG - Intergenic
1031146433 7:118002260-118002282 CCTTACTGGATGTAGGAGATGGG - Intergenic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1033909698 7:146248247-146248269 CCGCTCAGGGTGAAGGAGAAGGG + Intronic
1034507953 7:151510146-151510168 GCTCACTGAGTGAATGAGAAGGG - Intronic
1034949835 7:155289838-155289860 CCTCACATGGTGAAGGGGCCAGG + Intergenic
1038286375 8:26209568-26209590 CCTGTCTGGGTGATGGAGGCTGG - Intergenic
1039385185 8:37129252-37129274 CCTGACTGGATGAAGGACACGGG + Intergenic
1040971996 8:53145143-53145165 CCTCACTTGGGGAAGGACATGGG + Intergenic
1042977987 8:74492208-74492230 CATCACTGGGTTAAAGAGAGAGG + Intergenic
1045116380 8:98986906-98986928 TTTCACTTGGTGAAGGAGTCAGG + Intergenic
1045430748 8:102112756-102112778 CCTCCCTGGGTGGAGGAGGGAGG + Intronic
1047714287 8:127581553-127581575 CCAGCCTGGGTGAAAGAGACGGG - Intergenic
1048764444 8:137829586-137829608 CCACTAAGGGTGAAGGAGACAGG + Intergenic
1048795695 8:138147345-138147367 CCTCAGTAGCTGAAGGAGAGGGG - Intronic
1049107680 8:140623987-140624009 TCACAGTGGGTGATGGAGACAGG + Intronic
1049391692 8:142374977-142374999 CCTCCCTGGGGAAAGGGGACAGG - Intronic
1049936183 9:504093-504115 CCTCCCCGGGTGAGGGGGACCGG - Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050111948 9:2226423-2226445 ACTCATTGTGGGAAGGAGACTGG - Intergenic
1050583642 9:7086880-7086902 CCCCACTCTGTGAAGGAGAGGGG - Intergenic
1051176202 9:14362864-14362886 CCTCACTCTGTCAAGCAGACTGG - Intronic
1051353806 9:16223114-16223136 CCTCGCTGGGTGCTGTAGACCGG - Intronic
1051512625 9:17895716-17895738 CCTCAATGGAAAAAGGAGACAGG + Intergenic
1052221269 9:26026127-26026149 CCTAATTGGGTTAAGGAGAGTGG + Intergenic
1053446692 9:38158525-38158547 TTTCACTGGGGGAAGGAAACAGG + Intergenic
1057216284 9:93230593-93230615 CCTCACTGGGAGATGGTGCCAGG - Intronic
1057813792 9:98279101-98279123 CCTTACTTGGTGAAGGGGAAAGG + Intergenic
1058674617 9:107389733-107389755 CCTCACTGGCAGAGGGAGAGTGG - Intergenic
1060223887 9:121779905-121779927 CCTCACTGAGTTGAGGAGACAGG - Intronic
1061731891 9:132621558-132621580 TCACGCTGGGTGAAGGAGAGGGG + Intronic
1062010634 9:134264886-134264908 CCTCAGAGAGTGGAGGAGACAGG + Intergenic
1062555937 9:137113492-137113514 CATAACTGGGTGAGGGACACAGG + Exonic
1187086741 X:16049450-16049472 CCACTCAGGGTGAAGGAGAAGGG + Intergenic
1191138798 X:57094370-57094392 TCTCACTGGGAGATGCAGACTGG - Intergenic
1194503199 X:94703600-94703622 CCACTCAGGGTGAAGGAGAAAGG + Intergenic
1194652505 X:96533002-96533024 TCTCACTGGGAGATGCAGACTGG - Intergenic
1195404110 X:104494079-104494101 GCAAACTGGGTGAAGGATACAGG - Intergenic
1196308172 X:114128212-114128234 TCTCACTGGGAGATGCAGACCGG + Intergenic
1199704001 X:150408216-150408238 CATCACTGGGAGAGGGTGACTGG + Intronic
1199990137 X:152982911-152982933 CCACTGTGGGTGAAGGAGTCGGG + Intergenic
1200033302 X:153313047-153313069 CCACTGTGGGTGAAGGAGTCAGG + Intergenic
1200035829 X:153329218-153329240 CCTTAGTCAGTGAAGGAGACCGG + Intergenic
1201167992 Y:11228566-11228588 TCTCACTGGGTGCTGCAGACCGG + Intergenic