ID: 1112157532

View in Genome Browser
Species Human (GRCh38)
Location 13:96833858-96833880
Sequence CTTCCATCTTTTAGGGAACG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112157522_1112157532 8 Left 1112157522 13:96833827-96833849 CCTGACACCATAACCTTAAGCCA 0: 1
1: 0
2: 0
3: 10
4: 184
Right 1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1112157521_1112157532 18 Left 1112157521 13:96833817-96833839 CCTACAAAATCCTGACACCATAA 0: 1
1: 0
2: 1
3: 26
4: 595
Right 1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1112157519_1112157532 25 Left 1112157519 13:96833810-96833832 CCCACATCCTACAAAATCCTGAC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1112157523_1112157532 1 Left 1112157523 13:96833834-96833856 CCATAACCTTAAGCCATGCCTTT 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1112157520_1112157532 24 Left 1112157520 13:96833811-96833833 CCACATCCTACAAAATCCTGACA 0: 1
1: 0
2: 2
3: 24
4: 263
Right 1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 107
1112157524_1112157532 -5 Left 1112157524 13:96833840-96833862 CCTTAAGCCATGCCTTTCCTTCC 0: 1
1: 0
2: 0
3: 29
4: 326
Right 1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112157532 Original CRISPR CTTCCATCTTTTAGGGAACG GGG Exonic
900990530 1:6096325-6096347 CTTCCTTCTCTTAGGAAACTTGG - Intronic
903708595 1:25305312-25305334 CTCCCATCTTTCAGGGATCTGGG - Intronic
903718516 1:25387099-25387121 CTCCCATCTTTCAGGGATCTGGG + Intronic
905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG + Intergenic
905798722 1:40829990-40830012 CCTCCAACGTTTGGGGAACGTGG + Intronic
919046940 1:192464195-192464217 CTTCCATATTTTAGGGTAGCAGG - Intergenic
920056064 1:203192679-203192701 ATTCCTTCTTTCAGGGAACTGGG + Intergenic
920537115 1:206745014-206745036 CTTCCCTCTATTAGGGCAGGAGG - Intergenic
922553107 1:226511715-226511737 CTTCCTTCTAGTAGGGAAGGAGG + Intergenic
922620929 1:226987717-226987739 CTCCCTTCTTACAGGGAACGGGG - Intergenic
1063253972 10:4305948-4305970 CTTCCCTCTTTTAGAGAAGAGGG + Intergenic
1065636635 10:27742044-27742066 CTTTGATCTTTTAGGAAAAGGGG + Intronic
1066657459 10:37709559-37709581 CTTCCATCTTTCAGGTACCTGGG + Intergenic
1069994479 10:72334042-72334064 CTTCCATGTTTTAGAAAATGAGG - Exonic
1072530909 10:96318073-96318095 CTTCCATCTTTTCTGGACCTTGG + Intronic
1074192076 10:111146786-111146808 CTTCCTTCTATTATGGAAGGTGG + Intergenic
1076076213 10:127535817-127535839 CCTCCTTCTTTCAGGGAAGGGGG + Intergenic
1076741381 10:132487458-132487480 CGTTCATCTTTTACGGAACGTGG + Intergenic
1082618101 11:55386999-55387021 CTTGCATCATTTATAGAACGAGG - Intergenic
1083683233 11:64360807-64360829 CTTTCCTCTTTCAGGGAACTCGG + Intronic
1087011350 11:93516959-93516981 CATCCAGCTTTAAGGGAAGGTGG - Intronic
1089699890 11:120238281-120238303 CTCCCTTCTTTTCGGGAGCGTGG + Intronic
1093899613 12:24616180-24616202 GTCCCATCTTTTGGGGAAAGTGG + Intergenic
1097237967 12:57552592-57552614 CATTCATCATTTAGGGAATGAGG + Intronic
1104571564 12:129930306-129930328 CTTCCATCTCCTAGGTCACGGGG + Intergenic
1106977287 13:35235346-35235368 CTTTTATCTTGTAGGGAATGAGG - Intronic
1110527041 13:76550352-76550374 CTTCCATCTATTAATGAACACGG - Intergenic
1112157532 13:96833858-96833880 CTTCCATCTTTTAGGGAACGGGG + Exonic
1116047894 14:39766426-39766448 CATCCATTGTTTAGGGAACAGGG + Intergenic
1117315730 14:54568472-54568494 CCTCCTTCTTTTGGGCAACGTGG + Intronic
1117392329 14:55273455-55273477 CTTCCTTCTTTTAAGAAATGAGG + Intronic
1117571516 14:57053768-57053790 CTCCCATTTTTTAAGAAACGTGG - Intergenic
1119728492 14:76936580-76936602 CTTCCATCCTCTAGGGATGGAGG - Intergenic
1126603003 15:50447774-50447796 CTTCCTTTTTGTGGGGAACGGGG + Intronic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1126798225 15:52277667-52277689 CTTCCATATTCTAGGTAACAAGG - Intronic
1126906545 15:53374012-53374034 CCTCCATCTGTTAGGGTAAGAGG + Intergenic
1130807371 15:87339567-87339589 CTTCCAACATTTAAGGAATGGGG + Intergenic
1133451899 16:5910852-5910874 CTTCCATCTGTCACGGAACAGGG - Intergenic
1143545663 17:7593625-7593647 CTTCCATCTTTTACCCAACCAGG - Exonic
1144072413 17:11686474-11686496 CTTCCAGCTTTTTAGGCACGTGG + Intronic
1147430040 17:40365187-40365209 TTTACATCTTTTTTGGAACGGGG + Intergenic
1148484816 17:47983805-47983827 CTTCCCTCTTTCAGGGAAAGAGG + Intergenic
1150383930 17:64742672-64742694 ATGCCATCTTTTAGGGACAGTGG + Intergenic
1150855776 17:68751174-68751196 CCTCCCTCCTTTAGGGAGCGGGG - Intergenic
1153170008 18:2305050-2305072 CTTCCATCTATTAAGGAGCAGGG - Intergenic
1157579023 18:48762812-48762834 CTCCCAGCTTTTAGGGAAGACGG - Intronic
1158709124 18:59821455-59821477 CTTCCAGCTCTTAGGGAAATGGG + Intergenic
1164752953 19:30669653-30669675 CTTTCAGGTTTTAGGGAAAGTGG - Intronic
1164964719 19:32472340-32472362 CTCCCAGCTCTTAGGGAAGGCGG - Intronic
1165287649 19:34855495-34855517 CTTACATCTTTTAGCAAACTAGG - Intergenic
930589554 2:53311378-53311400 ATTCCATCTTTTAGGCACCATGG + Intergenic
932845609 2:75133011-75133033 TTTCCAACTTTAAGGGAAGGTGG + Intronic
937133535 2:119531830-119531852 CTTCCCTCTTTTTGGGGACCTGG + Intergenic
941115865 2:161471713-161471735 CTTCTAGCTTCTAGGGAATGGGG + Intronic
941370690 2:164659710-164659732 CTGCCATCTTTTAGGGAATAAGG + Intronic
942699703 2:178691740-178691762 CTTCCCTCTTTTAGAGAAAGAGG - Intronic
943105386 2:183540561-183540583 CTTCCATATTTTAGGAAAAAAGG + Intergenic
946630099 2:221657688-221657710 CCTCTATCTTTTAGGGTATGAGG + Intergenic
947994042 2:234512189-234512211 CTACCATCATTTAGGCAACTTGG - Intergenic
1171233650 20:23507753-23507775 CTACCATCTTTTAAGGAATTTGG - Intergenic
1173371865 20:42443691-42443713 CACCCATCTTTCAGGGAAGGTGG + Intronic
1175070573 20:56330281-56330303 CTTTCACCTTTAAGGGAAGGTGG - Intergenic
1178610589 21:34075162-34075184 CTTACGTGTTTTAGGGAATGTGG + Intronic
1181838229 22:25628916-25628938 CTTCCATCTTTTCAGGGAAGTGG - Intronic
1182042770 22:27251150-27251172 CTTCCATCATTAAGGGGAAGGGG - Intergenic
1183333491 22:37233878-37233900 CTCCCATCTTCCAGGGAAAGAGG + Intronic
949149533 3:748833-748855 GTTCCATTTTGTAGGGAACTGGG + Intergenic
950797448 3:15521471-15521493 CTTCCATCTGTCAGGGGACAGGG - Intronic
952421460 3:33135272-33135294 GTTCCTTCCTTTAGGGAATGGGG - Intronic
953711628 3:45276223-45276245 CTTCCATCTTGAAGGGAGCAAGG - Intergenic
954574025 3:51664990-51665012 CCTCCATCTTTGAAGGAACATGG + Exonic
956180892 3:66517511-66517533 CTTTCCTCTGTTTGGGAACGAGG + Intergenic
956963447 3:74430884-74430906 CTTCTATCCTGTAGGTAACGTGG - Intronic
964575892 3:158167961-158167983 CTGACAGCTTTTAGGGAACTTGG - Intronic
971698676 4:29938776-29938798 CTTACAACTTTGAGGGAACCCGG + Intergenic
977173651 4:93793315-93793337 CTTTAATCTCTTAGGGAAGGAGG - Intergenic
977258210 4:94763939-94763961 CTTCCCTTTATTATGGAACGTGG + Intronic
978335351 4:107661947-107661969 GTTCCATCTTTGAGGAAACAGGG - Intronic
985075725 4:186212284-186212306 CTTCCATCTTTAAAGGAAAAAGG + Intronic
989588395 5:43091134-43091156 CTTCCATCTGTAAGGGCACATGG - Intronic
994038125 5:95225956-95225978 CATCCATCTCTTAGGGAATAGGG - Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996617644 5:125459880-125459902 CTTCCATATGTGAGGGAACTTGG - Intergenic
998402759 5:141856417-141856439 CTCCCATCTTTTGTGGAGCGAGG + Intronic
999678259 5:154029132-154029154 GTTGCATCTTTTAGGCAAAGGGG - Intronic
1000639230 5:163681825-163681847 CTTTCATCTTTTAAGCAACCAGG - Intergenic
1001717009 5:173824536-173824558 TTGCCTTCTTTTAGGGAACAGGG + Intergenic
1005266845 6:24121124-24121146 TTTCCTTCTTTTAGGGCAAGTGG - Intergenic
1006114545 6:31768456-31768478 CTACCATCTTTTTGGGGAGGTGG - Intronic
1006370736 6:33642258-33642280 CGTCCATCCTTCAGGGAACTGGG - Intronic
1006385355 6:33727672-33727694 CTTCCAACTGCTAGGGAAAGAGG + Intronic
1008088389 6:47268049-47268071 CTTCCATCCTTTGGAGAAGGAGG - Intronic
1008237293 6:49065574-49065596 CTACCATCTTTCAGGGAAACAGG - Intergenic
1009164930 6:60329362-60329384 CTTCCATTTTTTGGGGGAGGTGG + Intergenic
1013142125 6:107347570-107347592 ATTATATCTTTTAGGGAAGGAGG + Intronic
1015183184 6:130382852-130382874 CTTCCATCTTCTTGGGGAAGGGG + Intronic
1015814710 6:137196281-137196303 CTTCTATCTTTTGGGGAAAGGGG + Intergenic
1028110396 7:86933860-86933882 ATTCCATCTTCTAGGGGACTAGG + Intronic
1030386401 7:108872535-108872557 CCTCCCTCTTTTAGGGATCTTGG + Intergenic
1031114240 7:117650425-117650447 CTTCCATGTTTTATGAAATGGGG - Intronic
1032509627 7:132462183-132462205 CTTCGATGCTTTAGGGAATGTGG + Intronic
1033645877 7:143303688-143303710 CTTCAAGGTTGTAGGGAACGTGG + Intronic
1038380387 8:27087320-27087342 CTGCTCTCTTTTAGGGAAGGAGG + Intergenic
1038768348 8:30451811-30451833 CTCCTATCTTTTAGGGACTGGGG + Intronic
1038847847 8:31246292-31246314 CTTCCATCTTTTAAAGAAGTGGG - Intergenic
1040945293 8:52877720-52877742 CTTCCATTTGTGAGGCAACGAGG - Intergenic
1048497077 8:134944153-134944175 CTTCCATCTCTTCTGCAACGAGG - Intergenic
1050104065 9:2147287-2147309 CTTCCATCTTTTTGGAATGGGGG - Intronic
1185824237 X:3234351-3234373 ATTCCATCCTTTAGTCAACGGGG - Intergenic
1188063586 X:25630469-25630491 CGTCCATCTTTTAGGGCTAGTGG - Intergenic
1198231530 X:134694314-134694336 CTTCCATCTTCTAGGGAGCTTGG - Intronic
1200064784 X:153499137-153499159 CTTCCTTCTTATAGTCAACGGGG + Intronic
1200157422 X:153984636-153984658 CTTCCCTCTTCTAGGGCACATGG - Intergenic