ID: 1112156395

View in Genome Browser
Species Human (GRCh38)
Location 13:96822166-96822188
Sequence GCTGCCAGTGAGACTGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112156393_1112156395 -8 Left 1112156393 13:96822151-96822173 CCGGCTGGGATTAGAGCTGCCAG 0: 1
1: 1
2: 2
3: 36
4: 264
Right 1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG 0: 1
1: 0
2: 1
3: 34
4: 354
1112156392_1112156395 -7 Left 1112156392 13:96822150-96822172 CCCGGCTGGGATTAGAGCTGCCA 0: 1
1: 0
2: 0
3: 22
4: 266
Right 1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG 0: 1
1: 0
2: 1
3: 34
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112156395 Original CRISPR GCTGCCAGTGAGACTGAATT GGG Intronic
900844590 1:5086831-5086853 GCAGTCACTGAGACTGAGTTTGG + Intergenic
901002097 1:6154019-6154041 CCTGCCACTGAGGCAGAATTTGG + Intronic
901088498 1:6626196-6626218 GCTGCTCGGGAGACTGAAGTAGG + Intronic
901356362 1:8652943-8652965 GCTACTTGTGAGACTGAAGTGGG - Intronic
901532792 1:9864022-9864044 GCTGCCAGAGAGCCTAAACTAGG - Intronic
902724665 1:18326771-18326793 GTTTGCAGTCAGACTGAATTTGG + Intronic
903614330 1:24641207-24641229 GCTGCCAGGGAGGCTGAAGCAGG + Intronic
905776111 1:40668308-40668330 GCTACCAGGGAGGCTGAAGTGGG + Intergenic
906239694 1:44235270-44235292 GGTGCAAATGAGCCTGAATTTGG - Intronic
906921659 1:50070971-50070993 AGGGCCAGTGAGACTGAAGTGGG - Intronic
906925111 1:50107616-50107638 GTTGACAGTGAGACAGAACTAGG - Intronic
907497537 1:54854817-54854839 GTTTCCAGGGAGACCGAATTGGG - Intronic
907710588 1:56876944-56876966 ACTCCCAATGTGACTGAATTAGG + Intronic
908591530 1:65641238-65641260 CCTGGAACTGAGACTGAATTTGG + Exonic
908601387 1:65743963-65743985 GCTGCCAGTAAGTTTGAACTGGG - Intergenic
908915725 1:69123454-69123476 ACTGCCAATGTGACTGTATTGGG + Intergenic
909129595 1:71717797-71717819 GATACCAGTGATACTGGATTAGG - Intronic
909732245 1:78907780-78907802 GCAGCCAGTGTGACTGAATATGG + Intronic
910221349 1:84892645-84892667 GATGGCAATGAGACTGAGTTTGG + Intronic
910462311 1:87460728-87460750 ATTGCCAGTGAGACAGTATTGGG - Intergenic
910672735 1:89789342-89789364 GCTACCTGGGAGACTGAAGTGGG + Intronic
911119598 1:94282395-94282417 GCTGCCTGGGAGACTGAGGTGGG - Intergenic
911433262 1:97821049-97821071 ACTGCCTGTGAGACTGAAAAGGG + Intronic
912124503 1:106517486-106517508 GCTGACAATGAGACTTACTTGGG - Intergenic
913065371 1:115247708-115247730 GCAGACATTGAGACGGAATTTGG + Intergenic
914843261 1:151265553-151265575 GGTGCCAGTGACTTTGAATTTGG + Exonic
915153298 1:153852948-153852970 GCTGCCACTGACACAGACTTGGG + Intronic
915650143 1:157303731-157303753 ACAGCCAGTGTGACTGTATTTGG + Intergenic
915661376 1:157408441-157408463 ACAGCCAGTGTGACTGTATTTGG - Intergenic
915999219 1:160598537-160598559 GCTACCAGGGAGACTGAGGTGGG + Intergenic
916336852 1:163681908-163681930 GCTGTCTGTGAGGCTGAGTTTGG - Intergenic
917427531 1:174930427-174930449 GCTACCAGAGAGACTGAGGTAGG - Intronic
918296155 1:183159409-183159431 GCTGCCTGGGAGACTGAAGCAGG - Intergenic
919164025 1:193869318-193869340 GGTTCCAATTAGACTGAATTTGG + Intergenic
919829783 1:201532197-201532219 GGTGCCAGTGAGGCTGACTGTGG - Intergenic
919982304 1:202649923-202649945 GCAGCCTGGGAGACTGAAGTTGG - Intronic
920359091 1:205400171-205400193 GCTACCTGGGAGACTGAAGTGGG - Intronic
924022696 1:239801045-239801067 GGTGCCAGGGAGGCTTAATTAGG + Intronic
1065826856 10:29580234-29580256 GCTGCTTGTGAGGCTGAAGTGGG + Intronic
1065993798 10:31037453-31037475 ACTCCCAGTGTGACTGGATTTGG + Intergenic
1066444363 10:35468306-35468328 GCTCCCAGTGTGACAGTATTTGG - Intronic
1066503221 10:36015033-36015055 GCTGGCAGTGACAATGAACTGGG - Intergenic
1066631968 10:37466908-37466930 GCTGCTAGGGAGACTGAGTTGGG - Intergenic
1067092489 10:43275340-43275362 TGTCCCAGTGAGACTGATTTTGG + Intergenic
1069087186 10:64154800-64154822 GATGCCAGTCATACTGGATTAGG - Intergenic
1069658481 10:70107695-70107717 GCGGGCTGTGAAACTGAATTAGG - Intronic
1070545625 10:77450165-77450187 GCTACTCGGGAGACTGAATTAGG - Intronic
1070680421 10:78445182-78445204 GATGCCAATCATACTGAATTAGG + Intergenic
1071159088 10:82725928-82725950 ACTCCCAATGAGACTGTATTTGG + Intronic
1071292380 10:84197037-84197059 GTTGGCAGTGAGTCTGAGTTTGG + Intronic
1072290333 10:93959322-93959344 GGTGCCAGTGACTTTGAATTTGG - Intergenic
1072877359 10:99186892-99186914 GCTACTAGGGAGACTGAAGTGGG - Intronic
1072983297 10:100117664-100117686 GCTACCAGGGAGACTGAGGTGGG + Intergenic
1073373132 10:103008665-103008687 GCTACCAGGGAGACTGAAGCAGG + Intronic
1073704022 10:105961687-105961709 GCTCCCAGTGAGACTGGCTGAGG - Intergenic
1077964504 11:7114245-7114267 GCTACCAGGGAGGCTGAAGTGGG + Intergenic
1077978663 11:7276362-7276384 GCTTCCATTGAGGCTGGATTTGG - Intronic
1078018788 11:7638170-7638192 GCTTCCAGAGGGACTGAATCAGG + Intronic
1078261098 11:9709597-9709619 GCTGCCCGGGAGGCTGAAGTTGG - Intronic
1078371489 11:10750507-10750529 GCTACCAGGGAGACTGAAACAGG - Intergenic
1078869783 11:15332670-15332692 GCCCCCAGTGATACTGTATTTGG - Intergenic
1080910600 11:36594298-36594320 GCTTGCAGTGGGACTGAATGAGG + Intronic
1081249956 11:40817158-40817180 CCTGCCAGTGTGTCTGAACTTGG + Intronic
1081300604 11:41446444-41446466 GCTGCCAGTGAGGCTAACTTGGG - Intronic
1081762928 11:45589765-45589787 TCTGCCAGTGATACTGATTTTGG + Intergenic
1081963428 11:47154896-47154918 GGTGCCACTGAGACTGAACCGGG + Intronic
1082757980 11:57096830-57096852 ACTCCCAATGTGACTGAATTTGG - Intergenic
1083222420 11:61261692-61261714 GCTACCTGTGAGACTGAAGTAGG + Intronic
1084099860 11:66940308-66940330 ACTACCAGGGAGACTGAAGTGGG - Intronic
1084111169 11:67015082-67015104 GGGGCCAGAGAGACCGAATTGGG - Intronic
1085331735 11:75657666-75657688 GCTTCCAGTGAGACCCATTTTGG - Intronic
1086747795 11:90452135-90452157 GATCCCTGTGAGACTGACTTAGG - Intergenic
1086783938 11:90941601-90941623 CCTCCCAGTGAAACTGATTTTGG - Intergenic
1087395007 11:97585964-97585986 GATGCCAGTTATATTGAATTAGG + Intergenic
1087557358 11:99738230-99738252 GATACCAGTCAGACTGGATTAGG - Intronic
1087646441 11:100813589-100813611 GCAGAGAGTGAGAGTGAATTAGG + Intronic
1088086062 11:105981870-105981892 CCTGCCTGTGAGACTGAGTTAGG + Exonic
1088915105 11:114221633-114221655 GCTGCCAGAGTGGCTGAGTTGGG + Intronic
1089932572 11:122328922-122328944 ACTGCCAGTGTGACTGTACTTGG + Intergenic
1090550603 11:127815703-127815725 ACTTCCATTGAGACTGAAATGGG + Intergenic
1090787528 11:130063063-130063085 GCTACCTGGGAGACTGAAGTGGG + Intergenic
1090841139 11:130488096-130488118 GCTGCCAGTGAGACTCCATGAGG - Intergenic
1091049534 11:132354948-132354970 GAACCCAGTGAGACTGATTTTGG - Intergenic
1093379054 12:18469170-18469192 GCTGCCAGTCACACTGACGTAGG - Intronic
1094277898 12:28699590-28699612 GCTACCAGTCAGATTGGATTAGG - Intergenic
1094566550 12:31603590-31603612 GCTACCAGGGAGACTGAGGTGGG + Intergenic
1096769005 12:53920988-53921010 CCTGCCAGTGAGACTCACTAAGG - Intergenic
1097737401 12:63196898-63196920 GCTGCCAGGGAGTTTGAACTGGG + Intergenic
1098528534 12:71514033-71514055 GCTACCAGAGAGGCTGAGTTGGG + Intronic
1098602361 12:72347039-72347061 GATGCCAGTGATACTGGATTAGG + Intronic
1100159364 12:91840410-91840432 GCTACCTGGGAGGCTGAATTAGG - Intergenic
1100474080 12:94919609-94919631 GCTGCCAGTTAGACTTTCTTAGG - Intronic
1100659596 12:96682485-96682507 GCTGCTTGGGAGACTGAAGTGGG - Intronic
1101638345 12:106566320-106566342 GCCCCCAGTGTGACTGTATTTGG + Intronic
1103263054 12:119605538-119605560 GCTGCCTGGGAGGCTGAACTGGG - Intronic
1104250787 12:127091514-127091536 GCTACCAGGGAGGCTGAAGTGGG - Intergenic
1106155052 13:27146872-27146894 GATGCCAGTCATACTGGATTAGG - Intronic
1107632534 13:42356610-42356632 GAGCCCAGTGAGACTGATTTTGG + Intergenic
1108526622 13:51291084-51291106 GCTTCCAGTCAGAATTAATTTGG + Intergenic
1108955710 13:56154943-56154965 GCTGCCTGGGAGACTGAGGTGGG + Intergenic
1110686912 13:78386275-78386297 GCTACTAGGGAGACTGAAGTGGG + Intergenic
1111050161 13:82872499-82872521 GCTGCCAGTGAGGCAAGATTGGG - Intergenic
1111468034 13:88643301-88643323 GCTGCCTGTGAGCCTGAGTTTGG - Intergenic
1111987426 13:95079118-95079140 GCTGCCAGTGAGGGTGAGCTGGG + Intronic
1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG + Intronic
1112446930 13:99472616-99472638 GCTCCTTGGGAGACTGAATTGGG + Intergenic
1112971425 13:105267307-105267329 ACTGACAGTGAAACTAAATTTGG - Intergenic
1114516718 14:23304880-23304902 GCTACCAGGGAGGCTGAAGTGGG + Intronic
1115901890 14:38160795-38160817 GAAGCCTGTGAGACTGGATTAGG + Intergenic
1117004357 14:51403510-51403532 GCTACCAGGGAGGCTGAAGTGGG - Intergenic
1117364574 14:55013112-55013134 GCTGCCCGGGAGGCTGAACTGGG + Intronic
1117396346 14:55314013-55314035 GCTGCCTGTGAGGCTGAGTTAGG - Intronic
1117404918 14:55392535-55392557 GCTACCAGGGAGACTGAGGTGGG + Intronic
1117442233 14:55770892-55770914 GCTGCTAGGGAGGCTGAAGTGGG + Intergenic
1118170059 14:63379944-63379966 GCTACTAGGGAGACTGAGTTGGG - Intronic
1118438941 14:65795548-65795570 GCTACTTGTGAGACTGAAGTGGG + Intergenic
1119892250 14:78191701-78191723 GCCACCAGTGTGACTGAATGAGG + Intergenic
1120504645 14:85339880-85339902 GATGCCAGTCAGATTGGATTAGG - Intergenic
1121149113 14:91614544-91614566 GCTACCAGGGAGACTGAGGTGGG + Intronic
1122551460 14:102552333-102552355 TCTGCCAGGGAGCCTGATTTTGG + Intergenic
1202904902 14_GL000194v1_random:63766-63788 TCTCCCAGTGTGACTGTATTTGG - Intergenic
1124369369 15:29094953-29094975 GCTGCCTGGGAGGCTGAAGTGGG + Intronic
1124448834 15:29765778-29765800 GCTACCAGGGAGGCTGAAGTGGG + Intronic
1124796628 15:32787447-32787469 GCTGCTAGTGAAACTGACCTGGG - Intronic
1125164124 15:36682656-36682678 GCTACCAGGGAGACTGAGATGGG + Intronic
1125423372 15:39526515-39526537 GCTGCTTGGGAGGCTGAATTGGG - Intergenic
1125911890 15:43447610-43447632 GGTGGCAATGAGACAGAATTTGG - Intronic
1126757609 15:51939886-51939908 GGTGCCAGTGAGACTTCTTTGGG - Intronic
1127436756 15:58965489-58965511 GCTACCAGGGAGGCTGAAGTGGG - Intronic
1127788225 15:62375276-62375298 GCTGTCTGAGTGACTGAATTGGG - Intergenic
1127900894 15:63340181-63340203 GCTGCCAATGAAACTAAATGAGG + Intronic
1128203051 15:65826366-65826388 GCTACCAGGGAGACTGAGGTGGG - Intronic
1129703340 15:77780646-77780668 ACCCCCAGTGAGACTGTATTTGG + Intronic
1131100480 15:89685090-89685112 GCTACTAGGGAGACTGAAGTGGG + Intronic
1131924876 15:97371780-97371802 GCTGTCAGTGTGTCTGAATCGGG - Intergenic
1132200749 15:99953137-99953159 ACCCCCAGTGTGACTGAATTTGG + Intergenic
1134255000 16:12603337-12603359 GCTGCAGTTGAGACTAAATTGGG - Intergenic
1134285345 16:12856762-12856784 GCTGACAGTGAGATTGGAATAGG - Intergenic
1134440079 16:14294221-14294243 GCTGCTAGGGAGACTGAGGTGGG + Intergenic
1135331023 16:21559915-21559937 GCTACCTGGGAGACTGAAGTGGG - Intergenic
1135386679 16:22047757-22047779 GCTGACACTGAGACAGAGTTAGG + Intronic
1137521996 16:49202383-49202405 GACACCAGTGACACTGAATTAGG - Intergenic
1139562535 16:67752713-67752735 GCAGCCAGTGATACTAAATGAGG - Intronic
1141351777 16:83304796-83304818 GCTGCTAGTAAGAGTGAATTAGG + Intronic
1141381552 16:83581705-83581727 GCTGCTAGGGAGACTGAGGTGGG + Intronic
1142311064 16:89314110-89314132 GCTGCAAGGGAGGCTGAAGTAGG + Intronic
1143607193 17:7994297-7994319 GGGCCCAGTGAAACTGAATTCGG - Intergenic
1143640156 17:8191431-8191453 GCTACCCGGGAGACTGAGTTAGG - Intergenic
1143959223 17:10700650-10700672 GCTACCAGGGAGGCTGAATTAGG + Intronic
1144007748 17:11116387-11116409 GGAGCCAGGGAGACTGAATAGGG + Intergenic
1145812744 17:27774344-27774366 GCTGCCCGGCAGACTGGATTTGG - Exonic
1147814072 17:43195707-43195729 GCTACCAGGGAGACTGAAGTGGG + Intronic
1148445838 17:47736644-47736666 GGGGCTAGTGGGACTGAATTGGG - Intronic
1149707480 17:58708015-58708037 TCTCCCAGTGTGACTGTATTTGG - Intronic
1150253629 17:63725461-63725483 GCTGCTAGGGAGACTGAAGCAGG - Intronic
1150337875 17:64343463-64343485 TCTGCCAGGGAGACGGACTTGGG - Intronic
1150803409 17:68300049-68300071 GCTGCTAGGGAGGCTGAAGTGGG - Intronic
1151785545 17:76273250-76273272 ACTGCAAGTGAGACTGAGCTTGG - Intergenic
1151890127 17:76946825-76946847 GATGGCAGTGAGACTGGAATGGG + Intronic
1152279251 17:79375711-79375733 GCTGGCAGTGAGGTTGAATTGGG - Intronic
1153792261 18:8589291-8589313 CCTGCCAGTCACACTGGATTAGG + Intergenic
1154340905 18:13501329-13501351 CCTGCCAGTGAGAGAGATTTTGG + Intronic
1156552328 18:38030546-38030568 CCTCCCAGTGTGACTGTATTTGG - Intergenic
1157894553 18:51452540-51452562 GATACCAGTCAGATTGAATTAGG - Intergenic
1158399245 18:57105982-57106004 ACTCCCAGTGTGACTGTATTTGG - Intergenic
1159438245 18:68445680-68445702 GCTACAAGGGAGACTGAAGTGGG - Intergenic
1159829725 18:73260915-73260937 AATGCCAGTAAGCCTGAATTTGG - Intronic
1160399108 18:78596242-78596264 GCTGATGGTGAGACTGAATGAGG + Intergenic
1161365434 19:3876578-3876600 GCTGCCAGGGAGGCTGAGATAGG + Intergenic
1161949047 19:7457292-7457314 GATGCCAGTCAGATTGGATTTGG + Intronic
1162429162 19:10616852-10616874 GCTACCAGGGAGACTGAGGTGGG - Intronic
1162603293 19:11687174-11687196 ACTTCCAGTCAGACTGAATTGGG + Intergenic
1162928173 19:13940932-13940954 GCTACCAGGGAGGCTGAAGTGGG + Intronic
1163038572 19:14586235-14586257 GCTGCCAGGGAGGCTGAGTCAGG - Intronic
1163039266 19:14590498-14590520 GCTGCCAGGGAGACTGAGTCAGG - Intronic
1163206382 19:15806515-15806537 GCTACCTGGGAGACTGAACTGGG - Intergenic
1164479577 19:28601106-28601128 GCTGCCCTTGAAGCTGAATTTGG - Intergenic
1164525152 19:29008140-29008162 GCTGCAAGGGAGACTGAGGTGGG - Intergenic
1164624279 19:29715806-29715828 GCTGCCAGTGAGGCTGAGGAGGG + Intergenic
1164982061 19:32621514-32621536 GCTGCTAGGGAGGCTGAAGTAGG + Intronic
1165195227 19:34097346-34097368 GCTACTAGGGAGACTGAAGTGGG - Intergenic
1165472792 19:36013243-36013265 TCTGACAGTAAGAATGAATTTGG + Intronic
1166681221 19:44768333-44768355 GCTACTAGGGAGACTGAAGTGGG + Intergenic
1167091063 19:47344233-47344255 GCTACTAGGGAGACTGAAGTGGG + Intergenic
925031933 2:656966-656988 GCCACCAGTGGGACTGTATTTGG - Intergenic
925473555 2:4188496-4188518 TGTGCCTGTGAGACTGAATTTGG + Intergenic
925656147 2:6151562-6151584 GCTACCTGTGAGGCTGAAGTGGG - Intergenic
926310939 2:11675844-11675866 ACTCCCAGTGTGACTGTATTTGG + Intergenic
927006982 2:18861268-18861290 GCTGCCAGTGAGAGTTAAGGTGG + Intergenic
927686174 2:25172544-25172566 GCTACTAGAGAGACTGAAGTGGG - Intergenic
927805456 2:26142878-26142900 GCTGCCTGGGAGACTGAGGTGGG + Intergenic
927854710 2:26520704-26520726 GCTGCCCCTGAGTCTCAATTTGG + Intronic
928530588 2:32186883-32186905 GCTACTCATGAGACTGAATTGGG + Intronic
928929585 2:36610649-36610671 GATACCAGTCAGACTGGATTAGG - Intronic
929044364 2:37775778-37775800 GCTGCCAACAAGACTGAATTAGG - Intergenic
929703764 2:44188978-44189000 GCTACCCGGGAGACTGAAGTGGG - Intronic
930493638 2:52109729-52109751 GCCTCCAATGTGACTGAATTTGG + Intergenic
930735785 2:54777229-54777251 GCTGGCAGTGAGAAGGCATTTGG - Intronic
931314902 2:61119848-61119870 GCTACTAGCGAGACTGAAGTAGG + Intronic
931450082 2:62361221-62361243 GCTACCTGAGAGACTAAATTAGG - Intergenic
931585400 2:63821231-63821253 TCTGCCAGGGAGTCTGAACTTGG + Intronic
931638265 2:64359957-64359979 GCTGCCAGTGAGACACACTCAGG - Intergenic
931780123 2:65572281-65572303 GATACCAGTAATACTGAATTAGG - Intergenic
934091361 2:88553433-88553455 GCTGCCTGGGAGGCTGAAGTGGG - Intergenic
934501737 2:94866692-94866714 TCTCCCAGTGTGACTGTATTTGG + Intergenic
934682626 2:96296019-96296041 GCTACCAGGGAGGCTGAAGTGGG + Intronic
937256656 2:120560733-120560755 GCAGGCACTGAGACTGACTTAGG - Intergenic
941626191 2:167833175-167833197 TCTGGCAGGGAGACTGCATTAGG - Intergenic
941745420 2:169081753-169081775 GCTGCCTGTCTGACTGAATCAGG + Exonic
942035125 2:172003320-172003342 GCTGGGAGTGAGACTGAGATAGG - Intronic
944640900 2:201724541-201724563 GCTACCAGTGAGACTGAGTATGG - Intronic
944937443 2:204584002-204584024 GTTGCCAGGGAGACTGAAGTTGG + Intronic
946449582 2:219768348-219768370 GCTTTCAGTGAGACTGATTTTGG + Intergenic
946841067 2:223820824-223820846 GCTGCCCATGAGAATGAGTTTGG - Intronic
947024094 2:225716952-225716974 GCAGACACTGAGACAGAATTTGG + Intergenic
947708932 2:232299022-232299044 GCTGAGAGAAAGACTGAATTTGG - Intronic
947771268 2:232672262-232672284 TCTGTCAGTGAGACTGACTCTGG + Intronic
948287934 2:236801494-236801516 GCTGCCACTGTCACTGAATGAGG - Intergenic
948385291 2:237577061-237577083 GGTGCAAGTGAGAGTGAATGTGG + Intronic
948831461 2:240600413-240600435 GCACCCAGTGAGCCTGATTTGGG + Intronic
1174807323 20:53615942-53615964 GCTACCTGGGAGACTGAGTTGGG + Intergenic
1175310388 20:58007686-58007708 GATGCCAGTCACACTGGATTAGG - Intergenic
1176624265 21:9078524-9078546 TCTCCCAGTGTGACTGTATTTGG - Intergenic
1177148700 21:17433062-17433084 GACACCAGTCAGACTGAATTAGG - Intergenic
1177363695 21:20105345-20105367 TCTGCCAGTGATATTGAAATGGG - Intergenic
1178569799 21:33725486-33725508 GCTGCTAGGGAGGCTGAAGTGGG + Intronic
1178886167 21:36486482-36486504 GGTGCCAGTGACTTTGAATTTGG - Intronic
1180205063 21:46254707-46254729 GCTGCCAGTGTGACAGATTGGGG + Intronic
1181846964 22:25718300-25718322 GCTGCCACTGAGTCAGAAATGGG - Exonic
1182164122 22:28155067-28155089 CCAGCCAGGGAGACTGAATCAGG - Intronic
1182433125 22:30312409-30312431 GCTGCTCGGGAGACTGAAGTGGG + Intronic
1183046994 22:35228294-35228316 ACTCCCAGTGAGACTGTATTTGG + Intergenic
1184766316 22:46574372-46574394 CCTCCCAATGAGACTGCATTTGG - Intergenic
950445295 3:13033997-13034019 GGTGCCAGTCAGACTGCATTAGG + Intronic
950995800 3:17494715-17494737 GGTGCCAGGGAGACTGGGTTCGG - Intronic
952810486 3:37398145-37398167 GCTCCCAATGTGACTGTATTTGG - Intronic
953985009 3:47434920-47434942 TCTGCCAGTGAGATTGAGGTTGG - Intronic
955513537 3:59705208-59705230 GGTGCCAGTCAGATTGCATTGGG - Intergenic
956256579 3:67289841-67289863 GCAGACATTGCGACTGAATTAGG + Intergenic
959536230 3:107488505-107488527 CCTGTGAGTGAGACTGATTTGGG + Intergenic
960210622 3:114960974-114960996 GGTCCCAGTGAGAGTTAATTTGG + Intronic
961230916 3:125307754-125307776 GCTGCTTGGGAGGCTGAATTGGG - Intronic
962423360 3:135247961-135247983 GCTTCCAGTAAGGCAGAATTGGG + Intronic
962484907 3:135832998-135833020 GATGCCAGTCATATTGAATTAGG + Intergenic
962736854 3:138333161-138333183 GCTGCCTGGGAGGCTGAAGTGGG - Intergenic
963859216 3:150290530-150290552 GCTACCACTGAGGCTGAGTTGGG - Intergenic
965766456 3:172135747-172135769 GCAGTCAATGAGTCTGAATTTGG - Intronic
966053997 3:175659856-175659878 GCTTCCAAGGAAACTGAATTCGG + Intronic
966602022 3:181785337-181785359 GCAGTCAGATAGACTGAATTTGG + Intergenic
967543804 3:190699868-190699890 ACTGCCAATGTGACTGTATTTGG + Intergenic
967723142 3:192836495-192836517 ACTACCAGTCAGATTGAATTAGG - Intronic
967849151 3:194069539-194069561 GCTCCCCGTGTGACTGTATTTGG + Intergenic
969453637 4:7288738-7288760 GCTGCCAATGTGACTGTATCTGG - Intronic
970478837 4:16452381-16452403 GACACCAGTGATACTGAATTTGG + Intergenic
972168192 4:36312664-36312686 ATTGCCAGTGACACTGAACTCGG + Intronic
972197420 4:36671111-36671133 GCTACCAGGGAGGCTGAAGTAGG + Intergenic
972837689 4:42893522-42893544 GCTGCCAGTGAGAAGGGTTTTGG + Exonic
973564527 4:52170843-52170865 GCAGCCAGGAAGATTGAATTGGG - Intergenic
973880661 4:55268527-55268549 GCTGCCAGACAAAGTGAATTAGG + Intergenic
974339497 4:60596954-60596976 ACTTCCAGTGTGACTGTATTAGG + Intergenic
974836689 4:67259813-67259835 GATGTCAGTCAGACTGGATTAGG - Intergenic
976673574 4:87680414-87680436 GCTGCGCCTGAGACTGAAATTGG - Intergenic
976885720 4:89981224-89981246 GATGCCAGTCAGACTGGACTGGG - Intergenic
977045392 4:92062667-92062689 GACACCAGTCAGACTGAATTAGG + Intergenic
977180994 4:93873929-93873951 GCTGTCAGTGAGAATGAAGTTGG + Intergenic
977273446 4:94946938-94946960 GCTACCCGGGAGACTGAAGTGGG + Intronic
978592670 4:110343100-110343122 GCTGCCTGTGAGGCTGAGTCTGG - Intergenic
978763550 4:112380985-112381007 GAAGCCAGTGGGCCTGAATTTGG + Intronic
979458453 4:120952811-120952833 GATGCCAGTCATATTGAATTAGG + Intergenic
980686127 4:136231496-136231518 GATGCCAATGAGATTGGATTGGG - Intergenic
980961590 4:139481301-139481323 GATGCCAGTCATACTGGATTAGG + Intergenic
981216627 4:142177097-142177119 GCTCCAAAGGAGACTGAATTAGG - Intronic
983102762 4:163645272-163645294 GCTGCTACTGAGACTGCAATGGG - Intronic
983912718 4:173258018-173258040 TCTCCCAGTGAGATTGAGTTGGG + Intronic
986617110 5:9629121-9629143 GCTGTCAGTGAGAGAGAAGTTGG - Exonic
986898430 5:12400346-12400368 GACACCAGTGATACTGAATTAGG - Intergenic
987729362 5:21748821-21748843 GATGCCAGTTATACTGTATTAGG - Intergenic
988404193 5:30803342-30803364 GCTGACATTGAGACAGAAATTGG - Intergenic
988581539 5:32473073-32473095 GCTGCCTGGGAGACTGAGGTAGG + Intergenic
988583760 5:32491183-32491205 GCTCCCAGTGGGGCTGAATCCGG - Intergenic
989341496 5:40380296-40380318 GCTACCAGTGAGAAAGAAGTAGG - Intergenic
990442517 5:55860998-55861020 GATGCCAGTCAGATTGGATTAGG + Intronic
991083878 5:62630605-62630627 GCTGCCTGGGAGACTGAGGTGGG - Intergenic
991594388 5:68288181-68288203 GCAGCCAGTGAGACTATTTTAGG + Intronic
991661211 5:68952475-68952497 GATGGCAATTAGACTGAATTTGG - Intergenic
991668328 5:69022254-69022276 GATGCCAGTCAAACTGGATTAGG - Intergenic
992136289 5:73749418-73749440 GCTACCAGGGAGGCTGAAGTGGG + Intronic
992437874 5:76772810-76772832 GCTGCTAGGGAGGCTGAAGTGGG + Intergenic
992913601 5:81424077-81424099 GCTTCCATTTTGACTGAATTGGG - Intronic
993004885 5:82419253-82419275 GATGCCAGTAACACTGAATTAGG - Intergenic
993574412 5:89583809-89583831 GACACCAGTCAGACTGAATTAGG + Intergenic
994801101 5:104377762-104377784 GCTGCCAATGTGACTTTATTTGG + Intergenic
995271702 5:110227620-110227642 GTTGCCAGTGAGACTTAGTTAGG + Intergenic
996850825 5:127950088-127950110 GCTACCAGGGAGGCTGAAGTGGG - Intergenic
998244719 5:140489076-140489098 GCTGCTAGGGAGACTGTAGTGGG + Intronic
998491994 5:142555143-142555165 GATGCCAGCGAGATTGGATTCGG + Intergenic
1000209682 5:159098000-159098022 GGTGGTAGTGAGAGTGAATTGGG - Intronic
1001107581 5:168868400-168868422 GCTGCTAGGGAGACTAAAGTGGG - Intronic
1001127753 5:169035625-169035647 GGTGACAGTGAGACTGCATCTGG + Intronic
1001336995 5:170807058-170807080 GCTACCAGTGAGACTGAGGTGGG - Intronic
1002440481 5:179261981-179262003 GCTGCCTGTGGGGCTGCATTGGG + Intronic
1002647975 5:180671537-180671559 GCTTCCAGGGAGATTGAAGTGGG - Intergenic
1003820935 6:9896324-9896346 GTTACCAGTGAGACTGAGCTGGG - Intronic
1003882585 6:10491767-10491789 GCTGCCAGAGTGCCCGAATTGGG + Intergenic
1004366155 6:15014486-15014508 GTTGACAGTGTGACTGATTTGGG - Intergenic
1004366536 6:15017895-15017917 CCTGCCAGTGAGTCTGAATCTGG - Intergenic
1004655553 6:17656484-17656506 GCTACCAGGGAGGCTGAAGTGGG - Intronic
1004972286 6:20923898-20923920 GCTACCAGGGAGGCTGAAGTGGG + Intronic
1005879150 6:30041419-30041441 GCTGCTCATGAGGCTGAATTGGG + Intergenic
1006995336 6:38254523-38254545 GCTGCCTGGGAGACTGAGGTGGG + Intronic
1008773912 6:55011326-55011348 GCTTCCAATCAGATTGAATTAGG + Intergenic
1010165623 6:72911706-72911728 GCTGTCAGTGAGTGTGCATTAGG + Intronic
1011841780 6:91509953-91509975 GTTGCCAATGACCCTGAATTCGG - Intergenic
1012100147 6:95073776-95073798 AATGCCAGTGTGACTGTATTTGG - Intergenic
1012582372 6:100884197-100884219 GTTACCAAGGAGACTGAATTTGG + Intergenic
1012695472 6:102376686-102376708 GCTGCTTGGGAGGCTGAATTGGG - Intergenic
1014112015 6:117628858-117628880 GTTGTCAGTGACTCTGAATTAGG - Intergenic
1014366364 6:120547638-120547660 CCTACCAGTGAGAATGAAATGGG + Intergenic
1015326906 6:131933750-131933772 CCTGAAAGTGAGACTGAGTTGGG - Intergenic
1015405803 6:132835733-132835755 GCAGACAGTCAGATTGAATTAGG - Intergenic
1016229296 6:141783375-141783397 TCTGGCATTGAGACTAAATTGGG - Intergenic
1016669966 6:146693192-146693214 CCTGCCAGTGTGGCTGCATTTGG + Intronic
1016903026 6:149120701-149120723 GACGCCAGTTAGATTGAATTAGG - Intergenic
1017582506 6:155881824-155881846 GCTGCCAGTGAGATTCAACTTGG - Intergenic
1018855484 6:167671559-167671581 GATGGCAGTGAGACTGAAGATGG - Intergenic
1018855524 6:167671930-167671952 GATGGCAGTGAGACTGAAGATGG - Intergenic
1019155282 6:170034355-170034377 GCTCCCAGTGAGACTGTATTTGG - Intergenic
1019833475 7:3357460-3357482 GATGCCAGGGAGACTGAGGTGGG - Intronic
1020309296 7:6856388-6856410 GCTGCTTGTGAGACTGAGGTGGG - Intergenic
1020786338 7:12577742-12577764 GCTGCTTGTGAGACTGAGGTAGG + Intronic
1021697493 7:23288566-23288588 GCTCCCAGGGAGGCTGAAGTGGG + Intergenic
1023803079 7:43851727-43851749 GCTGTCTGTGAGGCTGAATCTGG - Intergenic
1024011003 7:45266657-45266679 GATGCCAGTCATACTGCATTAGG + Intergenic
1027611600 7:80368410-80368432 GCTACCAGGGAGACTGAAGTAGG - Intergenic
1027707999 7:81558449-81558471 ACTCCCAGTGTGACTGCATTTGG - Intergenic
1029179881 7:98692760-98692782 GCTCTTGGTGAGACTGAATTAGG - Intergenic
1029277074 7:99412538-99412560 GCTGCCTGGGAGACTGAGGTGGG - Intronic
1030719988 7:112859589-112859611 CCTGCCAGTGGGACAAAATTTGG + Intronic
1032141937 7:129339641-129339663 GCTACCAGAGAGGCTGAAGTGGG - Intronic
1032172754 7:129599555-129599577 GATGCCAGTCATACTGAATTAGG - Intergenic
1035519194 8:263475-263497 GCTGCTAGGGAGACTGAGATGGG + Intergenic
1036684471 8:10900111-10900133 GTTGCCAGTGGGACAGCATTCGG - Intronic
1036915754 8:12801999-12802021 GTTGCCAGTGATACTGCATTGGG - Intergenic
1037681142 8:21098564-21098586 ACTCCCAGTGTGACTGAGTTTGG - Intergenic
1037858260 8:22387059-22387081 GCTGCCCGTGAGGCTGAGGTGGG + Intronic
1038373849 8:27018285-27018307 ACTCCCAGTGTGACTGTATTTGG - Intergenic
1039740430 8:40377984-40378006 GCTGCAATAGAGACTGTATTTGG + Intergenic
1040137580 8:43872972-43872994 GCTATCTGTGAGACTGATTTTGG + Intergenic
1040283341 8:46083185-46083207 GCTACCTGTGAAACTGATTTAGG + Intergenic
1041876240 8:62690577-62690599 GCTGCCAGCCAGACTGACTGAGG - Intronic
1043414105 8:80030648-80030670 GGTGCCAGAGAGTCTGCATTTGG - Intronic
1045685379 8:104706017-104706039 GCTGCCAGAGTGATTGAAGTTGG + Intronic
1048429938 8:134360876-134360898 GCTCCCACTGAGACTACATTTGG - Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049076618 8:140401733-140401755 GGTACCAGTGAGGCTGAAGTGGG - Intronic
1049984047 9:931788-931810 GCTCCCAATGTGACTGTATTTGG - Intronic
1050356540 9:4788926-4788948 GCTACCAGGGAGGCTGAAGTGGG + Intergenic
1051151216 9:14081213-14081235 GCTTTCAGTGAGGCTGGATTTGG + Intergenic
1051238244 9:15024414-15024436 GCTGCCAGTGAGGTTGGGTTGGG - Intergenic
1051962381 9:22783024-22783046 CGTGCCAGTGACACTGGATTTGG + Intergenic
1052811017 9:33060118-33060140 GCTGCCTGGGAGGCTGAAGTGGG - Intronic
1053104518 9:35398586-35398608 GCTGCAGGTGAAACTGAATACGG + Exonic
1053311674 9:37024653-37024675 GCTGCCAGGGAGATTGAAAATGG + Intronic
1054909405 9:70440163-70440185 GCTGCCTGGGAGACTGAGGTGGG + Intergenic
1055852092 9:80644251-80644273 GCTGCCTGGGAGGCTGAATCTGG - Intergenic
1058164146 9:101601797-101601819 GATGCCAGTCATACTGGATTCGG + Intronic
1059740353 9:117143991-117144013 ACTCCCAGTGTGACTGTATTTGG + Intronic
1060319491 9:122543312-122543334 GCTACTTGGGAGACTGAATTGGG - Intergenic
1061976491 9:134070527-134070549 GCTGCCATTGAGAAGGGATTTGG + Intergenic
1061982214 9:134112330-134112352 GCTGCCAGGGAGGCTGAGGTAGG + Intergenic
1062114010 9:134797857-134797879 TTTGCCAGTGTAACTGAATTAGG - Intronic
1203747445 Un_GL000218v1:48956-48978 TCTCCCAGTGTGACTGTATTTGG - Intergenic
1203562276 Un_KI270744v1:68790-68812 TCTCCCAGTGTGACTGTATTTGG + Intergenic
1192153738 X:68727780-68727802 CCTGCCAGTGAGACTCCATAGGG + Intergenic
1192480717 X:71483079-71483101 GCTGCTAGAGAGGCTGAGTTGGG - Intronic
1192750224 X:73982761-73982783 GCTGCCAGGGAGGCTGAGGTGGG + Intergenic
1194139874 X:90196336-90196358 GCTGCCAGGAAGTTTGAATTGGG + Intergenic
1194174478 X:90629384-90629406 GCTACCAGGGAGACTGAGGTTGG + Intergenic
1194937898 X:99973059-99973081 GATGCCAGTCAGATTGGATTAGG + Intergenic
1195571061 X:106399239-106399261 ACTCCCAATGTGACTGAATTTGG - Intergenic
1195645705 X:107228725-107228747 GCTACCAGAGAGGCTGAAGTGGG - Intronic
1196215113 X:113041374-113041396 GATGCCTGTGGAACTGAATTAGG + Intergenic
1198860950 X:141069829-141069851 GCTGCCAGTAAGGCTGAATGAGG + Intergenic
1198901742 X:141517554-141517576 GCTGCCAGTAAGGCTGAATGAGG - Intergenic
1199848360 X:151707771-151707793 GATGCCAGTCAGATTGGATTAGG + Intergenic
1200046525 X:153405770-153405792 GCAGCCTCTGAGACTTAATTGGG - Intergenic
1200126885 X:153819429-153819451 GTTGCCAGTGAGAGTGAAAGGGG - Intronic
1200485622 Y:3765305-3765327 GCTGCCAGGAAGTTTGAATTGGG + Intergenic
1201160772 Y:11163940-11163962 TCTCCCAGTGTGACTGTATTTGG - Intergenic
1202099926 Y:21296595-21296617 GCTGGAAGTGAGATTGATTTTGG + Intergenic