ID: 1112150747

View in Genome Browser
Species Human (GRCh38)
Location 13:96760172-96760194
Sequence TGTTTTATATTGCACTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112150747 Original CRISPR TGTTTTATATTGCACTACCA TGG Intronic
903532653 1:24043593-24043615 TGCTTTAGATTGCATTACCAAGG - Intergenic
905365579 1:37449433-37449455 TGTTTTATATTGAAATTCCCCGG + Intergenic
908264328 1:62363307-62363329 TGTTTTCTATTGTACTCCCAGGG + Intergenic
908381802 1:63603900-63603922 TGTTGTATATAGAACTTCCAGGG - Intronic
908969203 1:69806667-69806689 TGTTTCTTATTGCATTACCATGG + Intronic
909689068 1:78385667-78385689 TGTTATATATTGCATTATTAAGG + Intronic
911036959 1:93560678-93560700 TGTTTTCTATTCCATTAACAGGG + Intergenic
911277249 1:95877578-95877600 TCTTTGATAGTGCAGTACCATGG + Intergenic
911604076 1:99881687-99881709 ATTTTTAGATTGCATTACCAGGG - Exonic
911802473 1:102159653-102159675 TGTTCTAATTTTCACTACCAGGG - Intergenic
911974546 1:104474894-104474916 TGTTTTATATTTCTTTACCTTGG + Intergenic
912296063 1:108472065-108472087 TGTTTAACATTGCACTAAAAAGG + Intergenic
913207557 1:116554906-116554928 TCTTTTCTGTTGCACTTCCAAGG + Intronic
914772005 1:150695607-150695629 TTTTTTATAATGTAGTACCATGG - Intronic
916807318 1:168271094-168271116 TGTTATATATTGGCCTGCCATGG - Intergenic
919014953 1:192020524-192020546 TATTTTATATTTCAGTACAAAGG - Intergenic
919705076 1:200668736-200668758 TGTTTTATATTGGACTTAAAAGG - Intronic
920262989 1:204702489-204702511 TCTTCTATATTCCACTTCCATGG - Intergenic
921686268 1:218092508-218092530 TGTCTTATATTGTAAAACCATGG + Intergenic
922673372 1:227532271-227532293 TTCTTTGTATTCCACTACCAGGG + Intergenic
923345252 1:233045395-233045417 GGTTTCATTCTGCACTACCAAGG - Intronic
1066075942 10:31876707-31876729 TGTTTTATATTTCTCTTCCTGGG - Intronic
1068149951 10:53118982-53119004 TCTTTTTTATTGCAATACCATGG + Intergenic
1068446562 10:57132375-57132397 TCTTTTATATTTCAATACCGTGG + Intergenic
1069023424 10:63514980-63515002 TGTTTTGTAATGCAGTACTAGGG + Intergenic
1070228544 10:74538730-74538752 TGTTATATATTTTACTGCCATGG + Intronic
1071807614 10:89142137-89142159 TTTTATATATTATACTACCAAGG + Intergenic
1077397847 11:2334013-2334035 TGGTTGATATTGCACAACCAGGG + Intergenic
1078478250 11:11652946-11652968 TGTTTTATATTGCTGTAAAAAGG - Intergenic
1091941049 12:4482297-4482319 TGTTTTATTTTGCATTTCCCTGG - Intergenic
1093523759 12:20081879-20081901 AGTTTTATATTCAACTTCCATGG - Intergenic
1095794547 12:46203575-46203597 TGTTCCATATTGCACTACTTTGG + Intronic
1096015445 12:48269045-48269067 TATTTTATATAGCATTGCCAGGG + Intergenic
1097702643 12:62835866-62835888 TATTTTATTTTGCACTTCAAAGG + Intronic
1097724336 12:63057770-63057792 TGTTTTATAATGCACGCACATGG + Intergenic
1097735209 12:63174990-63175012 TGTGTTATATTTCACTAGTAAGG - Intergenic
1102907632 12:116688885-116688907 TGTTTTTTATTTCCCCACCAGGG - Intergenic
1107001031 13:35545795-35545817 TAGTTTAATTTGCACTACCATGG - Intronic
1108476961 13:50829762-50829784 TGTTTTATTTTTCCCTACCCTGG - Intronic
1110964444 13:81675551-81675573 TTTTTTTTTTTGCACTTCCAGGG + Intergenic
1111137857 13:84073366-84073388 GGTTATATAATGCACTTCCATGG - Intergenic
1111589562 13:90326190-90326212 TGTTTTATTTATCACTAACAAGG - Intergenic
1112150747 13:96760172-96760194 TGTTTTATATTGCACTACCATGG + Intronic
1112262978 13:97894652-97894674 TGTTTCAGATTGCTCTTCCAAGG - Intergenic
1114756815 14:25269254-25269276 TCTTTTATATTTGGCTACCAGGG + Intergenic
1115579751 14:34746235-34746257 TGTTTTATATAGAACGTCCAGGG + Intergenic
1117357623 14:54940593-54940615 TATTTTATATTGAACAAACAAGG - Exonic
1118156887 14:63251121-63251143 TGTTTTATATTTTCCTAGCAAGG + Intronic
1121420385 14:93809018-93809040 TGTTTTATTTTGCTTTCCCAGGG + Intergenic
1124217800 15:27823871-27823893 TGATTTACATTGCAATACTAAGG + Intronic
1125004290 15:34799993-34800015 TGTTTTATATGCAACCACCAAGG + Intergenic
1127332464 15:57952285-57952307 TGTTTTCTATTACATTACTAGGG + Intergenic
1128400816 15:67278877-67278899 TTTTTTACATTGCTCTCCCATGG + Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1131720179 15:95159620-95159642 TGTTTCATAATGTACTACCTGGG - Intergenic
1137902858 16:52287879-52287901 TGTCTTATACTGCAGTACCAAGG + Intergenic
1141215320 16:82018390-82018412 AATATTATATTGCACTCCCATGG - Intergenic
1143284390 17:5778430-5778452 TTTTTTCTATTGCACTTCTAAGG - Intronic
1145197428 17:20907224-20907246 TGTTGTATATTTTACTACAATGG + Intergenic
1145887908 17:28395737-28395759 TATTTTTTATTACACTACAAGGG + Exonic
1147018553 17:37512204-37512226 TGTTTTATTTTCCTCCACCAAGG - Exonic
1148011701 17:44487804-44487826 TGTTTTGTGCTTCACTACCAGGG + Intronic
1149120639 17:53159626-53159648 ATTTTTATATTGAACTGCCATGG - Intergenic
1150906922 17:69347814-69347836 TCTTTTTTATTGCAATGCCATGG - Intergenic
1153138286 18:1942474-1942496 TGTTTTTTATTGCACTTAAAAGG + Intergenic
1153882063 18:9430144-9430166 TGTTTTATATGGTACTTACATGG - Intergenic
1155353199 18:24926605-24926627 TTTTTTATTTTGCACCACCCTGG + Intergenic
1157238298 18:45984633-45984655 TATTTTATGTTGCACTAAGAAGG - Exonic
1157636287 18:49158331-49158353 TGTTTTACATTACTTTACCATGG - Intronic
1157996235 18:52559586-52559608 TATTTCATATTGCAGTACCTTGG - Intronic
926635656 2:15176122-15176144 TATTTTTCATTGCAATACCAAGG + Intronic
931070408 2:58641636-58641658 TGTTTTATTTTGCAATAAGAAGG + Intergenic
931086705 2:58839648-58839670 TTTTTTTTATTGCACTGCCTTGG + Intergenic
937748911 2:125450079-125450101 TGTTTTATATTTCAGTCCGAAGG + Intergenic
939372778 2:141323833-141323855 TGTTTTCCTTTGCACTACCATGG - Intronic
939592051 2:144076778-144076800 TGTTTTATACTGTGCTATCAAGG + Intronic
939742943 2:145932806-145932828 TGTTATGTATTGTATTACCAAGG - Intergenic
941014689 2:160341727-160341749 TGTTTTAAACTGAACTAGCAAGG + Intronic
941366597 2:164618277-164618299 TTTTTTTTTTTCCACTACCATGG + Intronic
942822858 2:180136791-180136813 TGTTTTATGTTACAGGACCAAGG - Intergenic
943246592 2:185460852-185460874 TGTTTTACATTGCACTTCTGAGG - Intergenic
944334592 2:198516235-198516257 TGTTTTCTATTGCTCTTACATGG + Intronic
945619703 2:212119670-212119692 TGTTTAACATTCAACTACCAAGG - Intronic
946065866 2:216986669-216986691 TGTTTTATTTTGCAATAAAAGGG + Intergenic
946318761 2:218935651-218935673 AGTTTTATAATTCACTAACATGG + Intergenic
946544913 2:220729390-220729412 TTTTTTCTTTTGCACTATCAAGG - Intergenic
946959935 2:224973865-224973887 TGATTTACATTGCATTGCCATGG - Intronic
1170437703 20:16347514-16347536 TCTTTTATATTGCCCTTCCTTGG - Intronic
1172348801 20:34224755-34224777 TGGTTGATATTGCACAACCAGGG + Intronic
1177051138 21:16235488-16235510 AGTTTTATATTAGAATACCATGG + Intergenic
1177645025 21:23890178-23890200 TATTTTATAATGCTTTACCAGGG - Intergenic
1181590374 22:23880949-23880971 TGTTATATAGTGCAGTAACACGG - Intronic
956053388 3:65273203-65273225 TGTTTTAATTTGCAGTACCCTGG - Intergenic
956278137 3:67526169-67526191 CCTTTTATAAAGCACTACCAGGG + Intronic
957004091 3:74923482-74923504 TCTTTTATATTGCCATGCCAAGG - Intergenic
957392712 3:79598656-79598678 TCTTTTGTATTGAGCTACCAGGG - Intronic
958063503 3:88513043-88513065 TGTTTAAAATAGAACTACCATGG + Intergenic
959255398 3:104004741-104004763 TGTTTGATGATGCACTATCAGGG - Intergenic
964091472 3:152881328-152881350 TGTTTTATACTGCACAATCCAGG - Intergenic
965200663 3:165653960-165653982 TCTTTTTTACTGCAATACCATGG + Intergenic
970501421 4:16681007-16681029 TGTATTATATTGAATAACCAAGG - Intronic
970658605 4:18260113-18260135 TCCTTTATCTTCCACTACCAGGG + Intergenic
973088367 4:46098642-46098664 TATTTTATGTTGGACTACCCTGG + Intronic
975266639 4:72376814-72376836 TGTCTTGTATTTCACTGCCAAGG + Intronic
975603357 4:76126476-76126498 TGTTTTATATTACAAAACCTAGG + Intronic
976926849 4:90509339-90509361 TGTTTTTTATTACACTTCCCAGG - Intronic
977230631 4:94448249-94448271 TGTTTTATAATGAATTGCCACGG - Intergenic
977407073 4:96613112-96613134 TTTTTTATATTGATCTACCTTGG - Intergenic
977892213 4:102325536-102325558 TGTTTTATGATGCACTGCTAGGG + Intronic
978198336 4:105996077-105996099 TGTATTGTATTGCACTAACAAGG + Intronic
981845274 4:149160705-149160727 TGTTTTATTTTGCACGTGCATGG + Intergenic
982617342 4:157655903-157655925 TGTTCAATATTGAACTACTAAGG - Intergenic
983981085 4:173998232-173998254 TGTGTTATCTTTCACTTCCAAGG - Intergenic
990786136 5:59422343-59422365 TGTTTCATATTGCCCTAAGAAGG - Intronic
991382282 5:66042247-66042269 TATTTTGTATTGCACAACTATGG + Intronic
992888314 5:81181131-81181153 TGTTATAAATGGCACTCCCATGG + Intronic
992891481 5:81208333-81208355 TGTTTTGTTTTGAACTTCCAGGG + Exonic
993535410 5:89078645-89078667 TAATTTATATTGCTTTACCAAGG - Intergenic
1003546370 6:7062855-7062877 TGTTTTGTAAGGCACTACCTGGG + Intergenic
1003852940 6:10243343-10243365 TGATTTATATTCCATCACCAAGG - Intergenic
1004954813 6:20717612-20717634 TATTTTATATTGCTCTAATAAGG - Intronic
1005211066 6:23464321-23464343 TATTTTATATATTACTACCATGG + Intergenic
1012824744 6:104133128-104133150 TGTTTTATCTTGCACTTTTATGG - Intergenic
1013992023 6:116265011-116265033 TGTTTCATATTGCAGCAACAGGG + Intronic
1014650505 6:124030538-124030560 TGTTATATATTGGATTTCCATGG + Intronic
1015620940 6:135130947-135130969 TGCTTTATATAGCACTAAAATGG + Intergenic
1016201953 6:141421187-141421209 TGTTTTTTATGGCACTACTTAGG - Intergenic
1018012064 6:159680182-159680204 TGGTTTGTATTGAACTAACAAGG - Exonic
1020571295 7:9866201-9866223 TGTTTAATATTTCACTAGAATGG - Intergenic
1021331912 7:19348946-19348968 TGTTTTATATTTCCCTGCCTTGG + Intergenic
1022407406 7:30104119-30104141 AGTTTTATTTTGCATTACCCTGG - Intronic
1027618848 7:80457696-80457718 TTTTTTTTTTTGCACTACCCTGG - Intronic
1028825008 7:95261841-95261863 TCTATTATATTACACTTCCAAGG + Intronic
1029410721 7:100408521-100408543 TGTGTCATAATGCCCTACCAGGG + Exonic
1030396328 7:108991007-108991029 TGTTTTATATTGGACTTAAAAGG + Intergenic
1037354258 8:18000072-18000094 TGTTTTATATTGGATGATCAGGG + Intronic
1038478059 8:27882728-27882750 TGTTTTATATGCCACTAAGAAGG + Intronic
1039014914 8:33136612-33136634 AGCTTTATATTACAATACCACGG + Intergenic
1040044204 8:42944922-42944944 TATTTTAGATTGCAATACAAAGG - Intronic
1040671049 8:49691250-49691272 TCTTTTATCTTCGACTACCAGGG + Intergenic
1045303661 8:100937646-100937668 TGTTTTAGATTGTACTGTCATGG + Intronic
1045532423 8:102997458-102997480 GGTTTTTTATTGCAATATCATGG + Intergenic
1045619742 8:103961430-103961452 TTTTTTATACTGCACTAATATGG + Intronic
1047515507 8:125551099-125551121 TGATTTATAGTAAACTACCAGGG - Intergenic
1047900578 8:129417461-129417483 TGTTGTATATTCCAATATCATGG - Intergenic
1053231715 9:36416082-36416104 TGTTTTGTTTTACGCTACCAGGG + Intronic
1057373528 9:94496770-94496792 TGTTTTTTAAGGCATTACCATGG + Intergenic
1058477086 9:105347228-105347250 ACTTTTATATTGTACCACCATGG - Intronic
1058865430 9:109157661-109157683 TGTTTGATTTTTCAATACCAAGG + Intronic
1059707255 9:116836774-116836796 TGTTTTATATAGGACATCCAGGG + Intronic
1061218824 9:129237120-129237142 TGTTTAAAATTTCACTACCTGGG - Intergenic
1061305748 9:129732175-129732197 TGTTTTCTTCTGCTCTACCATGG + Intergenic
1190027612 X:46939990-46940012 TGGTTTATTTTACACTACAATGG + Intronic
1191152308 X:57232872-57232894 TTTTTTATGTTGGCCTACCAGGG + Intergenic
1194220964 X:91190677-91190699 TGTGTTTTATTGCACTACCTAGG - Intergenic
1194693544 X:97016372-97016394 TCTTTTATATTGGAATGCCAAGG + Intronic
1195807291 X:108789161-108789183 TGTTTTTTATTGCTCTAGCTAGG + Intergenic
1196507468 X:116464052-116464074 TATTTTATATTCTCCTACCAAGG + Intergenic
1198142442 X:133818139-133818161 CGATTTATATTCCACTAGCAAGG + Intronic
1198869784 X:141164875-141164897 TGTTTTATATTCTACTAAAATGG - Intergenic
1200557471 Y:4654429-4654451 TGTGTTTTATTGCACTGCCTAGG - Intergenic