ID: 1112154462

View in Genome Browser
Species Human (GRCh38)
Location 13:96802219-96802241
Sequence TGAATCACGTAAATCCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112154462_1112154465 7 Left 1112154462 13:96802219-96802241 CCTATCAGGATTTACGTGATTCA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1112154465 13:96802249-96802271 CTGGAAACCAGAAGAAAATCAGG 0: 1
1: 0
2: 2
3: 50
4: 584
1112154462_1112154468 13 Left 1112154462 13:96802219-96802241 CCTATCAGGATTTACGTGATTCA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1112154468 13:96802255-96802277 ACCAGAAGAAAATCAGGGCTGGG 0: 1
1: 0
2: 5
3: 38
4: 355
1112154462_1112154466 8 Left 1112154462 13:96802219-96802241 CCTATCAGGATTTACGTGATTCA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1112154466 13:96802250-96802272 TGGAAACCAGAAGAAAATCAGGG 0: 1
1: 3
2: 15
3: 143
4: 911
1112154462_1112154467 12 Left 1112154462 13:96802219-96802241 CCTATCAGGATTTACGTGATTCA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1112154467 13:96802254-96802276 AACCAGAAGAAAATCAGGGCTGG 0: 1
1: 0
2: 5
3: 37
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112154462 Original CRISPR TGAATCACGTAAATCCTGAT AGG (reversed) Intronic
913484019 1:119317080-119317102 TGACTCCCGTAAATACTGATGGG - Intergenic
924450507 1:244174708-244174730 TGAATAATTTAAATCATGATTGG + Intergenic
1066239611 10:33520852-33520874 TGAAGCACGTAATTCCTCTTGGG + Intergenic
1071747658 10:88440094-88440116 TTTATCACATAAATCCTGTTAGG - Intronic
1096835617 12:54349207-54349229 TGGATCCCGCAAAGCCTGATGGG - Intronic
1099193535 12:79586286-79586308 TGAAAAACGTAAATCATGATTGG - Exonic
1100823179 12:98450896-98450918 TGAATCACATAAATCTATATGGG + Intergenic
1103608319 12:122105036-122105058 TAAATCACGTGAGTCCTGAAAGG + Intronic
1106938618 13:34751559-34751581 TGACTAAGGTAAATCCTGAGTGG - Intergenic
1108327865 13:49352115-49352137 TGACTCACTTAAATCCTAAGTGG + Intronic
1110358178 13:74593294-74593316 TGAGTCACTAAAATCCTGATTGG - Intergenic
1110520212 13:76466892-76466914 TTAAACACGTAATTGCTGATGGG - Intergenic
1111323546 13:86662360-86662382 TGAATTACGAAAATCTTCATAGG - Intergenic
1111765889 13:92528553-92528575 TAAATCACTTAAATTTTGATAGG - Intronic
1112154462 13:96802219-96802241 TGAATCACGTAAATCCTGATAGG - Intronic
1117467464 14:56007649-56007671 TGAATGACGTCAATGCTGAAGGG - Intergenic
1126304566 15:47240733-47240755 TGAATCATGTACATAATGATTGG + Intronic
1133217797 16:4304002-4304024 TGAATCACGTGATTCCCGACAGG + Intergenic
1133555939 16:6906590-6906612 TGTTTCCAGTAAATCCTGATAGG + Intronic
1133641844 16:7724711-7724733 TAAATCAATTAAATCCTTATGGG - Intergenic
1134530752 16:14981308-14981330 TGAACAAGGTAAATCCTGAATGG + Intronic
1139865597 16:70059719-70059741 TGAACAAGGTAAATCCTGAATGG - Intergenic
1151081550 17:71335204-71335226 TAAATTTCGAAAATCCTGATAGG + Intergenic
929296185 2:40249732-40249754 CGAATCACTTAAATACTGAGAGG + Intronic
931456613 2:62414515-62414537 TGAATCAAGTATAGCCTGAGTGG + Intergenic
932500617 2:72179848-72179870 TGAACCTACTAAATCCTGATAGG + Intronic
942860450 2:180603820-180603842 TGGTTCAAGTAAATCCTGAATGG + Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
943733190 2:191325072-191325094 TGGACCACCTCAATCCTGATTGG + Intronic
1179395759 21:41038981-41039003 TGAAACAAGTAAAATCTGATTGG + Intergenic
949925065 3:9034405-9034427 TGAATCTCATTAATCCTGATTGG - Intronic
951608750 3:24467378-24467400 GGAATCACGAATATCCTTATTGG + Intronic
953339923 3:42124840-42124862 TGAAACACTTATATCCTTATGGG - Intronic
959831869 3:110873751-110873773 TGACTCACATAAATTTTGATTGG + Intergenic
967344357 3:188437380-188437402 TCAATCACATAAATCCTTCTTGG + Intronic
967530588 3:190545063-190545085 ATATTCACGTAAATCCTGGTAGG - Intronic
972428802 4:38960635-38960657 AGAATCAGGTTAATCCTGATTGG + Intergenic
973572905 4:52258447-52258469 TGAATCACCTAGATCCAGAAAGG - Intergenic
973848900 4:54941607-54941629 TGCATCACTTGAATCCTGTTTGG + Intergenic
980342951 4:131574794-131574816 TGTATCACATAGATGCTGATAGG - Intergenic
982376398 4:154695768-154695790 TGATTGAAGTAAATCCTTATTGG + Intronic
983506654 4:168560575-168560597 TGAATCACTTAAATCATTTTAGG - Intronic
984578359 4:181477822-181477844 TGAATCACGTGAATACTTAAAGG + Intergenic
987769891 5:22287991-22288013 TCAATCAAATAAATCCTGAATGG + Intronic
990806084 5:59663820-59663842 TGAACCATATAAAGCCTGATGGG + Intronic
995859473 5:116626496-116626518 AGAATTACGTAATTCCTCATGGG - Intergenic
996915128 5:128703211-128703233 TGACTCAGGTAGATCCAGATGGG + Intronic
997136174 5:131328883-131328905 TGCATCAGGCAAATTCTGATTGG + Intronic
997581159 5:135018090-135018112 GGAATCACCTAAATGCTCATTGG + Intergenic
1011132201 6:84063307-84063329 TGAATCATCTAAATCCTTTTGGG - Intronic
1017009134 6:150051013-150051035 TGAATCACGTCAATGTGGATGGG + Intergenic
1018488068 6:164262652-164262674 TGAATCACACAATGCCTGATCGG + Intergenic
1027655191 7:80921321-80921343 TGAATCATAAAAATACTGATAGG + Intronic
1033040596 7:137914240-137914262 CTAATCACGAAAATCCTGGTAGG + Intronic
1033895536 7:146064971-146064993 AGAAGCACATAAATCCTAATTGG - Intergenic
1046589471 8:116188636-116188658 TGAATCAAGGAAATTCTGGTGGG - Intergenic
1048646030 8:136420696-136420718 TGAATCAAGTAAAGCATGATAGG - Intergenic
1051870405 9:21730858-21730880 TGAAGAACCTAAATCCTAATAGG - Intergenic
1185829815 X:3289973-3289995 TGATGCAGGTAAATCCAGATAGG + Intergenic
1188533749 X:31171611-31171633 TGAACCAAGTAAATGCTGACCGG - Intronic
1189200355 X:39190235-39190257 TGAATCACTAAAATTGTGATTGG - Intergenic
1194705809 X:97174164-97174186 TACTTCACATAAATCCTGATAGG + Intronic
1196131857 X:112165507-112165529 TGAATCACCTATTTCCTGCTGGG + Intergenic
1196586152 X:117430652-117430674 AGAATAATCTAAATCCTGATAGG + Intergenic