ID: 1112160590

View in Genome Browser
Species Human (GRCh38)
Location 13:96863250-96863272
Sequence GAACACTGCTTGAGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112160588_1112160590 18 Left 1112160588 13:96863209-96863231 CCACTGTTGATTGCTACTCATAT No data
Right 1112160590 13:96863250-96863272 GAACACTGCTTGAGAAAAACTGG No data
1112160587_1112160590 19 Left 1112160587 13:96863208-96863230 CCCACTGTTGATTGCTACTCATA No data
Right 1112160590 13:96863250-96863272 GAACACTGCTTGAGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112160590 Original CRISPR GAACACTGCTTGAGAAAAAC TGG Intergenic
No off target data available for this crispr