ID: 1112160292

View in Genome Browser
Species Human (GRCh38)
Location 13:96860018-96860040
Sequence CCCTAGGAGGAGTGGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112160292_1112160300 28 Left 1112160292 13:96860018-96860040 CCATCCAACCACTCCTCCTAGGG No data
Right 1112160300 13:96860069-96860091 GTGAGATGCTTGTATTAGCCAGG No data
1112160292_1112160301 29 Left 1112160292 13:96860018-96860040 CCATCCAACCACTCCTCCTAGGG No data
Right 1112160301 13:96860070-96860092 TGAGATGCTTGTATTAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112160292 Original CRISPR CCCTAGGAGGAGTGGTTGGA TGG (reversed) Intergenic
No off target data available for this crispr