ID: 1112150752

View in Genome Browser
Species Human (GRCh38)
Location 13:96760241-96760263
Sequence TTGTATCTGAAGATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112150752 Original CRISPR TTGTATCTGAAGATTGAGGA AGG (reversed) Intronic
902051287 1:13565458-13565480 TCTTTCCTGAAGATTGAGGACGG - Intergenic
902075608 1:13782434-13782456 TTGGACCTGAAGGATGAGGAGGG - Exonic
902206347 1:14870970-14870992 TGATATCTGGAGAATGAGGAAGG + Intronic
902293596 1:15451105-15451127 CTGGCTCTGAAGATAGAGGAAGG + Intergenic
904259408 1:29279847-29279869 TGGAATCAGAAGATTGAGGTTGG + Intronic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
905967139 1:42108056-42108078 TGGAATCTGAATGTTGAGGATGG + Intergenic
906548253 1:46638126-46638148 TTTTATCTGAAGCTTGGGGTGGG + Intronic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
909996511 1:82286598-82286620 TTGTCACTTATGATTGAGGATGG + Intergenic
910207800 1:84765205-84765227 TTGACTTTGAAGATGGAGGAAGG - Intergenic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
911237575 1:95427852-95427874 TTTCATCTGAAGACTGAGTATGG + Intergenic
911902500 1:103524056-103524078 TTATATCTGAAGAATGACAAAGG - Intergenic
912672989 1:111648750-111648772 TGGTCTCAGCAGATTGAGGAGGG - Intronic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913400093 1:118422424-118422446 TTCTATCTGAAGGTGGAGGGTGG + Intergenic
915791779 1:158680123-158680145 TTATTTCGGAGGATTGAGGAAGG - Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916561662 1:165938996-165939018 ATGCACCTGAAGATGGAGGAAGG - Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
917750077 1:178045001-178045023 TCTTTCCTGAAGATTGAGGACGG - Intergenic
918124463 1:181570669-181570691 CTGACTCTGAAGATAGAGGAAGG - Intronic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
921892673 1:220368761-220368783 TTGTTTGTGAAGCTTGAGAAAGG - Intergenic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
922995023 1:229949833-229949855 TTGTATGTGTAACTTGAGGAAGG - Intergenic
923292652 1:232561636-232561658 TTCTATCTGTAGAATAAGGAAGG - Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1065483915 10:26218114-26218136 TTTTATCTGAAGATTCTGGCAGG - Intronic
1066088490 10:31994688-31994710 TTGAAGCTGAGAATTGAGGAAGG + Intergenic
1066120985 10:32287063-32287085 TTCTCTATGAACATTGAGGAGGG - Intronic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067334718 10:45350961-45350983 TGGTCTCTAAAGATTGAGCATGG - Intergenic
1069859722 10:71462853-71462875 CTGTGTCTGAAGATTGAGTGGGG - Intronic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1073683910 10:105732229-105732251 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1074551447 10:114446066-114446088 TTCTATTTGAAAATTGAGGCTGG - Intronic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1077470287 11:2755138-2755160 ATGGCTCTGAAGATAGAGGAAGG - Intronic
1078337492 11:10475559-10475581 CTGCATCTGGAGATTAAGGAGGG - Intronic
1082189662 11:49227517-49227539 TAGTATCTGAATATTGATGATGG + Intergenic
1086151500 11:83615693-83615715 TTGATTCTGAAGATGGAAGAAGG + Intronic
1086676864 11:89618983-89619005 TAGTATCTGAATATTGATGATGG - Intergenic
1087383349 11:97437628-97437650 ATGCATCTGTAGTTTGAGGAAGG - Intergenic
1087580650 11:100047749-100047771 TTGAATCAGTAGATTGAGTAAGG + Intronic
1088533595 11:110836860-110836882 TGGGATCAGAAGATTGAAGAAGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090567791 11:128014785-128014807 TTGGAGCTGAATATTTAGGACGG - Intergenic
1090731251 11:129574890-129574912 CTGTATTTGAAGCTGGAGGAAGG - Intergenic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1093728496 12:22542620-22542642 CTGTCTCTGAAGGTTGAGAAAGG - Intronic
1095242275 12:39875298-39875320 TTGGCTTTGAAGACTGAGGAAGG - Intronic
1096202966 12:49698992-49699014 TTTTCTTTGAAGATAGAGGAGGG - Intronic
1096906847 12:54944076-54944098 CTTTTCCTGAAGATTGAGGATGG + Intergenic
1097592774 12:61591900-61591922 CTTTTCCTGAAGATTGAGGATGG - Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097658951 12:62406490-62406512 TGGTCTCTGAAGAATTAGGATGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098818936 12:75206811-75206833 TTGAATCTGAGGACAGAGGAAGG - Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1103642082 12:122359660-122359682 TTCTACCTGAACATAGAGGAAGG + Intronic
1104071153 12:125346704-125346726 TTGGATCAAAAGATAGAGGAGGG - Intronic
1105570385 13:21597151-21597173 TTGTCTCTGAAGTTTAAAGATGG - Intronic
1105718859 13:23094192-23094214 TTATATCTGGAGACAGAGGAGGG + Intergenic
1106928923 13:34642322-34642344 TTGGAGCTGAGGATTGAGGTTGG + Intergenic
1107631836 13:42350711-42350733 TTGGCTTTGAAGATAGAGGAAGG + Intergenic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1110723559 13:78793036-78793058 TTGTGTCAAAAGATTGAGTAAGG - Intergenic
1110945292 13:81406993-81407015 TTGTGTCAAAAGATTGAGGGAGG - Intergenic
1111002147 13:82198330-82198352 TTGTAATAGAAGATGGAGGATGG + Intergenic
1111185109 13:84724525-84724547 ATGTGACTGAAGATTGAGAATGG - Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1112304013 13:98257090-98257112 TAGTATCTGAAGTGTGACGAGGG - Intronic
1112523140 13:100116613-100116635 TGGTATCTAAAAATTGGGGAAGG - Intronic
1113095314 13:106657407-106657429 TCGTTTCTGAGGACTGAGGAGGG + Intergenic
1113232333 13:108226550-108226572 TTTTATCTGAAGAGGGAGAAAGG + Intronic
1113756494 13:112815246-112815268 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113756512 13:112815368-112815390 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1113756523 13:112815448-112815470 GTGTGTCTGAAGGATGAGGAAGG - Intronic
1113756528 13:112815488-112815510 GTGTGTCTGAAGGGTGAGGAAGG - Intronic
1114638771 14:24205103-24205125 TTGTATGTAGGGATTGAGGAAGG + Intronic
1115013303 14:28577325-28577347 GTGTATCTGAGTATAGAGGAAGG - Intergenic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1116857083 14:49962164-49962186 TTATTTCTCAAGATTGAGAAGGG - Intergenic
1117112464 14:52473001-52473023 TTGTATAAGAAGATTAAGGTGGG + Intronic
1118981501 14:70720595-70720617 TTGTATCATAAGATTGAGTTGGG - Intergenic
1119587907 14:75855247-75855269 TTGAATCTGTAGATTGATTAGGG + Intronic
1120858782 14:89235760-89235782 TTGTCTGTGAAGATGGAGGATGG + Intronic
1121727571 14:96164443-96164465 TTGTCTTTGAGGATGGAGGAGGG + Intergenic
1121760184 14:96438389-96438411 TTATATAGGAAGGTTGAGGAAGG + Intronic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122453283 14:101829353-101829375 TGGTAGCTGGAGATTGAAGAAGG - Intronic
1125074914 15:35602678-35602700 TTGAATCTGCAGATTAAGTAAGG - Intergenic
1125133919 15:36318459-36318481 TTCTTTCAGAAGATAGAGGAAGG - Intergenic
1125573521 15:40739178-40739200 TTGTTTCTGAAGACAGATGATGG - Intronic
1126753851 15:51905199-51905221 TGGTATCAGCAGATTGAGGCCGG + Intronic
1127151542 15:56080651-56080673 TTCTATCTAATGAATGAGGAAGG - Intergenic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1128949954 15:71868291-71868313 ATGTCTCTGAAGATGGAGAAAGG - Intronic
1129022932 15:72539817-72539839 CTCTATATGAATATTGAGGAGGG + Intronic
1130304954 15:82707201-82707223 CCTTTTCTGAAGATTGAGGATGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1135835164 16:25818860-25818882 TGATATCTGAAGACAGAGGATGG + Intronic
1136032431 16:27513540-27513562 TTAGATCTGAAGACAGAGGAAGG + Intronic
1137470166 16:48747179-48747201 TTGTAACTGGAGATAGAGGTGGG + Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1140593998 16:76386951-76386973 TTGGCTTTGAAGATAGAGGAAGG + Intronic
1140923909 16:79564980-79565002 TTACATCTGAAGCTTGAGAATGG + Intergenic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141317306 16:82974723-82974745 CTGTCTTTGAAGATAGAGGAAGG + Intronic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1143813131 17:9488607-9488629 TTGTCTTTGAAGACGGAGGAAGG + Intronic
1144673297 17:17145165-17145187 CTGTCTCTGAGGAGTGAGGAAGG - Intronic
1146905270 17:36613979-36614001 TTGTATGTGAGGATTAATGATGG + Intergenic
1149773861 17:59342169-59342191 TTGTATTGGCAGATTTAGGATGG + Intronic
1150193544 17:63269693-63269715 TAGTATCTGAAGATTTAATAAGG + Intronic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1155112537 18:22730299-22730321 CTGTTTCTGAGGATTTAGGAGGG - Intergenic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155923552 18:31629915-31629937 CTGTATCTGAACTTTGAGTATGG - Intronic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1157941320 18:51931900-51931922 CTGAATCTGAATATTGAGAACGG + Intergenic
1158097975 18:53796496-53796518 TGGGAATTGAAGATTGAGGATGG - Intergenic
1159792967 18:72806777-72806799 TTGGATGTGAAGATTGATTATGG - Intronic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1161495957 19:4585702-4585724 TTGTCACTGAAGATCCAGGAGGG + Intergenic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1167065279 19:47180961-47180983 TTGGATCTGAGAATAGAGGAAGG + Intronic
1167917719 19:52755653-52755675 CCTTTTCTGAAGATTGAGGACGG - Intergenic
1168455475 19:56504365-56504387 TTATTTCTGGAGAATGAGGATGG - Intergenic
927479691 2:23442485-23442507 TTGTCTTTGAAGATGGAGGAAGG + Intronic
927955679 2:27205846-27205868 TGGTATATGAAGGTAGAGGATGG - Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
929061528 2:37929959-37929981 TATTATGTGAATATTGAGGAAGG + Intronic
929193569 2:39162794-39162816 TTGTATTTGGAAATTGAAGAGGG + Intergenic
929827876 2:45323756-45323778 TGGTATTTGAAGATTGTGTATGG + Intergenic
930513302 2:52373599-52373621 TTGAAGCTGAAGATGTAGGATGG + Intergenic
930706976 2:54514491-54514513 TTATCTCTGAATATTGAGAATGG + Intronic
931303110 2:61000590-61000612 TTTATTCTGAAGATGGAGGAAGG - Intronic
933143110 2:78817902-78817924 TTTTCTCTGAAGAATGAGGAAGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935785731 2:106547166-106547188 ATGAATCTGCAGTTTGAGGAGGG + Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937495441 2:122414263-122414285 TTGTAGCTGAAGACTGAGGGAGG + Intergenic
938152479 2:128899469-128899491 TTGCAACTGAGGATTGTGGAAGG - Intergenic
938231022 2:129659179-129659201 TTAGATCTGAAGATTAATGAGGG + Intergenic
938543401 2:132305238-132305260 TTGTCTCTGGAGATAGAGGATGG + Intergenic
938749443 2:134314682-134314704 TTTTAGCTGAAGAAAGAGGAAGG + Intronic
940183369 2:150958084-150958106 CTTTTCCTGAAGATTGAGGATGG - Intergenic
940275759 2:151938977-151938999 TTATATCTGCAGATAGAGAAAGG - Intronic
940322539 2:152392136-152392158 TTGTACCTAAACATTGTGGAAGG + Intronic
941234748 2:162957128-162957150 TTGTAGCAGAAGCTGGAGGAGGG - Intergenic
941268983 2:163401489-163401511 TTGTTTCTGAGGGTTGAGGGAGG + Intergenic
941865849 2:170333557-170333579 TTGGATCTGAAGAGAGAGCAGGG - Intronic
941903377 2:170698361-170698383 TTATATGTGAAGTTTGAGAAGGG - Intergenic
943060154 2:183034682-183034704 TTGCTTCTGAAGGTAGAGGATGG - Intronic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
943426310 2:187739781-187739803 TTGACTTTGAAGATGGAGGAAGG - Intergenic
943442828 2:187947261-187947283 TTGTATGTTATGATTGAAGAGGG + Intergenic
943721881 2:191213112-191213134 TATTATCTGAATATTGAAGAAGG - Intergenic
944344611 2:198647112-198647134 TTGTATTTGAATATTTGGGAGGG + Intergenic
944617399 2:201475850-201475872 TTGTAAGTGAAAATTGAGGGAGG + Intronic
944853192 2:203741440-203741462 TTGCATCTGGTGACTGAGGAAGG + Intergenic
946564713 2:220951177-220951199 TTGTATCTTAAGATTTTGAAAGG - Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169466196 20:5842250-5842272 TTTTATCTGAAGGTAGAGGAAGG - Intronic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170680004 20:18518056-18518078 CCGTTCCTGAAGATTGAGGATGG + Intronic
1170843714 20:19944705-19944727 TTCCATCTGAAAGTTGAGGATGG + Intronic
1171872289 20:30538089-30538111 TTGTCTCTGGAGATAGAGGATGG + Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172881697 20:38204088-38204110 TGGTATCTGAAGGATAAGGAGGG + Intergenic
1173016126 20:39227442-39227464 GTGTATCTGAAGAGGGAGGCAGG - Intergenic
1173306870 20:41858826-41858848 TTTTATCTGGTGATTGAGGGTGG + Intergenic
1173531868 20:43775938-43775960 ATGTATGTGATGAGTGAGGAAGG - Intergenic
1173652514 20:44675784-44675806 TCTTTCCTGAAGATTGAGGACGG - Intergenic
1173746535 20:45441738-45441760 TTGTATCTGAAGTGAGAGCAGGG + Intergenic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1175019929 20:55835075-55835097 CTGATTTTGAAGATTGAGGAGGG - Intergenic
1175989842 20:62782965-62782987 TTTGCTCTGAAGATGGAGGATGG + Intergenic
1176905920 21:14501045-14501067 ATGTATCTGTAGACTGAGGTGGG + Intronic
1177780673 21:25619609-25619631 TTTTATTTGAAGATTAAGTATGG - Intergenic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1179536021 21:42052958-42052980 TTGCTTCTGAAGATTGAAGGGGG - Intergenic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1184424164 22:44399351-44399373 TTCTATCTGAAGGTGGAGGTGGG + Intergenic
1184720102 22:46307190-46307212 TTTCATCTGAGGATTCAGGAAGG + Intronic
949105128 3:194403-194425 TTCTCTCTGATAATTGAGGACGG - Intergenic
949405622 3:3711328-3711350 TTGGATGTGAGGAGTGAGGAAGG - Intronic
949436311 3:4033246-4033268 TTGGCTCTGAGGACTGAGGAAGG + Intronic
949444472 3:4119144-4119166 TCTAATCTGAAGGTTGAGGAAGG - Intronic
951371850 3:21859074-21859096 TCATATCTGAGGTTTGAGGAAGG + Intronic
951594444 3:24301896-24301918 TTGACTTTGAAGATGGAGGAAGG + Intronic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
953091785 3:39734531-39734553 TGTAATCTGAAGATTGAAGATGG - Intergenic
956342831 3:68246030-68246052 TTGACTCTGAAGATAGAGCAGGG - Intronic
956454949 3:69411269-69411291 TTGTTTCTCAAAATTGAAGAAGG + Intronic
956662587 3:71613906-71613928 TTAGTTTTGAAGATTGAGGAAGG - Intergenic
957742203 3:84285526-84285548 TTATATCTCATGAGTGAGGAGGG + Intergenic
957904393 3:86538677-86538699 CTTTTTCTGAAGATTGAGGATGG + Intergenic
959007842 3:101040526-101040548 GTGTATCTGAGGAATGAGGAGGG - Intergenic
959187691 3:103067489-103067511 TTGCTTCTTAAGATTGAGGTAGG - Intergenic
959469274 3:106729600-106729622 TTTTCTTTGAATATTGAGGAAGG - Intergenic
959529563 3:107417596-107417618 TTGTTTCTGAAGTTTGAATATGG - Intergenic
960093406 3:113665070-113665092 TTGTATATGGAGGTTGGGGAAGG + Intronic
961145527 3:124589814-124589836 TTGTATCTGAAGATTCAATAAGG - Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962729094 3:138263139-138263161 TTGTATCTAGACATTGATGAAGG + Intronic
963089621 3:141471085-141471107 TGGTCTCAGCAGATTGAGGAGGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
967236467 3:187389343-187389365 TTCTATTTGAAGAATGATGATGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
970018083 4:11535052-11535074 TTGCATTTGGAGATGGAGGAGGG + Intergenic
970187171 4:13469505-13469527 TTGGAACTGAAGTTGGAGGAAGG - Intronic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971357144 4:25905465-25905487 TTGTATCTTAACATGGTGGAAGG - Intronic
971425973 4:26515878-26515900 CTGGATGTGAAGCTTGAGGAGGG + Intergenic
971968228 4:33590897-33590919 TTGGTTTTGAAGATTGATGAGGG + Intergenic
972045970 4:34664576-34664598 TTGTGTCTGAATTTGGAGGAGGG + Intergenic
972657660 4:41080444-41080466 CTGTCTCTGAAAACTGAGGACGG + Intronic
974786045 4:66620549-66620571 TTGTATCAGTAGATTGAGTAAGG + Intergenic
974987377 4:69044583-69044605 TTGTATTTGAAGCTTGAAGTTGG + Intronic
975450546 4:74520209-74520231 ATGTATATGAGGATTGGGGATGG - Intergenic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976336416 4:83893244-83893266 TTTTAGGTGAAGGTTGAGGAAGG - Intergenic
977777400 4:100937335-100937357 TTGTTTCTGAATTTTGGGGAAGG + Intergenic
978723593 4:111944315-111944337 TGATATCTGAAGTATGAGGAGGG - Intergenic
979000931 4:115218283-115218305 ATGTATCTGAAGTTTGAGAAAGG + Intergenic
979165573 4:117525743-117525765 TTGTATTTGAGGATTGAGGAGGG - Intergenic
980636667 4:135514662-135514684 TTATCTCTGAAGAGTGAGGATGG - Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981276266 4:142901131-142901153 TTGAACCTGAAGAGTCAGGATGG - Intergenic
982722020 4:158869154-158869176 TTGTATGTGAAGGCTGCGGAAGG + Exonic
985413331 4:189710004-189710026 TTGAATCTGAAGGCTGAGCAGGG + Intergenic
986216772 5:5726804-5726826 TTGTGTCTGAAGAGTGTGGAAGG + Intergenic
986527356 5:8694472-8694494 TTGTCTCTGTAGACTCAGGAAGG + Intergenic
987642559 5:20631501-20631523 TTGTATCTGAAAAAAAAGGAAGG + Intergenic
987769660 5:22284398-22284420 TCTCATCTGAAGACTGAGGATGG + Intronic
988798327 5:34673376-34673398 TTGAATCTGCAGGTTAAGGAGGG - Intronic
989177638 5:38544337-38544359 GTGTATGTGAAGAGTGTGGAAGG - Intronic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990080848 5:51911791-51911813 TTTTATCTGAGGACTGAGAATGG + Intergenic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
993216714 5:85033779-85033801 TTGTTTATGCAGATTAAGGATGG + Intergenic
994870130 5:105337363-105337385 TGGTACCTGAAGGTTGGGGAGGG + Intergenic
995164491 5:109023210-109023232 TTGTATGTGGAGAATGAGGCAGG + Intronic
996047810 5:118895435-118895457 TTGAATCTGAAGATTGCTTAGGG - Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996918060 5:128734367-128734389 CTTTTCCTGAAGATTGAGGACGG - Intronic
997008175 5:129844986-129845008 TTGCATCTGAAAATTGAGTTTGG - Intergenic
998538559 5:142957148-142957170 TTGAATCAAAAGAATGAGGATGG + Intronic
1000549229 5:162638509-162638531 ACTTATCTGAAGATTGAGGGAGG - Intergenic
1004142229 6:13028901-13028923 TTGGATTAGTAGATTGAGGAAGG + Intronic
1004690937 6:17991568-17991590 TGGGATGTGAAGATTGAGGGAGG + Intergenic
1004789716 6:19011475-19011497 TTGGCTTTGAAAATTGAGGAAGG - Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1005857727 6:29875620-29875642 ATGTATCAGAAGACTCAGGATGG + Intergenic
1006325237 6:33348688-33348710 CTTTTTCTGAAGATTGAGGATGG - Intergenic
1008559691 6:52711934-52711956 TTGAATCAGAAGACTGAGTAAGG + Intergenic
1008946317 6:57100958-57100980 TTGTGTCTGGAGATAGAGGATGG - Intronic
1009270203 6:61604995-61605017 CCTTTTCTGAAGATTGAGGATGG - Intergenic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011859277 6:91734983-91735005 TTGTGTCTGCAGTTTGAGAATGG - Intergenic
1012603902 6:101133100-101133122 AAGTATCTGAAGATAGAGCATGG - Intergenic
1016221228 6:141672372-141672394 TTGAATCTGAAGATTGATTTGGG - Intergenic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1019581467 7:1765647-1765669 TGGGCTCTGAAGATGGAGGAAGG + Intergenic
1021769275 7:23982685-23982707 CTGAATCTAAAGATTGAGAAAGG + Intergenic
1022982317 7:35615759-35615781 TTGTATGTGAGGATGGAGGAGGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1028575969 7:92350954-92350976 TTGAATCTGAAAATTCAAGAAGG + Exonic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028714951 7:93955138-93955160 TTGGATGTGAAGAGTAAGGAAGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029024274 7:97399204-97399226 TTGTATCTGAAGACTGAGTTAGG + Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1033464601 7:141579286-141579308 CCTTTTCTGAAGATTGAGGAAGG + Intronic
1033932318 7:146539280-146539302 GGGTTTCTGAAGAATGAGGAAGG + Intronic
1036154316 8:6327614-6327636 TTGAATCTGTAGACTGAGTAAGG - Intergenic
1036625296 8:10466114-10466136 TTGACTTTGAAGATGGAGGAAGG + Intergenic
1038566851 8:28626776-28626798 TTGCCTCTGAAGACTGAGGTGGG + Intronic
1039719606 8:40149241-40149263 TTGTCTTTGAAGATGGAGGAAGG - Intergenic
1039974711 8:42352655-42352677 TTGTATCTACTGATTGAGAATGG - Intronic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041674685 8:60526354-60526376 TTGGTTGTGAAGATGGAGGAAGG - Intronic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1045031240 8:98138456-98138478 TGAAATCTGAAGAATGAGGAAGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046094991 8:109547135-109547157 TTGTATTTGAAGGCTGAGGCAGG - Intronic
1048034248 8:130662109-130662131 TTCCATCTAAAAATTGAGGAGGG + Intergenic
1048687517 8:136920267-136920289 TTGTCTTTGAAGATGGAGGAAGG + Intergenic
1052480122 9:29013325-29013347 TTGCATCTGAAAAGTGAGTAAGG - Intergenic
1053103091 9:35387989-35388011 TTCAATCTGAATTTTGAGGAAGG + Intronic
1055844461 9:80544680-80544702 TTTGACTTGAAGATTGAGGAAGG - Intergenic
1056363283 9:85880121-85880143 CCTTTTCTGAAGATTGAGGACGG + Intergenic
1059476503 9:114551849-114551871 TTGTAGGTGAAGATGGAGAATGG - Intergenic
1186964769 X:14775318-14775340 TTGTATTGAAAGATAGAGGAAGG - Intergenic
1187177847 X:16912994-16913016 TTTAATCTGAAGTTTGTGGATGG + Intergenic
1187555476 X:20347058-20347080 TTGTCTCTGCATCTTGAGGATGG + Intergenic
1188769962 X:34141149-34141171 TTGAAACTGAAAATTGAGAAGGG - Intergenic
1188890366 X:35604651-35604673 TTTTATATTAAGATTGATGAAGG - Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189249423 X:39588463-39588485 TTTTAACTGCAGCTTGAGGAGGG + Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190577208 X:51852145-51852167 TTATGTCTGAAGATGGAGAAAGG - Intronic
1191882644 X:65857937-65857959 TTGCCTCTGAAGATGAAGGAAGG - Intergenic
1192268859 X:69559599-69559621 TTGGATGTGGAGAATGAGGAAGG + Intergenic
1194912434 X:99663509-99663531 TTGTATCTGAAAATTGAGTTTGG + Intergenic
1194944034 X:100047209-100047231 TTGAATCTGTAGACTGAGTAAGG - Intergenic
1195326443 X:103762342-103762364 CCTTTTCTGAAGATTGAGGATGG + Intergenic
1198053046 X:132967165-132967187 TTGTCACTGCAGATTGAGGGTGG - Intergenic
1199073378 X:143503754-143503776 CTTTTCCTGAAGATTGAGGACGG + Intergenic
1199611635 X:149621750-149621772 TTGACTTTGAAGATGGAGGAAGG - Intronic
1199839840 X:151633609-151633631 ATGTAGCTGAAGATGGAGTATGG - Intronic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201910277 Y:19126796-19126818 GTGTACCTGAAACTTGAGGATGG + Intergenic